Datasets:

---

Marcus2112

/

minipile_density-proportioned_pico

like 0

Q: TCSH script full path In bash shell I can get a full path of a script even if the script is called by source, link, ./..., etc. These magic bash lines: #Next lines just find the path of the file. #Works for all scenarios including: #when called via multiple soft links. #when script called by command "source" aka . (dot) operator. #when arg $0 is modified from caller. #"./script" "/full/path/to/script" "/some/path/../../another/path/script" "./some/folder/script" #SCRIPT_PATH is given in full path, no matter how it is called. #Just make sure you locate this at start of the script. SCRIPT_PATH="${BASH_SOURCE[0]}"; if [ -h "${SCRIPT_PATH}" ]; then while [ -h "${SCRIPT_PATH}" ]; do SCRIPT_PATH=`readlink "${SCRIPT_PATH}"`; done fi pushd `dirname ${SCRIPT_PATH}` > /dev/null SCRIPT_PATH=`pwd`; popd > /dev/null How can you get the script path under the same conditions in TCSH shell? What are these 'magic lines'? P.S. It is not a duplicate of this and similar questions. I'm aware of $0. A: I don't use tcsh and do not claim guru status in it, or any other variant of C shell. I also firmly believe that Csh Programming Considered Harmful contains much truth; I use Korn shell or Bash. However, I can look at manual pages, and I used the man page for tcsh (tcsh 6.17.00 (Astron) 2009-07-10 (x86_64-apple-darwin) on MacOS 10.7.1 Lion). As far as I can see, there is no analogue to the variable ${BASH_SOURCE[0]} in tcsh, so the starting point for the script fragment in the question is missing. Thus, unless I missed something in the manual, or the manual is incomplete, there is no easy way to achieve the same result in tcsh. The original script fragment has some problems, too, as noted in comments. If the script is invoked with current directory /home/user1 using the name /usr/local/bin/xyz, but that is a symlink containing ../libexec/someprog/executable, then the code snippet is going to produce the wrong answer (it will likely say /home/user1 because the directory /home/libexec/someprog does not exist). Also, wrapping the while loop in an if is pointless; the code should simply contain the while loop. SCRIPT_PATH="${BASH_SOURCE[0]}"; while [ -h "${SCRIPT_PATH}" ]; do SCRIPT_PATH=`readlink "${SCRIPT_PATH}"`; done You should look up the realpath() function; there may even be a command that uses it already available. It certainly is not hard to write a command that does use realpath(). However, as far as I can tell, none of the standard Linux commands wrap the realpath() function, which is a pity as it would help you solve the problem. (The stat and readlink commands do not help, specifically.) At its simplest, you could write a program that uses realpath() like this: #include <stdio.h> #include <stdlib.h> #include <string.h> #include <errno.h> int main(int argc, char **argv) { int rc = EXIT_SUCCESS; for (int i = 1; i < argc; i++) { char *rn = realpath(argv[i], 0); if (rn != 0) { printf("%s\n", rn); free(rn); } else { fprintf(stderr, "%s: failed to resolve the path for %s\n%d: %s\n", argv[0], argv[i], errno, strerror(errno)); rc = EXIT_FAILURE; } } return(rc); } If that program is called realpath, then the Bash script fragment reduces to: SCRIPT_PATH=$(realpath ${BASH_SOURCE[0]})

Q: Setting object style in InDesign I'm trying to somehow set InDesign object style for images that I add into text frame directly so they flow along with text when I edit content. My document is of technical nature so it has a single text frame per page. It's more of technical document really. This are my requirements: images need to break text block apart, so text won't flow over/around them images need to centrally aligned in the text frame regardless of their width images have to move with text (hence they are pasted into) images have a description that must never break to next page images have to align to the last baseline gridline just above description so description always appears it's positioned exactly the same space after image (upper margin will therefore vary but should be at least one leading high) - By last baseline I mean if an images occupies few line-heights (leadings), bottom of the image frame should align exactly with the last line and not somewhere in between. I'm heaving great difficulty creating my object style to accomplish this. The main problem being positioning images exactly on the last baseline grid. A: You can do this. I've tested the following in CS5 and 5.5, but the technique should work at least as far back as CS3, when iirc Object Styles were first introduced. So, in sequence: To get started, set up a Paragraph Style of "Image", which is set to align to grid and centered. First line, all lines, doesn't matter. The paragraph will only contain one line. Set up a paragraph style called "Description." In Keep Options, check "Keep With Previous." Edit the "Image" paragraph style, to add "Next Style: Description." (This isn't essential, but it makes things quicker later.) Paste your first image into its own paragraph, and set the style to "Image." Set the anchored image options to "Inline or Above Line" and choose the "Inline" radio button. The Y offset should be 0. The bottom of the image will now be sitting on a baseline. The top of the image will be below the last line of the previous paragraph. Select the image and Alt/Option-Click the new style icon in the Object Styles panel. Call this "Image" and give it a keyboard shortcut. Activate the Paragraph Styles checkbox, and "Use Next Style" in the associated Paragraph Styles dialog. Select the "Anchored Object Options" checkbox, and verify those settings. You're all set. You can now paste an inline image into its own paragraph, assign the "Image" object style using the keyboard shortcut, and press Enter/Return to create the next paragraph, which will have a paragraph style of "Description" assigned automatically. (If you are working on existing text, select the image and the description and right-click the "Image" paragraph style in the Paragraph Styles panel, then choose "Apply Image then Next Style" from the context menu.) At this point you have an image that won't have any text flowing around it, with a description that will never break to the next page without taking the image with it. A: I don't think you'll be able to accomplish this through styles alone with those last two bullets being a requirement. For one, object styles don't have a setting for anything having to do with the grid except when working with a text frame, and even then relative-to-grid settings only deal with the top of the frame which won't be of much help. Second, you could place the image frame in the text flow and apply a paragraph, but then a paragraph style aligns to a grid by the first line or all lines, but nothing in between. If dodging repetitive work is the goal here, then the only thing I can think of would be to create an object library that has the objects you need and some hooks for automation (like an applied label on the backend) and write up a script that will then go through the document, find the objects, and fix the layout "automagically" after you have finished populating your document. That's no small feat, and even with the most robust automatic layout systems, someone still has to go in a tweak layouts manually if layout quality is even a vague concern. I suggest either relaxing your layout requirements or handle this manually as you do your layout. It's a drag no matter how I look at this but that's also why a lot of us have jobs.

A wonderful way Vine Street both shares its facilities while providing important ministry is through the Pastoral Counseling Center of Tennessee (PCCT). Vine Street founded PCCT in 1985 to provide affordable, professional counseling in middle Tennessee. PCCT has several locations in the Nashville area, but its main office is on Vine Street’s campus in the Fitzpatrick House. It has been our neighbor for the last 29 years. The work at PCCT is unique in that the counselors are not only licensed clinicians in a mental health field, but they also have in-depth religious and theological training. The mission of PCCT is “to restore lives to wholeness—mentally, emotionally, and spiritually.” The staff provides individual, marital and family therapy, and services for Spanish-speaking clients are offered, too. Last year the Vine Street location served 400 clients, totaling 1,596 sessions of counseling and $125,000 of financial assistance. In addition, you may recall Vine Street donated $7,500 last year to PCCT, which was made possible by a generous gift left by Mrs. Hallie Warner. This gift provided 111 sessions to senior adult clients in need of financial assistance. PCCT is committed to helping all who are in need of counseling regardless of their financial situation, and it offers a sliding scale fee option for those who need financial assistance. Pastoral Counseling Center of Tennessee is a major ministry Vine Street Christian Church supports right here on our campus. Sundays: Communion in the chapel at 8:30 a.m. | Traditional Worship at 10:00 a.m. in the Sanctuary| Christian Education at 9 a.m. About CONNECT I'M NEW Vine Street Christian Church is a member of the Christian Church (Disciples of Christ). We are a movement for wholeness in a fragmented world. As part of the one body of Christ, we welcome all to the Lord's Table as God has welcomed us.

Role of inhibition of uroporphyrinogen decarboxylase in PCB-induced porphyria in mice. The oral administration of 3,4,5,3',4',5'-hexachlorobiphenyl for 3 weeks to mice caused a marked accumulation of porphyrins in the liver of C57BL/6 and C57Bl/10 mice but not in the liver of ddY mice. The time course of induction of delta-aminolevulinic acid synthetase (ALA-S), cytochrome P-450, and mixed function oxidases and inhibition of uroporphyrinogen decarboxylase (URO-D) in the liver of C57BL/6 mice and ddY mice fed a diet containing 500 ppm of a commercial PCB (Kanechlor-500) were investigated to clarify the sole factor in inducing porphyria. The activity of URO-D in the liver of C57BL/6 mice was depressed approximately 80% at 3 weeks when a large amount of uroporphyrin accumulated. Male ddY mice showed only a slight increase in uroporphyrin accumulation in the liver and a moderate decrease of URO-D activity even at the 10th week. ALA-S, cytochrome P-450, and mixed function oxidases were induced in both strains of mice, although the magnitude of these inductions in C57BL/6 mice was greater than that in ddY mice. No differences were detected between the two strains in the content and gas chromatographic pattern of PCB remaining in liver cytosol (6 weeks). In addition there was no relationship between the time of onset of porphyria and that of the maximal induction of drug-metabolizing function in C57BL/6 mice. These results indicate that the development of porphyria is causally related to the inhibition of URO-D rather than the induction of drug-metabolizing function. The hypothesis that porphyria first develops when the ratio of hepatic URO-D and ALA-S activities decreases to less than 1.0 is presented.

[Establishment and evaluation of the SD rat allergic rhinitis model]. To investigate method established and system evaluated in the model of SD rat with AR. To establish AR model of SD rats by ovalbumin (OVA), 20 cases of SD rats were randomly divided into two groups, namely control group (10 cases) and AR group (10 cases). AR models were sensitized and challenged by OVA. Control group were used with normal saline instead of OVA. The score of pathology and praxiology were observed when the SD rats in AR group appeared typical symptom of allergic rhinitis, and levels of IL-4, IFN-γ, IgE in the serum were examined by ELISA. According to the behavioral score, nasal histology and content of IL-4, IFN-γ, IgE of serum, Rat allergic rhinitis model were judged successfully established or not. Behavioral scores were significantly increased in OVA-challenged rats compared with the control group, P<0.05. Nasal epithelial goblet cells, eosinophils and lymphocytes in nasal mucosa in the AR rats exhibited obvious increase relative to the control group. IL-4, IgE levels in the AR rat exhibited obvious increase relative to control group while INF-γ levels exhibited obvious reduction (P<0.05). The allergic rhinitis models in SD rat by OVA were successfully established. The levels of IgE, INF-γ and IL-4 in Serum can be used as objective evaluation of animal models of allergic rhinitis established successfully or not.

The RNA-Seq data reported in this paper are available from the NCBI Sequence Read Archive under accession number GSE87194. Introduction {#sec001} ============ Schizophrenia is a serious psychiatric disorder adversely affecting the quality of life of a significant number of people \[[@pone.0166944.ref001]\]. Schizophrenia arises from a complex and varied set of environmental and genetic factors, which has made it very difficult to come to a clear understanding of the etiology of the condition, despite intensive scientific work in the area. However, it seems that a disease arising from the interplay of genes and environment is likely to involve the super family of nuclear receptors which are known to control gene expression depending on context. A group of 48 transcription factors play a key role in transducing extracellular (environmental, metabolic, endocrine) signals into intercellular signals, resulting in changes in expression of target genes. The nuclear receptors (NRs) are grouped into 6 functionally related sub-families (NR1---NR6) and include the estrogen and androgen receptors (NR3A1/ESR1 and NR3C4/AR), the glucocorticoid and mineralocorticoid receptors (NR3C1/GR and NR3C2/MR), the retinoid receptors (NR1B/RARs and NR2B/RXRs), the vitamin D receptor (NR1I1/VDR), the peroxisome proliferator-activated (fatty acid) receptors (NR1C/PPARs) and the orphan nuclear receptors (NR4A sub-family)\[[@pone.0166944.ref002]\]. A number of these genes/transcripts have been implicated in schizophrenia, including the estrogen \[[@pone.0166944.ref003], [@pone.0166944.ref004]\] and the glucocorticoid receptors \[[@pone.0166944.ref005]--[@pone.0166944.ref008]\], the retinoid (vitamin A) receptors \[[@pone.0166944.ref009]\] and the NR4A (orphan) receptors \[[@pone.0166944.ref010]\]. The nuclear receptors generally dimerize to form either homodimers or heterodimers with other nuclear receptors and may be activated by multiple ligands. They are therefore part of a complex network of molecules essential for development and adaptive responses in the adult. To gain a more complete picture of alterations in nuclear receptor alterations, we have focused this study on the NR4A sub-family of nuclear receptors (NR4A1 (Nurr 77 or NGF1B), NR4A2 (Nurr1), NR4A3 (Nor1)), and their dimerization partners, the retinoid X receptors (RXRA, RXRB, RXRG) and the retinoic acid receptors (RARA, RARB, RARG). The RAR proteins are activated by all-trans retinoic acid while the RXR proteins are activated by by 9-cis retinoic acid, and other ligands such as the omega 3 unsaturated fatty acids and various synthetic compounds \[[@pone.0166944.ref011], [@pone.0166944.ref012]\]. NR4A1 and NR4A2, but not NR4A3 \[[@pone.0166944.ref013], [@pone.0166944.ref014]\], form active heterodimers with RXRA and RXRG \[[@pone.0166944.ref015], [@pone.0166944.ref016]\] and in this form can bind to the retinoid acid response elements in genomic DNA \[[@pone.0166944.ref015]\]. Whilst NR4A3 does not heterodimerize with the RXRs, it can interfere with the signaling from either the NR4A1-RXR or NR4A2-RXR complexes \[[@pone.0166944.ref014]\]. RXR dimerizes with several nuclear receptors including the retinoid receptors (RARs sub-family), the vitamin D receptor (VDR), the thyroid hormone receptors (T3Rs) and the lipid activated nuclear receptors (PPARs). While NR4A2 has an important role in the cell body of dopaminergic neurons, the action of NR4A1 is more pronounced at target areas of the dopaminergic neurons, such as the prefrontal cortex. The NR4A1- RXR complex is suggested to function as an adaptive homeostatic regulator of dopamine neurotransmission \[[@pone.0166944.ref017]\]. Blockers of dopamine transmission, antipsychotics, can impact the expression of NR4A genes \[[@pone.0166944.ref018], [@pone.0166944.ref019]\] and gene ablation studies have demonstrated changes in response to antipsychotic medication in NR4A1 null mice \[[@pone.0166944.ref020], [@pone.0166944.ref021]\]. Thus, it is important to consider if the levels of antipsychotic drug levels correlate with levels of these nuclear receptor mRNAs in the brains of people with schizophrenia. In this study, we have quantified and compared the mRNA expression of genes encoding nuclear receptors with a focus on those in the NR4A and RXR/RAR families. This study aims to determine if altered levels of the mRNA expressions in orphan nuclear receptors and retinoid receptors exist in the brains of people with schizophrenia using next generation sequencing and by real time quantitative polymerase chain reaction (RT-qPCR) in the DLPFC. Methods {#sec002} ======= Post-mortem brain samples {#sec003} ------------------------- Dorsal lateral prefrontal cortex (DLPFC) from thirty-seven schizophrenia/schizoaffective cases and thirty-seven controls was obtained from the New South Wales Tissue Resource Centre. Of the thirty-seven schizophrenia/schizoaffective cases, eight were on first generation antipsychotics only, twenty-two had predominantly received first generation antipsychotics, one was one second generation antipsychotics only, five had predominantly received second generation antipsychotics, and one received equal first and second generation antipsychotics. Cases were matched for sample pH, age, post-mortem interval (PMI), and RNA integrity number (RIN) ([Table 1](#pone.0166944.t001){ref-type="table"}). Details of tissue characterization have been previously described \[[@pone.0166944.ref022]\]. All research was approved by and conducted under the guidelines of the Human Research Ethics Committee at the University of New South Wales (HREC 12435- Investigation of schizophrenia pathogenesis using post-mortem brain tissue). 300 mg of DLPFC was weighed out for total RNA extraction using TRIzol® Reagent (Life Technologies Inc., Grand Island, N.Y., U.S.A., catalogue number: 15596--018), as previously described \[[@pone.0166944.ref023]\], The quantity and quality of RNA was determined using a spectrophotometer (Nanodrop ND-1000, Thermo Fisher Scientific) and Agilent Bioanalyzer 2100 (Agilent Technologies, Palo Alto, CA, USA). 10.1371/journal.pone.0166944.t001 ###### Control and Schizophrenia Cohort Demographics. {#pone.0166944.t001g}   Control Group Schizophrenia Group ---------------------------------------- -------------------------- --------------------------- Number of Cases Healthy Controls = 37 SZ = 30, SA = 7 Age (years) 51.1 (18--78) 51.3 (27--75) Gender F = 7, M = 30 F = 13, M = 24 Hemisphere L = 14, R = 23 L = 20, R = 17 pH 6.66 ± 0.29 (5.84--7.19) 6.61 ± 0.30 (5.69--7.09) Post-Mortem Interval (hours) 24.8 ± 10.97 (6.5--50) 28.8 ± 14.07 (5--72) RNA Integrity Number (RIN) 7.3 ± 0.57 (6.0--8.4) 7.3 ± 0.58 (6.2--8.4) Manner of Death Natural = 37 Natural = 29, Suicide = 8 Age of onset (years) \- 23.7 ± 0.1 Duration of Illness (years) \- 27.6 ± 2.3 Daily Chlorpromazine Mean (mg) \- 692 ± 502 Last Recorded Chlorpromazine Dose (mg) \- 542 ± 374 Key: SZ = schizophrenia, SA = schizoaffective; F = Female, M = Male; L = left, R = Right; ± = Standard Deviation cDNA derived from total RNA from the DLPFC tissue of a cohort of 20 schizophrenia/schizoaffective cases (referred to as schizophrenia) and 20 control samples was sequenced using the ABI SOLiD platform as previously described \[[@pone.0166944.ref024]\]. In this study, we took the raw data generated from 19 of the schizophrenia samples and 19 control samples. We excluded one schizophrenia sample as the raw data file had been damaged and it was not possible to use it in further mapping. We also excluded one control sample who was phenotypically male but putatively XXY. We mapped the 50 nucleotide reads to the human genome (hg19) using TopHat2 (v 2.0.4) \[[@pone.0166944.ref025]\], which calls the Bowtie aligner (v 0.12.8) \[[@pone.0166944.ref026]\], allowing up to 2 bp mismatches per read (default position). HTSeq-count (Python package HTSeq, python v 2.7.3) was used to generate counts of reads uniquely mapped to known and annotated genes (freeze date October 2011) using the Ensembl annotation file GRCh37.66_chr.gtf (mode = union,--t = exon,--i = gene_name). The count table of uniquely mapped reads was then used for differential expression analysis. Differential expression was tested using the Bioconductor package, edgeR (v 3.12.1) \[[@pone.0166944.ref027]\] and confirmed using DESeq2 (v 1.10.1) \[[@pone.0166944.ref028]\]. We used a generalized linear model (GLM) with batch as well as the diagnostic (schizophrenia versus control) as factors in the design matrix \[[@pone.0166944.ref029]\] in each of the analyses. In carrying out this analysis, we have used read data (fastq files) obtained from RNA-Seq previously performed on the DLPFC of post-mortem brain. Tools for the analysis of RNA-Seq data have improved rapidly over recent years. Since the time when this data was first analyzed \[[@pone.0166944.ref024]\] commonly used analysis tools such as edgeR and DESeq have undergone important developments. They now allow covariates such as batch to be routinely incorporated in experimental analysis and provide a more sophisticated treatment of the variation in gene expression (dispersion estimation) \[[@pone.0166944.ref029], [@pone.0166944.ref030]\]. We have used these new methods in the work reported here. In the edgeR analysis, low count transcripts were excluded and only those genes with at least 1 count per million (cpm), in at least 10 samples, were used for analysis. This filtering retained 17,483 of the original 42,358 transcripts. Normalization was performed using the trimmed mean of M values (TMM) \[[@pone.0166944.ref027]\]. The dispersion parameter for each gene was estimated with the Cox-Reid common dispersion method \[[@pone.0166944.ref029]\]. Testing for differential expression employed a negative binomial generalized linear model for each gene. In the DESeq2 confirmatory analysis, normalization was performed using the median-of-ratios method \[[@pone.0166944.ref028]\]. Dispersions were estimated using a Cox-Reid adjusted profile likelihood and the Wald test for significance of GLM was used. DESeq2 invokes automatic filtering to optimize the number of genes that have an adjusted p value below the threshold (default 0.1). This resulted in the retention of 17,447 transcripts. In both workflows the Benjamini-Hochberg correction was used to correct for multiple comparisons with a false discovery rate of 0.10. The differential expression between schizophrenia and control are distinct from those obtained in our earlier analysis \[[@pone.0166944.ref024]\] due to the alternative analysis streams employed. For this edgeR analysis, estimates of dispersion take into account the actual variation seen in counts for a gene across samples (tagwise dispersion) as well as the common dispersion, which is a value derived from the entire gene set. The tagwise dispersion for a gene is modulated towards the common dispersion by applying a weighting factor (prior.n). Earlier versions of edgeR set the prior.n value at 10, which moved the tagwise dispersions strongly towards the common dispersion value. This was based upon the assumption that RNA-Seq projects generally consisted of few samples and accordingly the small sample size could not alone provide a reliable estimate of dispersion. Later versions of edgeR including v 3.12.1 (used in this analysis) altered these general settings to allow greater sensitivity to the number of samples used in an experiment. The greater the number of samples, the more reliable the tagwise dispersion should be, thus reducing the modulation towards a common dispersion value. The weighting towards the common dispersion is now calculated taking account of the number of samples and groups being analysed. Under the current default settings in edgeR (v 3.12.1) the prior.df is set to 10 with a resulting prior.n of approximately 0.3 (prior.n = prior.df /residual.df). That is, for a data set of this size, with 19 individual samples, there is very little smoothing towards a common dispersion value. Instead, more weight is given to the actual variation in count numbers for a particular gene gleaned from the data for that gene. In a data set where there is a large divergence of count values for a particular gene or where there may be one or two samples with an extreme value, tagwise dispersion will make it less likely that such a gene will be called as differentially expressed. The fact that we see a reduction in differentially expressed genes using the current method is indicative of a spread of gene counts rather than a tighter clustering of values among individuals for a gene expression level. Clustering functions available in the gplots package in the R environment (v 3.0.2) (<http://www.R-project.org>) \[[@pone.0166944.ref031]\] were used to generate heatmaps. The Metacore database was used for ascertaining interaction partners of particular genes. The Cytoscape software platform ([www.cytoscape.org](http://www.cytoscape.org/)) \[[@pone.0166944.ref032]\] was used for constructing protein interaction networks. qPCR analysis {#sec004} ------------- SuperScript® II/III First-Strand Synthesis System (Life Technologies, catalogue number: 11904-018/18080-400) was used for cDNA synthesis from 3 μg RNA. The protocol for SuperScript® II was followed by adding random hexamers, nucleoside triphosphate (dNTP), and RNase OUT to each sample. After incubating at 65°C, tris-hydrochloride (tris-HCl), potassium chloride (KCl), magnesium chloride (Mg2Cl), dithiothreitol (DTT) and SuperScript® II were added. All samples were incubated at room temperature for 10 min before heating it to 42°C for 50 min, followed by 70°C for 15 min. RNase H was added to all samples before incubating at 37°C. We followed the protocol for SuperScript® III First-Strand Synthesis System according to manufacturer's instructions. cDNA was plated out with a seven-point serial diluted standard curve, followed by quantitative real time PCR, probing with various primers to amplify members of the nuclear receptor superfamily ([Table 2](#pone.0166944.t002){ref-type="table"}). Samples were measured in triplicates on the 7900HT Fast Real-Time PCR System. The quantity means obtained from the relative standard curve method from serial dilutions of cDNA (1:3, 1:9, 1:27 etc) of our genes of interest were normalized to the geometric mean of four housekeeping genes: β-actin, ubiquitin C, glyceraldehyde-3-phosphate dehydrogenase, and TATA box binding protein ([Table 2](#pone.0166944.t002){ref-type="table"}). There was no difference in the mRNA levels for housekeepers between the schizophrenia and control groups \[[@pone.0166944.ref022]\]. 10.1371/journal.pone.0166944.t002 ###### List of Taqman genes of interest. {#pone.0166944.t002g} Gene Gene Name Assay ID -------------------------------------------- ------------------------------------------------- ------------------------------------------------- NR4A1/Nur77 Nuclear receptor subfamily 4, group A, member 1 Hs00374226_m1 NR4A2/Nurr1 Nuclear receptor subfamily 4, group A, member 2 Hs00428691_m1 NR4A3/Nor1 Nuclear receptor subfamily 4, group A, member 3 Hs00545009_g1 KLF4 Kruppel-like factor 4 Hs00358836_m1 VDR Vitamin D receptor Hs01045840_m1 RARA Retinoic Acid Receptor, alpha Hs00940446_m1 RARB Retinoic Acid Receptor, beta GCAGAGCGTGTAATTACCTTGAA/GTGAGATGCTAGGACTGTGCTCT RARG Retinoic Acid Receptor, gamma Hs01559234_m1 RXRA Retinoid X Receptor, alpha Hs01067640_m1 RXRB Retinoid X Receptor, beta Hs00232774_m1 RXRG Retinoid X Receptor, gamma Hs00199455_m1 ACTβ[\*](#t002fn001){ref-type="table-fn"} Actin, beta Hs99999903_m1 UBC[\*](#t002fn001){ref-type="table-fn"} Ubiquitin C Hs00824723_m1 GAPDH[\*](#t002fn001){ref-type="table-fn"} Glyceraldehyde-3-phosphate dehydrogenase Hs99999905_m1 TBP[\*](#t002fn001){ref-type="table-fn"} TATA box binding protein Hs00427620_m1 \*Housekeeper genes Statistical analysis of qPCR results {#sec005} ------------------------------------ Normalized data was analyzed using IBM SPSS Statistics 23.0. KLF4 and RXRB were log10 transformed for normal distribution within each diagnostic group. All data were tested for correlation with age, pH, PMI and RIN. The correlations between the gene expressions with each of these factors are listed in [S1 Table](#pone.0166944.s006){ref-type="supplementary-material"}. ANOVA and ANCOVA were performed when appropriate. The results were analyzed for diagnostic and gender differences. We performed Spearman's correlation in the schizophrenia group with chlorpromazine dosages, illness duration, and on target mRNAs. Results {#sec006} ======= Nuclear receptor family genes are expressed in three clusters {#sec007} ------------------------------------------------------------- We sought to characterize nuclear receptor mRNA change in the context of the expression landscape of all nuclear receptor genes in the DLPFC. A cluster-based analysis revealed that the nuclear receptor genes expressed in the adult human prefrontal cortex fall into three main groups, highly expressed genes, moderately expressed genes and lowly expressed genes ([Fig 1](#pone.0166944.g001){ref-type="fig"}). Our analysis indicates that NR4A1 falls within the moderately expressed cluster and is expressed at similar abundance levels as the other members of this sub-family NR4A2 (Nurr1) and NR4A3 (Nor-1). Further, the expression levels of the NR4A genes is in a similar range to that of members of the retinoid receptors (RARs and RXRs, part of the NR1B and NR2B sub-families), and the sex steroid hormone receptors such as the estrogen and androgen receptors (ESR1 and AR). As we were interested in seeing the relative expression levels of the nuclear receptors in the DLPFC we adjusted for gene length and also clustered by gene name rather than by sample. {#pone.0166944.g001} Nuclear receptor NR4A1 is significantly downregulated in schizophrenia {#sec008} ---------------------------------------------------------------------- Using RNA-Seq, we analyzed gene expression in the DLPFC of 19 schizophrenia patients and compared that to 19 controls. The biological coefficient of variation (BCV) calculated using the methods available in edgeR produced a value of 0.3863 for the 19 control samples and 0.479 for the 19 schizophrenia samples. This does indicate a slightly greater degree of variability in samples from people with schizophrenia compared to samples from the controls; however it also reflects that there is also quite a bit of variability in samples from controls as well. Considerable gene expression variability was seen between individuals, which was unsurprising for human brain and patient-derived samples. This could be due to the uncontrolled factors in case-control studies (such as age at death, time of death, or gender) and also due to the heterogeneous nature of schizophrenia. Consequently, we did not see a strong distinction between the two diagnostic categories when examining global gene expression via a multidimensional scaling (MDS) plot ([S1 Fig](#pone.0166944.s001){ref-type="supplementary-material"}). However, a small group of genes, which had not been previously reported by us to be associated with schizophrenia, was revealed with these novel analysis parameters. The top 20 differentially expressed genes (FDR\<0.1) found using edgeR are given in [Table 3](#pone.0166944.t003){ref-type="table"}. [S2 Fig](#pone.0166944.s002){ref-type="supplementary-material"} in the Supplementary material shows the sensitivity of the number of differentially expressed genes (found at an FDR\<0.1) to changes in prior.n from 0.3 to 2, 5 and 10. Full details of the DEGs found using these different values of prior.n are included as [S2 Table](#pone.0166944.s007){ref-type="supplementary-material"}. 10.1371/journal.pone.0166944.t003 ###### Significant differentially expressed genes in schizophrenia compared to controls (FDR \< 0.1) from use of edgeR. {#pone.0166944.t003g} Gene Protein name log2FC[^a^](#t003fn001){ref-type="table-fn"} p-value[^a^](#t003fn001){ref-type="table-fn"} FDR[^a^](#t003fn001){ref-type="table-fn"} --------------- ---------------------------------------------------------- ---------------------------------------------- ----------------------------------------------- ------------------------------------------- NR4A1 Nuclear receptor subfamily 4, group A member 1 -1.13 1 x 10^−6^ 0.019 KLF4 Kruppel-like factor 4 -0.99 6.49 x 10^−6^ 0.062 EIF2AP4 Eukaryotic translation initiation factor 2A pseudogene 4 1.08 2.26 x 10^−5^ \<0.1 RTN4R Reticulon 4 receptor -0.69 2.49 x 10^−5^ \<0.1 COL5A3 Collagen, type V, alpha 3 -0.55 3.44 x 10^−5^ \<0.1 ARRDC3 Arrestin domain containing 3 0.64 3.52 x 10^−5^ \<0.1 ADAMTS9-AS2 ADAMTS9 antisense RNA 2 0.53 3.74 x 10^−5^ \<0.1 GAREML/FAM59B GRB2 associated, regulator of MAPK1-like -0.47 4.52 x 10^−5^ \<0.1 MMD2 Monocyte to macrophage differentiation-associated 2 -0.49 5.26 x 10^−5^ \<0.1 DUSP1 Dual specificity phosphatase 1 -0.7 5.6 x 10^−5^ \<0.1 OAS2 2\'-5\'-oligoadenylate synthetase 2, 69/71kDa -0.67 6.98 x 10^−5^ \<0.1 ALDH1L2 Aldehyde dehydrogenase 1 family, member L2 0.37 7.82 x 10^−5^ \<0.1 ZNF385A Zinc finger protein 385A -0.49 8.26 x 10^−5^ \<0.1 ZNF610 Zinc finger protein 610 0.4 8.71 x 10^−5^ \<0.1 PAPOLB Poly(A) polymerase beta (testis specific) 0.89 8.98 x 10^−5^ \<0.1 PPP1R3B Protein phosphatase 1, regulatory subunit 3B 0.66 8.99 x 10^−5^ \<0.1 SNORD116-24 Small nucleolar RNA, C/D box 116--24 0.64 9.02 x 10^−5^ \<0.1 ALDH3A2 Aldehyde dehydrogenase 3 family, member A2 0.3 9.64 x 10^−5^ \<0.1 GABRE Gamma-aminobutyric acid (GABA) A receptor, epsilon 1.2 9.79 x 10^−5^ \<0.1 GBAP1 Glucosidase, beta, acid pseudogene 1 -0.57 1 x 10^−4^ \<0.1 ^a^Calculated in edgeR as described in Methods In this analysis, the most significant differentially expressed gene was the nuclear receptor NR4A1 (Nur77), for which expression is reduced in schizophrenia (54%, p\<0.01, FDR\<0.1). The next most significant gene expression change was KLF4 (kruppel-like factor 4), which is reduced by a similar amount in schizophrenia (50% p\<0.01, FDR\<0.1). We confirmed the edgeR results using a different analysis program, DESeq2, which also found NR4A1 and KLF4 as the most significantly differentially expressed genes with decreases in schizophrenia similar to that found with edgeR (51% and 47%, respectively) ([S2 Table](#pone.0166944.s007){ref-type="supplementary-material"}). To further validate these changes, quantitative PCR was used to measure the expression of these genes in the complete cohort of 74 individuals (37 schizophrenia and 37 controls). This established that both genes were significantly decreased in schizophrenia, (KLF4: F(1,69) = 8.101, p\<0.01); NR4A1: F(1,68) = 6.912, p = 0.01; [Fig 2](#pone.0166944.g002){ref-type="fig"}, [Table 4](#pone.0166944.t004){ref-type="table"}). {#pone.0166944.g002} 10.1371/journal.pone.0166944.t004 ###### Results from RT-qPCR analysis. {#pone.0166944.t004g} Gene F-value p-value df Mean Normalized Expression for Control Group Mean Normalized Expression for Schizophrenia Group Percentage Change (%) ------------------------------------------- ------------------- --------- ---- ---------------------------------------------- ---------------------------------------------------- ----------------------- ---------- -------- NR4A1/ Nur77 F(1, 68) = 6.912 0.011 1 4.634 (n = 36) 3.661 (n = 35) -20.99 NR4A2/ Nurr1 F(1, 66) = 4.655 0.035 1 11.624 (n = 36) 10.285 (n = 35) -11.52 NR4A3/ Nor1 F(1, 68) = 1.030 0.314 1 16.204 (n = 35) 14.994 (n = 36) -7.47 KLF4[\*](#t004fn001){ref-type="table-fn"} F(1, 69) = 8.101 0.006 1 0.864 (n = 36) 0.609 (n = 35) -37.36 VDR F(1, 70) = 0.209 0.649 1 26.381 (n = 37) 25.372 (n = 35) -3.83 RARA F(1, 66) = 0.400 0.529 1 2.26 (n = 35) 2.324 (n = 35) 2.83 RARB F(1, 66) = 0.046 0.5 1 11.038 (n = 33) 11.405 (n = 35) 3.32 RARG F(1, 62) = 2.824 0.098 1 8.457 (n = 32) 7.254 (n = 34) -14.23 RXRA F(1, 66) = 0.744 0.391 1 17.36 (n = 35) 19.049 (n = 34) 9.73 RXRB[\*](#t004fn001){ref-type="table-fn"} F(1, 66) = 10.256 0.002 1 1.772 (n = 35) 1.647 (n = 34) -24.99 RXRG F(1, 66) = 1.669 0.201 1 8.953 (n = 35) 8.035 (n = 35) -10.25 \*Log~10~ transformed data qPCR analysis of the other NR4A sub-family and retinoid receptors {#sec009} ----------------------------------------------------------------- *U*sing qPCR in the expanded cohort (37 schizophrenia and 37 controls), we confirmed decreased expression of NR4A1 and also found a significant decrease in NR4A2 expression in schizophrenia (NR4A2: F(1,66) = 4.655, p\<0.05) and RXRB: F(1,66) = 10.256, p\<0.01; [Fig 2](#pone.0166944.g002){ref-type="fig"}, [Table 4](#pone.0166944.t004){ref-type="table"}). We found no significant difference for NR4A3 (F(1,68) = 1.03, p\>0.05) or the RARs (A, B, and G), RXRA or RXRG (all F\<2.8, p\>0.05, [Table 4](#pone.0166944.t004){ref-type="table"}). Percentage differences in gene expression in all 10 targets examined here in the whole sample by qPCR are shown in [Fig 3](#pone.0166944.g003){ref-type="fig"}, and a comparison between control and schizophrenia groups of each of the gene expressions are shown in [S3 Fig](#pone.0166944.s003){ref-type="supplementary-material"}. {#pone.0166944.g003} Correlation of gene expression among transcription factors {#sec010} ---------------------------------------------------------- We performed Pearson's correlations of the mRNA expression found by qPCR for NR4 sub-family and the retinoid receptors in our extended cohort. Correlations were performed across the combined group of controls and schizophrenia patients. We found that NR4A1 mRNA was significantly correlated with the two other closely related mRNAs NR4A2 and NR4A3. RXRG mRNA was significantly correlated with the other two RXRs (A and B). RXRB mRNA was also correlated with RARG mRNA and NR4A3 mRNA was correlated with RARA mRNA ([Table 5](#pone.0166944.t005){ref-type="table"}). 10.1371/journal.pone.0166944.t005 ###### Correlation of gene expression for nuclear receptors. {#pone.0166944.t005g} Gene Gene N p-value FDR Adjusted ------- ------- ---- ---------------- ---------------- NR4A1 NR4A2 68 1.05 x 10^−4^ 0.002 NR4A1 NR4A3 69 1.89 x 10^−15^ 1.04 x 10^−13^ NR4A3 RARA 67 0.003 0.025 RXRA RXRG 66 0.003 0.026 RXRB RARG 63 4.62 x 10^−10^ 1.27 x 10^−8^ RXRB RXRG 66 7.9 x 10^−4^ 0.011 Correlation between gene expression and age {#sec011} ------------------------------------------- We found a negative correlation between expression of the NR4A family genes and age (NR4A1: r(71) = -0.419, p = 0.0003; NR4A2: r(71) = -0.515, p = 0.000004; NR4A3: r(71) = -0.330, p = 0.005; [S4 Fig](#pone.0166944.s004){ref-type="supplementary-material"}). This correlation in age was found in both control and schizophrenia groups, with the correlation effect stronger in the control group ([S3 Table](#pone.0166944.s008){ref-type="supplementary-material"}). There was no significant correlation between age and KLF4 or any of the retinoid receptors mRNAs. Correlation between gene expression, and chlorpromazine dosage {#sec012} -------------------------------------------------------------- We found a significant negative correlation between daily chlorpromazine dosage with NR4A1 and NR4A3 (NR4A1: rho(35) = -0.594, p = 0.0002; NR4A3: rho(36) = -0.438, p = 0.008) and no significant correlations between the last recorded chlorpromazine dosage to any of the mRNAs measured. There was a significant negative correlation between estimated lifetime chlorpromazine dosage and expression of NR4A1, NR4A2 and NR4A3 mRNAs (NR4A1: rho(35) = -0.601, p = 0.0001; NR4A2: rho(35) = -0.383, p = 0.023; NR4A3: rho(36) = -0.403, p = 0.015; [Fig 4](#pone.0166944.g004){ref-type="fig"}). We did not find a significant correlation with any measure of lifetime chlorpromazine and the retinoid receptor mRNAs measured (rho\<0.182, p\>0.05). {#pone.0166944.g004} We also found significant negative correlations between NR4A1 and NR4A2 mRNAs with duration of illness, and a trend between NR4A3 mRNA levels and duration of illness (NR4A1: rho(35) = -0.461, p = 0.005; NR4A2: rho(35) = -0.372, p = 0.028; NR4A3: rho(36) = -0.310, p = 0.067). We did not find a significant correlation between duration of illness and any retinoid receptors mRNAs measured (rho\<0.240, p\>0.05). Because there were significant correlations between the NR4A genes with age, we re-analyzed correlations between the NR4A mRNA expressions with illness duration and lifetime dosage in a partial correlation, factoring for age. We found NR4A1 mRNA expression remained significantly correlated with the estimated lifetime antipsychotic dosage (r(32) = -0.401, p = 0.019) and a trend in NR4A3 (r(33) = -0.311, p = 0.069). Two-way ANCOVA of diagnosis with gender {#sec013} --------------------------------------- We found there was a decrease of RXRG mRNA in females with schizophrenia (F(1,64) = 4.97, p = 0.029) and of RARG mRNA in females with schizophrenia (F(1,60) = 3.942, p = 0.05; [S5 Fig](#pone.0166944.s005){ref-type="supplementary-material"}). There was no significant change in all other gene targets when we analyzed by two-way ANCOVA of diagnosis and gender. Interaction network {#sec014} ------------------- To investigate the biological effect of NR4A1, NR4A2 and RXRB down-regulation, we generated a network representation of the genes annotated as being transcriptionally regulated by the NR4 sub-family or RXRB ([Fig 5](#pone.0166944.g005){ref-type="fig"}). The downstream genes presented in [Fig 5](#pone.0166944.g005){ref-type="fig"} are involved in a broad range of cellular functions, some of which are listed in [S4 Table](#pone.0166944.s009){ref-type="supplementary-material"}. {#pone.0166944.g005} Generally, the annotated interactions involve transcriptional activation, although in some cases there is an inhibitory effect of the transcription factor on the target gene. We see some indication of decreased expression in genes activated by NR4A1, for instance PYGM (phosphorylase, glycogen, muscle) (26% reduction, p\<0.001, FDR\<0.2), consistent with a decrease in NR4A1 activity while genes thought to be inhibited by NR4A1, such as PPARG (peroxisome proliferator-activated receptor gamma) (30% increase, p\<0.005 FDR\<0.4), have higher levels in schizophrenia. However, the overall picture is complicated with examples of the converse also being demonstrated. This leads us to suggest that complex mechanisms are involved in the transcriptional regulation of these genes and that down-regulation of the NR4A genes and RXRB alone may not be sufficient to induce all the expected changes in downstream gene expression. Discussion {#sec015} ========== This study presents evidence for down-regulation of the nuclear receptors NR4A1, NR4A2, RXRB, and KLF4 mRNAs in the DLPFC in schizophrenia and evidence of reduced RARG and RXRG expression in females with schizophrenia. This study also found a negative correlation between the expression of NR4A genes and estimated levels of antipsychotic exposure. To our knowledge, this is the first study to report a correlation between clinical lifetime chlorpromazine dose and decreased expression of NR4A genes in the DLPFC. Our finding of decreased expression of NR4A1 and NR4A2 mRNA in a large cohort confirms and expands upon a previous finding in post-mortem schizophrenia in the same area of the brain \[[@pone.0166944.ref010]\], whereas decrease in KLF4 mRNA overall, and RARG and RXRG mRNAs in females with schizophrenia are reported for the first time. The therapeutic efficacy of various antipsychotic drugs depends upon antagonism of the D2 dopamine receptors \[[@pone.0166944.ref033]\]. Schizophrenia patients who are being treated with antipsychotic medication are subjected to constant perturbation of dopamine signaling pathways. In this study, we see a highly significant diagnostic decrease in NR4A1 mRNA in the DLPFC and a lesser decrease in NR4A2 mRNA. We also find a significant negative correlation between the estimated lifetime dose of chlorpromazine and the expression of NR4A genes in the DLPFC. This is consistent with the proposition that NR4 family genes play an important role in the frontal cortex and may be regulated via cortical dopaminergic neurotransmission. It has previously been reported that NR4A1 and NR4A3 expression increases in the murine prefrontal cortex upon a single administration of chlorpromazine \[[@pone.0166944.ref019]\]. Maheux et al. studied the effect of a number of typical and atypical neuroleptics on the expression of NR4A1 and NR4A3 in different brain regions. Overall, they found that typical antipsychotics, as distinct from atypical antipsychotics, strongly induce the expression of NR4A1 and NR4A3 in striatal areas associated with control of locomotor functions with strength of induction being correlated with the affinity of the neuroleptic drug for the D2 receptor \[[@pone.0166944.ref019]\]. Our finding of negative correlation between the mRNA of NR4A1, NR4A2 and NR4A3 with lifetime chlorpromazine dose may appear contrary to this result. However, it also suggests that chronic administration of this medication may have a different effect to acute administration. This is in line with other studies which have reported different effects on NR4A gene expression for acute versus ongoing treatment with antipsychotics. For example, the atypical antipsychotic, Clozapine, has previously been found to affect NR4A1 expression, with acute administration resulting in an increase in NR4A1 mRNA and chronic treatment (treatment over 21 days) resulting in a decrease in NR4A1 expression \[[@pone.0166944.ref018]\]. Haloperidol also increased NR4A1 expression in the dorsolateral striatum on acute treatment only \[[@pone.0166944.ref018]\]. To date, there is little evidence that antipsychotic drugs affect RXR gene expression. We found no correlation between RXR expression and chlorpromazine medication. Langlois et al. report that haloperidol had modest effects on RXRG expression in the dorsolateral portion of the striatum without any effect in other regions \[[@pone.0166944.ref034]\]. Although we found no correlation between retinoid gene expression and chlorpromazine it is possible that medication has an effect on other genes or proteins which interact with or affect the retinoid receptors and contribute to the gene expression changes reported here. It has been proposed that NR4A1 and RXR work together as adaptive homeostatic regulators of dopamine function by reducing the effect of alterations in dopamine neurotransmission \[[@pone.0166944.ref017]\]. Given the link between NR4A genes and response to antipsychotic medication it is difficult to say whether NR4A genes are dysregulated in schizophrenia prior to commencement of antipsychotic medication. However, if dopamine signaling dysfunction is involved in the etiology of schizophrenia it is plausible that NR4A genes are vulnerable to changed expression in the development of the condition. Up or down regulation of NR4A genes is likely to have some effect on genes transcriptionally regulated by these factors. A change in NR4A can result in switching the transcriptional pathway between retinoic acid initiated (RARs) and 9-cis retinoic acid (RXRs) initiated programs \[[@pone.0166944.ref035]\] with potential perturbations in the dopaminergic pathways and in gene expression affected by dopamine. Functions ascribed to NR4A1 in neuronal differentiation and neurite outgrowth \[[@pone.0166944.ref036], [@pone.0166944.ref037]\], learning and memory and immunity are all potentially relevant to schizophrenia. Notably, neurotrophic factors that promote neuronal survival and growth mediate their effect through receptors such as NR4A1 \[[@pone.0166944.ref038]\]. NR4A1 was first recognized through its response to nerve growth factor (NGF), which induces neuronal differentiation and neurite outgrowth \[[@pone.0166944.ref037]\]. Another neurotrophin which has also been found to be reduced in schizophrenia is brain-derived neurotrophic factor \[[@pone.0166944.ref039]\]. A potential effect on neural plasticity is also consistent with recent work indicating that the NR4A sub-family is involved in the processes of learning and memory \[[@pone.0166944.ref040], [@pone.0166944.ref041]\]. In our analysis, we found all three NR4A receptor mRNA levels to be decreased with age. The role of NR4A receptors in brain aging is currently unknown. With human brain aging, increased DNA damage is found and since NR4A receptors may protect against DNA damage \[[@pone.0166944.ref042], [@pone.0166944.ref043]\] our finding of decreased NR4A receptors with age may contribute to loss of DNA repair in brain cells, as has been observed in damaged skin cells \[[@pone.0166944.ref044]\]. Another prominent event that occurs as humans age is a decrease in metabolic rate particularly in brain \[[@pone.0166944.ref045], [@pone.0166944.ref046]\] and the down regulation of NR4A synthesis may also play a role in down-regulating cellular metabolism. In support of this, an increase in metabolism is observed in muscle cells overexpressing NR4A receptors \[[@pone.0166944.ref047]--[@pone.0166944.ref049]\]. Thus, our findings support the hypothesis that increasing NR4A transcription or function could be a potential angle to counteract some of the effects associated with human brain aging as previously proposed \[[@pone.0166944.ref042]\]. The decrease in RXRB in schizophrenia is interesting as the genetic locus of RXRB (6p21.3) has been linked to schizophrenia \[[@pone.0166944.ref009]\]. Ablation of RXRB leads to lethality in 50% of embryos indicating an important role for this gene in early development. However, surviving embryos only display mild defects, primarily male infertility related to lipid metabolism defects in Sertoli cells \[[@pone.0166944.ref050]\]. Mutant mice, with ablation of RXRB-RXRG, RARB-RXRB or RARB-RXRG have shown locomotor defects and decrease of dopamine receptors DR1 and DR2 in the ventral striatum but not in the dorsal striatum \[[@pone.0166944.ref051]\]. There is evidence that suggests DRD2 is dysregulated in schizophrenia brains \[[@pone.0166944.ref052]--[@pone.0166944.ref054]\]. Krezel et al. suggest that RXRB and RXRG may be functionally redundant in locomotion control \[[@pone.0166944.ref051]\], which is considered a functional readout of dopamine activity in the brain. Our finding of decreased RARG and RXRG mRNA levels in females with schizophrenia may be related to changes found in estrogen and/or estrogen receptors (ER) signaling. Indeed, direct protein interaction between the retinoid receptors and the ERs via their ligand binding domain has been documented \[[@pone.0166944.ref055], [@pone.0166944.ref056]\]. Further, retinoid receptors have been shown to be regulated by estrogen/ER \[[@pone.0166944.ref057]\] through an estrogen response element (ERE) on the RAR gene promoter \[[@pone.0166944.ref058]--[@pone.0166944.ref061]\]. RARs and ER can bind to the overlapping DNA sites \[[@pone.0166944.ref062]\], which may cause antagonism. However, rather than simple antagonism, there can also be cooperation between RARs and ER in the control of gene expression \[[@pone.0166944.ref063], [@pone.0166944.ref064]\]. More work needs to be done to determine the role the retinoid receptors and ER proteins in brain neuropathology and how they may be individually or reciprocally altered in schizophrenia particularly in females. We have also found KLF4 to be differentially expressed in schizophrenia compared to controls. KLF4 is a transcription factor in the kruppel-like factor family which regulates multiple biological functions and is involved in neurogenesis, neuronal differentiation and neurite outgrowth \[[@pone.0166944.ref065]\]. KLF4 is regulated by RARA \[[@pone.0166944.ref066]\], and it can also inhibit RARA \[[@pone.0166944.ref067]\] in vascular smooth muscle cells in a feedback-loop fashion. KLF4 mRNA and protein expression is found to be increased in skin and breast cancer \[[@pone.0166944.ref068]--[@pone.0166944.ref071]\]. In skin, RARG and RXRA are found to be antagonists of KLF4 \[[@pone.0166944.ref072]\]. Interestingly, KLF4 inhibits cell proliferation in the brain \[[@pone.0166944.ref065]\] and is down-regulated in neurogenesis \[[@pone.0166944.ref073]\]. It has been found there may be a decreased rate of cell proliferation and decreased neurogenesis in the hippocampus in schizophrenia \[[@pone.0166944.ref074]--[@pone.0166944.ref076]\]. However, the role of KLF4 in differentiated cells in the cerebral cortex is not well understood. Transcriptional regulation by the nuclear receptors is complicated by heterodimerization and their activation by multiple ligands. Furthermore, recent genome-wide studies reveal that NR binding regions are enriched for sequence motifs of other transcription factors, such as Sp1, AP-1, and C/EBP motifs, suggesting that NRs interact with other transcription factors to regulate target gene expression \[[@pone.0166944.ref077], [@pone.0166944.ref078]\]. The NRs thus operate in a complex environment that may be tuned to provide specificity in particular tissues, cell types or environments. Quantifying and comparing the mRNA of nuclear receptors contributes to our understanding of their activity. However, a thorough investigation will also require study at the protein level. We and others have previously noted differences between protein and RNA abundance in the nuclear receptors highlighting the role of post-transcriptional regulation in these genes \[[@pone.0166944.ref006], [@pone.0166944.ref079]\]. The task of teasing out the functions of the nuclear receptors in normal and schizophrenia brains and their use as biomarkers in blook could be an area of future research. Another important research question is what cell types are expressing these nuclear receptors. Conclusion {#sec016} ========== This study reports significant changes in the nuclear receptors NR4A1, NR4A2, and RXRB and KLF4 in schizophrenia and provides further evidence of a role for the nuclear receptors in the disease process. Evidence is growing in support of an important role for NR4A1 and NR4A2 in neurogenesis, learning and memory, which may be associated with the role of NR4A family genes in dopaminergic pathways. Cognitive defects and changes to dopamine signaling are well known effects of schizophrenia and of current treatment protocols. These genes also play a role in immune function which is emerging as an important focus in schizophrenia research \[[@pone.0166944.ref024], [@pone.0166944.ref080], [@pone.0166944.ref081]\]. More generally this work highlights the role of a subset of nuclear receptors that link environmental cues to the genetic landscape in this complex disease. Supporting Information {#sec017} ====================== ###### MDS plot and Venn diagram of DEGs found using edgeR and DESeq2. Multidimensional scaling (MDS) plot of all samples, SCZ samples in batch 1 (orange), Control samples in batch 1 (cyan), SCZ samples in batch 2 (red), Control samples in batch 2 (blue). (B) DEGs were identified using a glm model in both the edger and DESeq2 tools taking account of batch and SCZ, using the default settings for edgeR and DESeq2. (TIF) ###### Click here for additional data file. ###### Venn diagram of DEGs found using edgeR with different values of prior.df. The differentially expressed genes calculated using edgeR but varying the parameter prior.df., using the current default setting (prior.df = 10) and increasing this to prior.df = 70 (equivalent to prior.n = 2), and prior.df = 175 (equivalent to prior.n = 5) and prior.df = 350 (equivalent to prior.n = 10). (TIF) ###### Click here for additional data file. ###### Normalized expressions of genes by diagnosis. Overview of the normalized expressions of NR4A1, NR4A2, NR4A3, KLF4, RARA, RARB, RARG, RXRA, RXRB, and RXRG. Blue bars indicate control group and red bars indicate schizophrenia group, all showing standard error of mean (SEM). \* represents significance. (TIF) ###### Click here for additional data file. ###### Correlations with age. Normalized expressions of a) NR4A1 b) NR4A2 and c) NR4A3 correlated against age. (TIF) ###### Click here for additional data file. ###### Diagnostic and Gender Differences. Two-way ANCOVA analysis of the normalized expression of diagnosis and gender of a) RARG and b) RXRG. (TIF) ###### Click here for additional data file. ###### Correlations between gene expressions and correlation factors. (XLSX) ###### Click here for additional data file. ###### a\. EdgeR DE analysis using only common dispersion. b. EdgeR DE analysis using df = 350 equating to prion.n = 10. c. EdgeR DE analysis using df = 175 equating to prion.n = 5. d. EdgeR DE analysis using df = 70 equating to prion.n = 2. e. EdgeR DE analysis using current defaults (df = 10). (ZIP) ###### Click here for additional data file. ###### Correlation between NR4A gene expressions and Age. (XLSX) ###### Click here for additional data file. ###### Functions associated with genes downstream of NR4A family and RXRB. (XLSX) ###### Click here for additional data file. MRW and SC acknowledge support from the Australian Federal Government's Super Science and NCRIS Schemes, from the New South Wales State Government Science Leveraging Fund and Research Attraction and Acceleration Program and from the University of New South Wales. This work was supported by Schizophrenia Research Institute (utilizing infrastructure funding from the NSW Ministry of Health and the Macquarie Group Foundation), the University of New South Wales, and Neuroscience Research Australia. CSW is a recipient of a National Health and Medical Research Council (Australia) Senior Research Fellowship (\#1021970). Shan-Yuan Tsai is supported by The Cowled Postgraduate Research Scholarship in Brain Research. Tissues were received from the New South Wales Brain Tissue Resource Centre at the University of Sydney which is supported by the Schizophrenia Research Institute and National Institute of Alcohol Abuse and Alcoholism (NIH (NIAAA) R28AA012725). [^1]: **Competing Interests:**CSW is a panel member of Lundbeck Australia Advisory Board and in collaboration with Astellas Pharma Inc., Japan. This does not alter our adherence to PLOS ONE policies on sharing data and materials. [^2]: **Conceptualization:** CSW MRW.**Data curation:** MRW SMC.**Formal analysis:** SMC SYT.**Funding acquisition:** CSW MRW.**Investigation:** SMC SYT.**Methodology:** CSW MRW SMC SYT.**Project administration:** CSW MRW.**Resources:** CSW MRW SMC SYT.**Software:** SMC MRW.**Supervision:** CSW MRW.**Validation:** CSW MRW SMC SYT.**Visualization:** SMC SYT.**Writing -- original draft:** SMC SYT MRW CSW.**Writing -- review & editing:** SMC SYT MRW CSW. [^3]: ‡ These authors are co-first authors on this work.

--- abstract: | Recommender systems are tools that support online users by pointing them to potential items of interest in situations of information overload. In recent years, the class of session-based recommendation algorithms received more attention in the research literature. These algorithms base their recommendations solely on the observed interactions with the user in an ongoing session and do not require the existence of long-term preference profiles. Most recently, a number of deep learning based (“neural”) approaches to session-based recommendations were proposed. However, previous research indicates that today’s complex neural recommendation methods are not always better than comparably simple algorithms in terms of prediction accuracy. With this work, our goal is to shed light on the state-of-the-art in the area of session-based recommendation and on the progress that is made with neural approaches. For this purpose, we compare twelve algorithmic approaches, among them six recent neural methods, under identical conditions on various datasets. We find that the progress in terms of prediction accuracy that is achieved with neural methods is still limited. In most cases, our experiments show that simple heuristic methods based on nearest-neighbors schemes are preferable over conceptually and computationally more complex methods. Observations from a user study furthermore indicate that recommendations based on heuristic methods were also well accepted by the study participants. To support future progress and reproducibility in this area, we publicly share the <span style="font-variant:small-caps;"></span> evaluation framework that was used in our research.[^1] author: - Malte Ludewig - Noemi Mauro - Sara Latifi - Dietmar Jannach bibliography: - 'article.bib' subtitle: 'A Comparison of Neural and Non-Neural Approaches' title: 'Empirical Analysis of Session-Based Recommendation Algorithms' --- &lt;ccs2012&gt; &lt;concept&gt; &lt;concept\_id&gt;10002951.10003317.10003347.10003350&lt;/concept\_id&gt; &lt;concept\_desc&gt;Information systems Recommender systems&lt;/concept\_desc&gt; &lt;concept\_significance&gt;500&lt;/concept\_significance&gt; &lt;/concept&gt; &lt;concept&gt; &lt;concept\_id&gt;10002944.10011123.10011130&lt;/concept\_id&gt; &lt;concept\_desc&gt;General and reference Evaluation&lt;/concept\_desc&gt; &lt;concept\_significance&gt;500&lt;/concept\_significance&gt; &lt;/concept&gt; &lt;concept&gt; &lt;concept\_id&gt;10010147.10010257.10010293.10010294&lt;/concept\_id&gt; &lt;concept\_desc&gt;Computing methodologies Neural networks&lt;/concept\_desc&gt; &lt;concept\_significance&gt;300&lt;/concept\_significance&gt; &lt;/concept&gt; &lt;/ccs2012&gt; Introduction {#sec:introduction} ============ Recommender systems (RS) are software applications that help users in situations of information overload and they have become a common feature on many modern online services. Collaborative filtering (CF) techniques, which are based on behavioral data collected from larger user communities, are among the most successful technical approaches in practice. Historically, these approaches mostly rely on the assumption that information about longer-term preferences of the individual users are available, e.g., in the form of a user-item rating matrix [@Resnick:1994:GOA:192844.192905]. In many real-world applications, however, such longer-term information is often not available, because users are not logged in or because they are first-time users. In such cases, techniques that leverage behavioral patterns in a community can still be applied [@JannachZankerCF2018]. The difference is that instead of the long-term preference profiles only the observed interactions with the user in the ongoing session can be used to adapt the recommendations to the assumed needs, preferences, or intents of the user. Such a setting is usually termed a *session-based recommendation* problem [@QuadranaetalCSUR2018]. Interestingly, research on session-based recommendation was very scarce for many years despite the high practical relevance of the problem setting. Only in recent years, we can observe an increased interest in the topic in academia [@DBLP:journals/corr/abs-1902-04864], which is at least partially caused by the recent availability of public datasets in particular from the e-commerce domain. This increased interest in session-based recommendations coincides with the recent boom of deep learning (neural) methods in various application areas. Accordingly, it is not surprising that several neural session-based recommendation approaches were proposed in recent years, with [<span style="font-variant:small-caps;">gru4rec</span>]{}being one of the pioneering and most cited works in this context [@Hidasi2016GRU]. From the perspective of the evaluation of session-based algorithms, the research community—at the time when the first neural techniques were proposed—had not yet established a level of maturity as is the case for problem setups that are based on the traditional user-item rating matrix. This led to challenges that concerned both the question what represents the state-of-the-art in terms of algorithms and the question of the evaluation protocol when time-ordered user interaction logs are the input instead of a rating matrix. Partly due to this unclear situation, it soon turned out that in some cases comparably simple non-neural techniques, in particular ones based on nearest-neighbors approaches, can lead to very competitive or even better results than neural techniques [@JannachLudewig2017RecSys; @Ludewig2018]. Besides being competitive in terms of accuracy, such more simple approaches often have the advantage that their recommendations are more transparent and can more easily be explained to the users. Furthermore, these simpler methods can often be updated online when new data becomes available, without requiring expensive model retraining. However, during the last few years after the publication of [<span style="font-variant:small-caps;">gru4rec</span>]{}, we have mostly observed new proposals in the area of complex models. With this work, our aim is to assess the progress that was made in the last few years in a reproducible way. To that purpose, we have conducted an extensive set of experiments in which we compared twelve session-based recommendation techniques under identical conditions on a number of datasets. Among the examined techniques, there are six recent neural approaches, which were published at highly-ranked publication outlets such as KDD, AAAI, or SIGIR after the publication of the first version of [<span style="font-variant:small-caps;">gru4rec</span>]{}in 2015.[^2] The main outcome of our offline experiments is that the progress that is achieved with neural approaches to session-based recommendation is still limited. In most experiment configurations, one of the simple techniques outperforms all the neural approaches. In some cases, we could also not confirm that a more recently proposed neural method consistently outperforms the much earlier [<span style="font-variant:small-caps;">gru4rec</span>]{}method. Generally, our analyses point to certain underlying methodological issues, which were also observed in other application areas of applied machine learning. Similar observations regarding the competitiveness of established and often more simple approaches were made before, e.g., for the domains of information retrieval, time-series forecasting, and recommender systems, [@Yang:2019:CEH:3331184.3331340; @Ferraridacremaetal2019; @Makridakis2018; @Armstrong:2009:IDA:1645953.1646031], and it is important to note that these phenomena are not tied to deep learning approaches. To help overcome some of these problems for the domain of session-based recommendation, we share our evaluation framework <span style="font-variant:small-caps;"></span> online[^3]. The framework not only includes the algorithms that are compared in this paper, it also supports different evaluation procedures, implements a number of metrics, and provides pointers to the public datasets that were used in our experiments. Since offline experiments cannot inform us about the quality of the recommendation as *perceived* by users, we have furthermore conducted a user study. In this study, we compared heuristic methods with a neural approach and the recommendations produced by a commercial system (<span style="font-variant:small-caps;"></span>) in the context of an online radio station. The main outcomes of this study are that heuristic methods also lead to recommendations—playlists in this case—that are well accepted by users. The study furthermore sheds some light on the importance of other quality factors in the particular domain, i.e., the capability of an algorithm to help users discover new items. The paper is organized as follows. Next, in Section \[sec:algorithms\], we provide an overview of the algorithms that were used in our experiments. Section \[sec:methodology\] describes our offline evaluation methodology in more detail and Section \[sec:results\] presents the outcomes of the experiments. In Section \[sec:user-study\], we report the results of our user study. Finally, we summarize our findings and their implications in Section \[sec:discussion\]. Algorithms {#sec:algorithms} ========== Algorithms of various types were proposed over the years for session-based recommendation problems. A detailed overview of the more general family of *sequence-aware recommender systems*, where session-based ones are a part of, can be found in [@QuadranaetalCSUR2018]. In the context of this work, we limit ourselves to a brief summary of parts of the historical development and how we selected algorithms for inclusion in our evaluations. Historical Development and Algorithm Selection ---------------------------------------------- Nowadays, different forms of session-based recommendations can be found in practical applications. The recommendation of *related items* for a given reference object can, for example, be seen as a basic and very typical form of session-based recommendations in practice. In such settings, the selection of the recommendations is usually based solely on the very last item viewed by the user. Common examples are the recommendation of additional articles on news web sites or recommendations of the form “Customers who bought …also bought” on e-commerce sites. Another common application scenario is the creation of automated playlists, e.g., on YouTube, Spotify, or last.fm. Here, the system creates a virtually endless list of next-item recommendations based on some seed item and additional observations, e.g., skips or likes, while the media is played. These application domains—web page and news recommendation, e-commerce, music playlists—also represent the main driving scenarios in academic research. For the recommendation of *web pages* to visit, Mobasher et al. proposed one of the earliest session-based approaches based on frequent pattern mining in 2002 [@Mobasher2002]. In 2005, Shani et al. [@shani05mdp] investigated the use of an MDP-based (Markov Decision Process) approach for session-based recommendations in *e-commerce* and also demonstrated its value from a business perspective. Alternative technical approaches based on Markov processes were later on proposed in 2012 and 2013 for the *news* domain in [@DBLP:conf/recsys/GarcinDF13] and [@DBLP:conf/webi/GarcinZFS12]. A early approach to *music playlist generation* was proposed in 2005 [@Ragno:2005:ISM:1101826.1101840], where the selection of items was based on the similarity with a seed song. The music domain was however also very important for collaborative approaches. In 2012, the authors of [@hariri12context] used a session-based nearest-neighbors technique as part of their approach for playlist generation. This nearest-neighbors method and improved versions thereof later on turned out to be highly competitive with today’s neural methods [@Ludewig2018]. More complex methods were also proposed for the music domain, e.g., an approach based on Latent Markov Embeddings [@Chen:2012:PPV:2339530.2339643] from 2012. Some novel technical proposals in the years 2014 and 2015 were based on a non-public *e-commerce* dataset from a European fashion retailer and either used Markov processes and side information [@tavakol14fmdp] or a simple re-ranking scheme based on short-term intents [@Jannach2015]. More importantly, however, in the year 2015, the ACM RecSys conference hosted a challenge, where the problem was to predict if a consumer will make a purchase in a given session, and if so, to predict which item will be purchased. A corresponding dataset (YOOCHOOSE) was released by an industrial partner, which is very frequently used today for benchmarking session-based algorithms. Technically, the winning team used a two-stage classification approach and invested a lot of effort into feature engineering to make accurate predictions [@Romov:2015:RCE:2813448.2813510]. In late 2015, Hidasi et al. [@Hidasi2016GRU] then published the probably first deep learning based method for session-based recommendation called [<span style="font-variant:small-caps;">gru4rec</span>]{}, a method which was continuously improved later on, e.g., in [@Hidasi:2018:RNN:3269206.3271761] or [@Tan2016GruPlus]. In their work, they also use the mentioned YOOCHOOSE dataset for evaluation, although with the slightly different optimization goal, i.e., to predict the immediate next item click event. As one of their baselines, they used an item-based nearest-neighbors technique. They found that their neural method is significantly better than this technique in terms of prediction accuracy. The proposal of their method and the booming interest in neural approaches subsequently led to a still ongoing wave of new proposals that apply deep learning approaches to session-based recommendation problems. In this present work, we consider a selection of algorithms that reflects these historical developments. We consider basic algorithms based on item co-occurrences, sequential patterns and Markov processes as well as methods that implement session-based nearest-neighbors techniques. Looking at neural approaches, we benchmark the latest versions of [<span style="font-variant:small-caps;">gru4rec</span>]{}as well as five other methods that were published later and which state that they outperform at least the initial version of [<span style="font-variant:small-caps;">gru4rec</span>]{}to a significant extent. Regarding the selected neural approaches, we limit ourselves to methods that do not use side information about the items in order to make our work easily reproducible and not dependent on such meta-data. Another constraint for the inclusion in our comparison is that the work was published in one of the major conferences, i.e., one that is rated A or A\* according to the Australian CORE scheme. Finally, while in theory algorithms should be reproducible based on the technical descriptions in the paper, there are usually many small implementation details that can influence the outcome of the measurement. Therefore, like in [@Ferraridacremaetal2019], we only considered approaches where the source code was available and could be integrated in our evaluation framework with reasonable effort. Considered Algorithms --------------------- In total, we considered 12 algorithms in our comparison. Table \[tab:non-neural-baselines\] provides an overview of the *non-neural* methods. Table \[tab:neural-methods\] correspondingly shows the neural methods considered in our analysis, ordered by their publication date. [1]{}[@p[1.1cm]{}X@]{} [<span style="font-variant:small-caps;">ar</span>]{}& This simple “Association Rules” method counts pairwise item co-occurrences in the training sessions. Recommendations for an ongoing session are generated by this method by returning those items that most frequently co-occurred with the last item of the current session in the past. For a formal definition, see [@Ludewig2018].\ [<span style="font-variant:small-caps;">sr</span>]{}& This method called “Sequential Rules” was proposed in [@Ludewig2018]. It is similar to [<span style="font-variant:small-caps;">ar</span>]{}in that it counts pairwise item co-occurrences in the training sessions. In addition to [<span style="font-variant:small-caps;">ar</span>]{}, however, it considers the order of the items in a session and the distance between them using a decay function. The method often led to competitive results in particular in terms of the Mean Reciprocal Rank in the analysis in [@Ludewig2018].\ [<span style="font-variant:small-caps;">sknn</span>]{}/[<span style="font-variant:small-caps;">v-sknn</span>]{}& The analysis in [@JannachLudewig2017RecSys] showed that a simple session-based nearest-neighbors method similar to the one from [@Hariri2015] was competitive with the first version for [<span style="font-variant:small-caps;">gru4rec</span>]{}. Conceptually, the idea is to find past sessions that contain the same elements as the ongoing session. The recommendations are then based by selecting items that appeared in the most similar past session. Since the sequence in which items are consumed in the ongoing user session might be of importance in the recommendation process, a number of “sequential extensions” to the [<span style="font-variant:small-caps;">sknn</span>]{}method were proposed in [@Ludewig2018]. Here, the order of the items in a session proved to be helpful, both when calculating the similarities as well as in the item scoring process. Furthermore, according to [@Ludewig2018rsc] it can be beneficial to put more emphasis on less popular items by applying an Inverse-Document-Frequency(IDF) weighting scheme. In this paper, all those extensions are implemented in the [<span style="font-variant:small-caps;">v-sknn</span>]{}method.\ [<span style="font-variant:small-caps;">stan</span>]{}& This method called “Sequence and Time Aware Neighborhood” was presented at SIGIR ’19 [@Garg:2019]. [<span style="font-variant:small-caps;">stan</span>]{}is based on [<span style="font-variant:small-caps;">sknn</span>]{}[@JannachLudewig2017RecSys], but it additionally takes into account the following factors for making recommendations: i) the position of an item in the current session, ii) the recency of a past session w.r.t. to the current session, and iii) the position of a recommendable item in a neighboring session. Their results show that [<span style="font-variant:small-caps;">stan</span>]{}significantly improves over [<span style="font-variant:small-caps;">sknn</span>]{}, and is even comparable to recently proposed state-of-the-art deep learning approaches.\ [<span style="font-variant:small-caps;">vstan</span>]{}& This method, which we propose in this present paper, combines the ideas from [<span style="font-variant:small-caps;">stan</span>]{}and [<span style="font-variant:small-caps;">v-sknn</span>]{}in a single approach. It incorporates all three previously mentioned particularities of [<span style="font-variant:small-caps;">stan</span>]{}, which already share some similarities with the [<span style="font-variant:small-caps;">v-sknn</span>]{}method. Furthermore, we add a sequence-aware item scoring procedure as well as the IDF weighting scheme from [<span style="font-variant:small-caps;">v-sknn</span>]{}.\ [<span style="font-variant:small-caps;">ct</span>]{}& This technique is based on Context Trees, which were originally proposed for lossless data compression. It is a non-parametric method and based on variable-order Markov models. The method was proposed in [@Mi2018ct], where it showed promising results.\ [1]{}[@p[1.7cm]{}X@]{} [<span style="font-variant:small-caps;">gru4rec</span>]{}& [<span style="font-variant:small-caps;">gru4rec</span>]{}[@Hidasi2016GRU] was the first neural approach that employed RNNs for session-based recommendation. This technique uses Gated Recurrent Units (GRU) [@DBLP:journals/corr/ChoMBB14] to deal with the vanishing gradient problem. The technique was later on improved using more effective loss functions [@Hidasi:2018:RNN:3269206.3271761].\ [<span style="font-variant:small-caps;">narm</span>]{}& This model [@Li2017narm] extends [<span style="font-variant:small-caps;">gru4rec</span>]{}and improves its session modeling with the introduction of a hybrid encoder with an attention mechanism. The attention mechanism is in particular used to consider items that appeared earlier in the session and which are similar to the last clicked one. The recommendation scores for each candidate item are computed with a bilinear matching scheme based on the unified session representation.\ [<span style="font-variant:small-caps;">stamp</span>]{}& In contrast to [<span style="font-variant:small-caps;">narm</span>]{}, this model [@Liu2018stamp] does not rely on an RNN. A short-term attention/memory priority model is proposed, which is (a) capable of capturing the users’ general interests from the long-term memory of a session context, and which (b) also takes the users’ most recent interests from the short-term memory into account. The users’ general interests are captured by an external memory built from all the historical clicks in a session prefix (including the last click). The attention mechanism is built on top of the embedding of the last click that represents the user’s current interests.\ [<span style="font-variant:small-caps;">nextitnet</span>]{}& This recent model [@Yuan2019nextitnet] also discards RNNs to model user sessions. In contrast to [<span style="font-variant:small-caps;">stamp</span>]{}, convolutional neural networks are adopted with a few domain-specific enhancements. The generative model is designed to explicitly encode item inter-dependencies, which allows to directly estimate the distribution of the output sequence (rather than the desired item) over the raw item sequence. Moreover, to ease the optimization of the deep generative architecture, the authors propose to use residual networks to wrap convolutional layer(s) by residual block.\ [<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}& This method [@DBLP:journals/corr/abs-1811-00855] models session sequences as graph structured data (i.e., directed graphs). Based on the session graph, [<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}is capable of capturing transitions of items and generating item embedding vectors correspondingly, which are difficult to be revealed by conventional sequential methods like MC-based and RNN-based methods. With the help of item embedding vectors, [<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}furthermore aims to construct reliable session representations from which the next-click item can be inferred.\ [<span style="font-variant:small-caps;">csrm</span>]{}& This method [@Wang:2019:CSR:3331184.3331210] is a hybrid framework that uses collaborative neighborhood information in session-based recommendations. [<span style="font-variant:small-caps;">csrm</span>]{}consists of two parallel modules: an Inner Memory Encoder (IME) and an Outer Memory Encoder (OME). The IME models a user’s own information in the current session with the help of Recurrent Neural Networks (RNNs) and an attention mechanism. The OME exploits collaborative information to better predict the intent of current sessions by investigating neighborhood sessions. Then, a fusion gating mechanism is used to selectively combine information from the IME and OME to obtain the final representation of the current session. Finally, [<span style="font-variant:small-caps;">csrm</span>]{}obtains a recommendation score for each candidate item by computing a bi-linear match with the final representation of the current session.\ Except for the [<span style="font-variant:small-caps;">ct</span>]{}method, the non-neural methods from Table \[tab:non-neural-baselines\] are conceptually very simple or almost trivial. As mentioned above, this can lead to a number of potential practical advantages compared to more complex models, e.g., regarding online updates and explainability. From the perspective of the computational costs, the time needed to “train” the simple methods is often low, as this phase often reduces to counting item co-occurrences in the training data or to preparing some in-memory data structures. To make the nearest-neighbors technique scalable, we implemented the internal data structures and data sampling strategies proposed in [@JannachLudewig2017RecSys]. As a result, the [<span style="font-variant:small-caps;">ct</span>]{}method is the only one from the set of non-neural methods for which we encountered scalability issues in the form of memory consumption and prediction time when the set of recommendable items is huge. Regarding alternative non-neural approaches, note that in the evaluation in [@Ludewig2018], a number of additional methods were considered. We do not include these methods ([<span style="font-variant:small-caps;">iknn</span>]{}, [<span style="font-variant:small-caps;">fpmc</span>]{}, [<span style="font-variant:small-caps;">mc</span>]{}, [<span style="font-variant:small-caps;">smf</span>]{}, [<span style="font-variant:small-caps;">bpr-mf</span>]{}, [<span style="font-variant:small-caps;">fism</span>]{}, [<span style="font-variant:small-caps;">fossil</span>]{}) in our present analysis, because previous research showed that these methods either are generally not competitive or only lead to competitive results in a few special cases. [1]{}[@Xlcccccccc@]{} Method & Publication & [<span style="font-variant:small-caps;">iknn</span>]{}& [<span style="font-variant:small-caps;">sknn</span>]{}& [<span style="font-variant:small-caps;">bpr-mf</span>]{}& [<span style="font-variant:small-caps;">fpmc</span>]{}& [<span style="font-variant:small-caps;">gru4rec</span>]{}& [<span style="font-variant:small-caps;">narm</span>]{}& [<span style="font-variant:small-caps;">stamp</span>]{}\ [<span style="font-variant:small-caps;">gru4rec</span>]{}& ICLR (05/16) & & & & & & &\ [<span style="font-variant:small-caps;">gru4rec+</span>]{}& RecSys (09/16) & & & & & & & &\ [<span style="font-variant:small-caps;">narm</span>]{}& CIKM (11/17) & & & & & & &\ [<span style="font-variant:small-caps;">stamp</span>]{}& KDD (08/18) & & & & & & &\ [<span style="font-variant:small-caps;">gru4rec2</span>]{}& CIKM (10/18) & & & & & & &\ [<span style="font-variant:small-caps;">nextitnet</span>]{}& WSDM (02/19) & & & & & & &\ [<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}& AAAI (02/19) & & & & & & &\ [<span style="font-variant:small-caps;">csrm</span>]{}& SIGIR (07/19) & & & & & & &\ The development over time regarding the *neural* approaches is summarized in Table \[tab:used-baselines-neural-approaches\]. The table also indicates which baselines were used in the original papers. The analysis shows that [<span style="font-variant:small-caps;">gru4rec</span>]{}was considered as a baseline in all papers. Most papers refer to the original [<span style="font-variant:small-caps;">gru4rec</span>]{}publication from 2016 or an early improved version that was proposed shortly afterwards (which we term [<span style="font-variant:small-caps;">gru4rec+</span>]{}here, see [@Tan2016GruPlus]). Most papers, however, do not refer to the improved version ([<span style="font-variant:small-caps;">gru4rec2</span>]{}) discussed in [@Hidasi:2018:RNN:3269206.3271761]. Since the public code for [<span style="font-variant:small-caps;">gru4rec</span>]{}was constantly updated, we however assume that the authors ran benchmarks against the updated versions. [<span style="font-variant:small-caps;">narm</span>]{}, as one of the earlier neural techniques, is the only neural method other than [<span style="font-variant:small-caps;">gru4rec</span>]{}that is considered quite frequently by more recent works. The analysis of the used baselines furthermore showed that only one of the more recent papers proposing a neural method considers, i.e., [@Wang:2019:CSR:3331184.3331210], session-based nearest-neighbors techniques as a baseline, even though their competitiveness was documented in a publication at the ACM Recommender Systems conference in 2017 [@JannachLudewig2017RecSys]. The authors of [@Wang:2019:CSR:3331184.3331210] however only consider the original proposal and not the improved versions from 2018 [@Ludewig2018]. The only other papers in our analysis, which consider session-based nearest-neighbors techniques as baselines, are about non-neural techniques ([<span style="font-variant:small-caps;">ct</span>]{}and [<span style="font-variant:small-caps;">stan</span>]{}). The paper proposing [<span style="font-variant:small-caps;">stan</span>]{}furthermore is an exception in that since it considers quite a number of neural approaches ([<span style="font-variant:small-caps;">gru4rec2</span>]{}, [<span style="font-variant:small-caps;">stamp</span>]{}, [<span style="font-variant:small-caps;">narm</span>]{}, [<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}) in its comparison. Evaluation Methodology {#sec:methodology} ====================== We benchmarked all methods under the same conditions, using the evaluation framework that we share online to ensure reproducibility of our results. Datasets {#subsec.datasets} -------- We considered eight datasets from two domains for our evaluation, e-commerce and music. Six of them are public and several of them were previously used to benchmark session-based recommendation algorithms. Table \[tab:datasets\] briefly describes the datasets. \[h!t\] [1]{}[@lX@]{} [RSC15]{}& E-commerce dataset used in the 2015 ACM RecSys Challenge.\ [RETAIL]{}& An e-commerce dataset from the company Retail Rocket.\ [DIGI]{}& An e-commerce dataset shared by the company Diginetica.\ [ZALANDO]{}& A non-public dataset consisting of interaction logs from the European fashion retailer Zalando.\ [30MU]{}& Music listening logs obtained from Last.fm.\ [NOWP]{}& Music listening logs obtained from Twitter.\ [AOTM]{}& A public music dataset containing music playlists.\ [8TRACKS]{}& A private music dataset with hand-crafted playlists.\ We pre-processed the original datasets in a way that all sessions with only one interaction were removed. As done in previous works, we also removed from sessions items that appeared less than 5 times in the dataset. Furthermore, we use an evaluation procedure where we run repeated measurements on several subsets (splits) of the original data, see Section \[subsec:evaluation-procedure\]. The average characteristics of the subsets for each dataset are shown in Table \[tab:dataset-characteristics\]. We share all datasets except [ZALANDO]{}and [8TRACKS]{}online. [1]{}[@Xrrrrrrrr@]{} Dataset & [RSC15]{}& [RETAIL]{}& [DIGI]{}& [ZALANDO]{}& [30MU]{}& [NOWP]{}& [AOTM]{}& [8TRACKS]{}\ Actions & 5.4M & 210k & 264k & 4.5M & 640k & 271k & 307k & 1.5M\ Sessions & 1.4M & 60k & 55k & 365k & 37k & 27k & 22k & 132k\ Items & 29k & 32k & 32k & 189k & 91k & 75k & 91k & 376k\ Days cov. & 31 & 27 & 31 & 90 & 90 & 90 & 90 & 90\ Actions/Sess. & 3.95 & 3.54 & 4.78 & 12.43 & 17.11 & 10.04 & 14.02 & 11.32\ Items/Sess. & 3.17 & 2.56 & 4.01 & 8.39 & 14.47 & 9.38 & 14.01 & 11.31\ Actions/Day & 175k & 8k & 8.5k & 50k & 7k & 3.0k & 3.4k & 16.6k\ Sessions/Day & 44k & 2.2k & 1.7k & 4k & 300 & 243 & 243 & 1.4k\ Evaluation Procedure and Metrics {#subsec:evaluation-procedure} -------------------------------- #### Data Splitting Approach. We apply the following procedure to create train-test splits. Since most datasets consist of time-ordered events, usual cross-validation procedures with the randomized allocation of events across data splits cannot be applied. Several authors only use one single time-ordered training-test split for their measurements. This, however, can lead to undesired random effects. We therefore rely on a protocol where we create five non-overlapping and contiguous subsets (splits) of the datasets. As done in previous works, we use the last *n* days of each split for evaluation (testing) and the other days for training the models.[^4] The reported measurements correspond to the averaged results obtained for each split. The playlist datasets ([AOTM]{}and [8TRACKS]{}) are exceptions here as they do not have timestamps. For these datasets, we therefore randomly generated timestamps, which allows us to use the same procedure as for the other datasets. #### Hyper-parameter Optimization. Proper hyper-parameter tuning is essential when comparing machine learning approaches. We therefore tuned all hyper-parameters for all methods and datasets in a systematic approach, using MRR@20 as an optimization target as done in previous works. Technically, we created subsets from the training data for validation. The size of the validation set was chosen in a way that it covered the same number of days that was used in the final test set. We applied a random hyper-parameter optimization approach with 100 iterations as done in [@Hidasi:2018:RNN:3269206.3271761; @Liu2018stamp; @Li2017narm]. Since [<span style="font-variant:small-caps;">narm</span>]{}and [<span style="font-variant:small-caps;">csrm</span>]{}only have a smaller set of hyper-parameters, we only had to do 50 iterations for these methods. For the [<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}method, we had to limit the number of iterations for the [ZALANDO]{}dataset to 40, because tuning was particularly time-consuming. The final hyper-parameter values for each method and dataset can be found online, along with a description of the investigated ranges. #### Accuracy Measures. For each session in the test set, we incrementally reveal one event of a session after the other, as was proposed in [@Hidasi2016GRU]. The task of the recommendation algorithm is to generate a prediction for the next event(s) in the session in the form of a ranked list of items. The resulting list can then be used to apply standard accuracy measures from information retrieval. The measurement can be done in two different ways. - As in [@Hidasi2016GRU] and other works, we can measure if the immediate next item is part of the resulting list and at which position it is ranked. The corresponding measures are the Hit Rate and the Mean Reciprocal Rank. - In typical information retrieval scenarios, however, one is usually not interested in having one item right (e.g., the first search result), but in having as many predictions as possible right in a longer list that is displayed to the user. For session-based recommendation scenarios, this applies as well, as usually, e.g., on music and e-commerce sites, more than one recommendation is displayed. Therefore, we measure Precision and Recall in the usual way, by comparing the objects of the returned list with the entire remaining session, assuming that not only the immediate next item is relevant for the user. In addition to Precision and Recall, we also report the Mean Average Precision metric. The most common cut-off threshold in the literature is 20, probably because this was the chosen threshold by the authors of [<span style="font-variant:small-caps;">gru4rec</span>]{}[@Hidasi2016GRU]. We have made measurements for alternative list lengths as well, but will only report the results when using 20 as a list length in this paper. We report additional results for cut-off thresholds of 5 and 10 in an online appendix.[^5] #### Coverage and Popularity. Depending on the application domain, factors other than prediction accuracy might be relevant as well, including coverage, novelty, diversity, or serendipity [@Shani2011]. Since we do not have information about item characteristics, we focus on questions of coverage and novelty in this work. With *coverage*, we here refer to what is sometimes called “aggregate diversity” [@Adomavicius:2012:IAR:2197072.2197127]. Specifically, we measure the fraction of items of the catalog that ever appears in any top-n list presented to the users in the test set. This coverage measure in some ways also measures the level of context adaptation, i.e., if an algorithm tends to recommend the same set of items to everyone or specifically varies the recommendations for a given session. We approximate the *novelty* level of an algorithm by measuring how popular the recommended items are on average. The underlying assumption is that recommending more unpopular items leads to higher novelty and discovery effects. Algorithms that mostly focus on the recommendation of popular items might be undesirable from a business perspective, e.g., when the goal is to leverage the potential of the long tail in e-commerce settings. Technically, we measure the *popularity* level of an algorithm as follows. First, we compute min-max normalized popularity values of each item in the training set. Then, during evaluation, we compute the popularity level of an algorithm by determining the average popularity value of each item that appears in its top-n recommendation list. Higher values correspondingly mean that an algorithm has a tendency to recommend rather popular items. #### Running Times. Complex neural models can need substantial computational resources to be trained. Training a “model”, i.e., calculating the statistics, for co-occurrence based approaches like [<span style="font-variant:small-caps;">sr</span>]{}or [<span style="font-variant:small-caps;">ar</span>]{}can, in contrast, be done very efficiently. For nearest-neighbors based approaches, actually no model is learned at all. Instead, some of our nearest-neighbors implementations need some time to create internal data structures that allow for efficient recommendation at prediction time. In the context of this paper, we will report running times for some selected datasets from e-commerce. We executed all experiments on the same physical machine. The running times for the neural methods were determined using a GPU; the non-neural methods used a CPU. In theory, running times should be compared on the same hardware. Thererfore, since the running times of the neural methods are much longer even when a GPU can be used, we can assume that the true difference in computational complexity is in fact even higher than we can see in our measurements. #### Stability with Respect to New Data In some application domains, e.g., news recommendation or e-commerce, new user-item interaction data can come in at a high rate. Since retraining the models to accommodate the new data can be costly, a desirable characteristic of an algorithm can be that the performance of the model does not degenerate too quickly before the retraining happens. To put it differently, it is desirable that the models do not overfit too much to the training data. To investigate this particular form of model stability, we proceeded as follows. First, we trained a model on the training data $T_0$ of a given train-test split[^6]. Then, we made measurements using two different protocols, which we term *retraining* and *no-retraining*, respectively. - In the *retraining* configuration, we first evaluated the model that was trained on $T_0$ using the data of the first day of the test set. Then, we added this first day of the test set to $T_0$ and retrained the model on this extended dataset, which we name $T_1$. Then, we continued with the evaluation with the data from the second day of the test data, using the model trained on $T_1$. This process of adding more data to the training set, retraining the full model, and evaluating on the next day of the test set was done for all days of the test set. - In the *no-retraining* configuration, we also evaluated the performance day by day on the test data, but did not retrain the models, i.e., we used the model trained on $T_0$ for all days in the test data. To enable a fair comparison in both configurations, we only considered items in the evaluation phase that appeared at least once in the original training data $T_0$. Note that the absolute accuracy values for a given test day depends on the characteristics of the recorded data on that day. In some cases, the accuracy for the second test day can therefore even be higher than for the first test day, even if there was no retraining. An exact comparison of absolute values is therefore not too meaningful. However, we consider the *relative* accuracy drop when using the initial model $T_0$ for a number of consecutive days as an indicator of the generalizability or stability of the learned models, provided that the investigated algorithms start from a comparable accuracy level. \[tab:results-ec\] [1]{}[@Xrrr|rr|rr@]{} Metrics & MAP@20 & P@20 & R@20 & HR@20 & MRR@20 & COV@20 & POP@20\ \ [<span style="font-variant:small-caps;">stan</span>]{}& [**0.0285**]{} & [**0.0543**]{} & [**0.4748**]{} & [**0.5938**]{} & [$*$**0.3638**]{} & 0.5929 & 0.0518\ [<span style="font-variant:small-caps;">vstan</span>]{}& 0.0284 & 0.0542 & 0.4741 & 0.5932 & 0.3636 & & 0.0488\ [<span style="font-variant:small-caps;">sknn</span>]{}& 0.0283 & 0.0532 & 0.4707 & 0.5788 & 0.3370 & 0.5709 & 0.0540\ [<span style="font-variant:small-caps;">v-sknn</span>]{}& 0.0278 & 0.0531 & 0.4632 & 0.5745 & 0.3395 & 0.5562 & 0.0598\ *[<span style="font-variant:small-caps;">gru4rec</span>]{}* & & & & & 0.3237 & [$*$**0.7973**]{} & [**0.0347**]{}\ *[<span style="font-variant:small-caps;">narm</span>]{}* & 0.0270 & 0.0501 & 0.4526 & 0.5549 & 0.3196 & 0.6472 & 0.0569\ *[<span style="font-variant:small-caps;">csrm</span>]{}* & 0.0252 & 0.0467 & 0.4246 & 0.5169 & 0.2955 & 0.6049 & 0.0496\ *[<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}* & 0.0241 & 0.0441 & 0.4125 & 0.4998 & & 0.5521 & 0.0743\ *[<span style="font-variant:small-caps;">stamp</span>]{}* & 0.0223 & 0.0420 & 0.3806 & 0.4620 & 0.2527 & 0.4865 & 0.0677\ [<span style="font-variant:small-caps;">ar</span>]{}& 0.0205 & 0.0387 & 0.3533 & 0.4367 & 0.2407 & 0.5444 & 0.0527\ [<span style="font-variant:small-caps;">sr</span>]{}& 0.0194 & 0.0362 & 0.3359 & 0.4174 & 0.2453 & 0.5185 &\ *[<span style="font-variant:small-caps;">nextitnet</span>]{}* & 0.0173 & 0.0320 & 0.3051 & 0.3779 & 0.2038 & 0.5737 & 0.0703\ [<span style="font-variant:small-caps;">ct</span>]{}& 0.0162 & 0.0308 & 0.2902 & 0.3632 & 0.2305 & 0.4026 & 0.3740\ \ [<span style="font-variant:small-caps;">sknn</span>]{}& [**0.0255**]{} & [**0.0596**]{} & 0.3715 & 0.4748 & 0.1714 & 0.8701 & 0.1026\ [<span style="font-variant:small-caps;">vstan</span>]{}& 0.0252 & 0.0588 & [**0.3723**]{} & [$*$**0.4803**]{} & [$*$**0.1837**]{} & 0.9384 & 0.0858\ [<span style="font-variant:small-caps;">stan</span>]{}& 0.0252 & 0.0589 & 0.3720 & 0.4800 & 0.1828 & 0.9161 & 0.0964\ [<span style="font-variant:small-caps;">v-sknn</span>]{}& 0.0249 & 0.0584 & 0.3668 & 0.4729 & 0.1784 & & 0.0840\ *[<span style="font-variant:small-caps;">gru4rec</span>]{}* & & & & & & [**0.9498**]{} & [**0.0567**]{}\ *[<span style="font-variant:small-caps;">csrm</span>]{}* & 0.0227 & 0.0544 & 0.3335 & 0.4258 & 0.1421 & 0.7337 & 0.0833\ *[<span style="font-variant:small-caps;">narm</span>]{}* & 0.0218 & 0.0528 & 0.3254 & 0.4188 & 0.1392 & 0.8696 & 0.0832\ *[<span style="font-variant:small-caps;">stamp</span>]{}* & 0.0201 & 0.0489 & 0.3040 & 0.3917 & 0.1314 & 0.9188 & 0.0799\ [<span style="font-variant:small-caps;">ar</span>]{}& 0.0189 & 0.0463 & 0.2872 & 0.3720 & 0.1280 & 0.8892 & 0.0863\ *[<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}* & 0.0186 & 0.0451 & 0.2840 & 0.3638 & 0.1564 & 0.8593 & 0.1092\ [<span style="font-variant:small-caps;">sr</span>]{}& 0.0161 & 0.0401 & 0.2489 & 0.3277 & 0.1216 & 0.8736 &\ *[<span style="font-variant:small-caps;">nextitnet</span>]{}* & 0.0149 & 0.0380 & 0.2416 & 0.2922 & 0.1424 & 0.7935 & 0.0947\ [<span style="font-variant:small-caps;">ct</span>]{}& 0.0115 & 0.0294 & 0.1860 & 0.2494 & 0.1075 & 0.7554 & 0.4262\ \ [<span style="font-variant:small-caps;">vstan</span>]{}& [**0.0168**]{} & [$*$**0.0777**]{} & [$*$**0.2073**]{} & [$*$**0.5362**]{} & 0.2488 & 0.5497 &\ [<span style="font-variant:small-caps;">stan</span>]{}& 0.0167 & 0.0774 & 0.2062 & 0.5328 & 0.2468 & 0.4918 & 0.0734\ [<span style="font-variant:small-caps;">v-sknn</span>]{}& 0.0158 & 0.0740 & 0.1956 & 0.5162 & 0.2487 & & 0.0680\ [<span style="font-variant:small-caps;">sknn</span>]{}& 0.0157 & 0.0738 & 0.1891 & 0.4352 & 0.1724 & 0.3316 & 0.0843\ *[<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}* & & & & 0.4755 & 0.2804 & 0.3845 & 0.0865\ *[<span style="font-variant:small-caps;">narm</span>]{}* & 0.0144 & 0.0692 & 0.1795 & 0.4598 & 0.2248 & 0.3695 & 0.0837\ *[<span style="font-variant:small-caps;">csrm</span>]{}* & 0.0143 & 0.0695 & 0.1764 & 0.4500 & 0.2347 & 0.2767 & 0.0789\ *[<span style="font-variant:small-caps;">gru4rec</span>]{}* & 0.0143 & 0.0666 & 0.1797 & & [**0.3069**]{} & [**0.6365**]{} & [$*$**0.0403**]{}\ [<span style="font-variant:small-caps;">sr</span>]{}& 0.0136 & 0.0638 & 0.1739 & 0.4824 & & 0.5849 & 0.0696\ [<span style="font-variant:small-caps;">ar</span>]{}& 0.0133 & 0.0631 & 0.1690 & 0.4665 & 0.2579 & 0.4672 & 0.0886\ [<span style="font-variant:small-caps;">ct</span>]{}& 0.0118 & 0.0564 & 0.1573 & 0.4561 & 0.2993 & 0.4653 & 0.2564\ *[<span style="font-variant:small-caps;">stamp</span>]{}* & 0.0104 & 0.0515 & 0.1359 & 0.3687 & 0.2065 & 0.2234 & 0.0868\ \ *[<span style="font-variant:small-caps;">narm</span>]{}* & [**0.0357**]{} & [**0.0735**]{} & [**0.5109**]{} & & 0.3047 & 0.6399 & 0.0638\ *[<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}* & 0.0351 & 0.0725 & 0.5060 & 0.6713 & [**0.3142**]{} & 0.5105 & 0.0720\ [<span style="font-variant:small-caps;">vstan</span>]{}& & & & [**0.6761**]{} & 0.2943 & 0.6762 &\ *[<span style="font-variant:small-caps;">csrm</span>]{}* & 0.0346 & 0.0714 & 0.4952 & 0.6566 & 0.2961 & 0.5929 & 0.0626\ *[<span style="font-variant:small-caps;">stamp</span>]{}* & 0.0344 & 0.0713 & 0.4979 & 0.6654 & 0.3033 & 0.5803 & 0.0655\ [<span style="font-variant:small-caps;">stan</span>]{}& 0.0342 & 0.0701 & 0.4986 & 0.6656 & 0.2933 & & 0.0773\ [<span style="font-variant:small-caps;">v-sknn</span>]{}& 0.0341 & 0.0707 & 0.4937 & 0.6512 & 0.2872 & 0.6333 & 0.0777\ *[<span style="font-variant:small-caps;">gru4rec</span>]{}* & 0.0334 & 0.0682 & 0.4837 & 0.6480 & 0.2826 & [**0.7482**]{} & [**0.0294**]{}\ [<span style="font-variant:small-caps;">sr</span>]{}& 0.0332 & 0.0684 & 0.4853 & 0.6506 & 0.3010 & 0.6674 & 0.0716\ [<span style="font-variant:small-caps;">ar</span>]{}& 0.0325 & 0.0673 & 0.4760 & 0.6361 & 0.2894 & 0.6297 & 0.0926\ [<span style="font-variant:small-caps;">sknn</span>]{}& 0.0318 & 0.0657 & 0.4658 & 0.5996 & 0.2620 & 0.6099 & 0.0796\ [<span style="font-variant:small-caps;">ct</span>]{}& 0.0316 & 0.0654 & 0.4710 & 0.6359 & & 0.6270 & 0.1446\ Results {#sec:results} ======= In this section, we report the results of our offline evaluation. We will first focus on accuracy, then look at alternative quality measures, and finally discuss aspects of scalability and the stability of different models over time. Accuracy Results ---------------- #### E-Commerce Datasets. Table \[tab:results-ec\] shows the results for the e-commerce datasets. The highest value across all techniques is printed in bold; the highest value obtained by the other family of algorithms—neural or non-neural—is underlined. Stars indicate significant differences (p$<$0.05) according to a Kruskal–Wallis test between all the models and a Wilcoxon signed-rank test between the best-performing techniques from each category. The results for the individual datasets can be summarized as follows. - On the [RETAIL]{}dataset, the nearest-neighbors methods consistently lead to the highest accuracy results on all the accuracy measures. Among the complex models, the best results were obtained by [<span style="font-variant:small-caps;">gru4rec</span>]{}on all the measures except for MRR, where [<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}led to the best value. The results for [<span style="font-variant:small-caps;">narm</span>]{}and [<span style="font-variant:small-caps;">gru4rec</span>]{}are almost identical on most measures. - The results for the [DIGI]{}dataset are comparable, with the neighborhood methods leading to the best accuracy results. [<span style="font-variant:small-caps;">gru4rec</span>]{}is again the best method across the complex models on all the measures. - For the [ZALANDO]{}dataset, the neighborhood methods dominate all accuracy measures, except for the MRR. Here, [<span style="font-variant:small-caps;">gru4rec</span>]{}is minimally better than the simple [<span style="font-variant:small-caps;">sr</span>]{}method. Among the complex models, [<span style="font-variant:small-caps;">gru4rec</span>]{}achieves the best HR value, and the recent [<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}method is the best one on the other accuracy measures. - Only for the [RSC15]{}dataset, we can observe that a neural method ([<span style="font-variant:small-caps;">narm</span>]{}) is able to slightly outperform our best simple baseline [<span style="font-variant:small-caps;">vstan</span>]{}in terms of MAP, Precision and Recall. Interestingly, however, [<span style="font-variant:small-caps;">narm</span>]{}is one of the earlier neural methods in this comparison. The best Hit Rate is achieved by [<span style="font-variant:small-caps;">vstan</span>]{}; the best MRR by [<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}. The differences between the best neural and non-neural methods are often tiny, in most cases around or less than 1%. Looking at the results across the different datasets, we can make the following additional observations. - Across all e-commerce datasets, the [<span style="font-variant:small-caps;">vstan</span>]{}method proposed in this paper is, for most measures, the best neighborhood-based method. This suggests that it is reasonable to include it as a baseline in future performance comparisons. - The ranking of the *neural* methods varies largely across the datasets and does not follow the order in which the methods were proposed. Like for the non-neural methods, the specific ranking therefore seems to be strongly depending on the dataset characteristics. This makes it particularly difficult to judge the progress that is made when only one or two datasets are used for the evaluation. - The results for the [RSC15]{}dataset are generally different from the other results. Specifically, we found that some neural methods are competitive and slightly outperform our baselines. [<span style="font-variant:small-caps;">stamp</span>]{}is not among the top performers except for this dataset. Unlike for other e-commerce datasets, [<span style="font-variant:small-caps;">ct</span>]{}works particularly well for this dataset in terms of the MRR. Given these observations, it seems that the [RSC15]{}dataset has some unique characteristics that are different from the other e-commerce datasets. Therefore, it seems advisable to consider multiple datasets with different characteristics in future evaluations. - We did not include measurements for [<span style="font-variant:small-caps;">nextitnet</span>]{}, one of the most recent methods, for the larger [ZALANDO]{}and [RSC15]{}datasets. We found that this method does not scale well and we could not complete the hyper-parameter tuning process within weeks on our machines (also for two music datasets). [1]{}[@Xrrr|rr|rr@]{} Metrics & MAP@20 & P@20 & R@20 & HR@20 & MRR@20 & COV@20 & POP@20\ \ & [$*$**0.0193**]{} & [**0.0664**]{} & [$*$**0.1828**]{} & 0.2534 & 0.0810 & 0.4661 & 0.0582\ [<span style="font-variant:small-caps;">sknn</span>]{}& 0.0186 & 0.0655 & 0.1809 & 0.2450 & 0.0687 & 0.3150 & 0.0619\ [<span style="font-variant:small-caps;">stan</span>]{}& 0.0175 & 0.0585 & 0.1696 & 0.2414 & 0.0871 & & 0.0473\ [<span style="font-variant:small-caps;">vstan</span>]{}& 0.0174 & 0.0609 & 0.1795 & [$*$**0.2597**]{} & 0.0853 & 0.4299 & 0.0505\ [<span style="font-variant:small-caps;">ar</span>]{}& 0.0166 & 0.0564 & 0.1544 & 0.2076 & 0.0710 & 0.4531 & 0.0511\ [<span style="font-variant:small-caps;">sr</span>]{}& 0.0133 & 0.0466 & 0.1366 & 0.2002 & 0.1052 & 0.4661 &\ *[<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}* & & & & 0.2113 & 0.0935 & 0.3265 & 0.0576\ *[<span style="font-variant:small-caps;">narm</span>]{}* & 0.0118 & 0.0463 & 0.1274 & 0.1849 & 0.0894 & 0.4715 & 0.0488\ *[<span style="font-variant:small-caps;">gru4rec</span>]{}* & 0.0116 & 0.0449 & 0.1361 & & & [$*$**0.5795**]{} & [**0.0286**]{}\ *[<span style="font-variant:small-caps;">stamp</span>]{}* & 0.0111 & 0.0456 & 0.1244 & 0.1954 & 0.0921 & 0.2148 & 0.0714\ *[<span style="font-variant:small-caps;">csrm</span>]{}* & 0.0095 & 0.0388 & 0.1065 & 0.1508 & 0.0594 & 0.2445 & 0.0494\ [<span style="font-variant:small-caps;">ct</span>]{}& 0.0065 & 0.0287 & 0.0893 & 0.1679 & [**0.1094**]{} & 0.2714 & 0.2984\ \ & [$*$**0.0309**]{} & [$*$**0.1090**]{} & [$*$**0.2347**]{} & 0.3830 & 0.1162 & 0.3667 & 0.0485\ [<span style="font-variant:small-caps;">vstan</span>]{}& 0.0296 & 0.1003 & 0.2306 & [$*$**0.3904**]{} & 0.1564 & &\ [<span style="font-variant:small-caps;">sknn</span>]{}& 0.0290 & 0.1073 & 0.2217 & 0.3443 & 0.0898 & 0.1913 & 0.0574\ [<span style="font-variant:small-caps;">stan</span>]{}& 0.0278 & 0.0949 & 0.2227 & 0.3830 & 0.1533 & 0.4315 & 0.0347\ [<span style="font-variant:small-caps;">ar</span>]{}& 0.0254 & 0.0886 & 0.1930 & 0.3088 & 0.0960 & 0.3524 & 0.0393\ [<span style="font-variant:small-caps;">sr</span>]{}& 0.0240 & 0.0816 & 0.1937 & 0.3327 & 0.2410 & 0.4131 & 0.0317\ *[<span style="font-variant:small-caps;">narm</span>]{}* & & & 0.1486 & 0.2956 & 0.1945 & 0.3858 & 0.0425\ *[<span style="font-variant:small-caps;">gru4rec</span>]{}* & 0.0150 & 0.0617 & & & & [**0.4881**]{} & [**0.0255**]{}\ *[<span style="font-variant:small-caps;">csrm</span>]{}* & 0.0118 & 0.0536 & 0.1236 & 0.2652 & 0.1503 & 0.2290 & 0.0390\ *[<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}* & 0.0108 & 0.0482 & 0.1151 & 0.2883 & 0.1894 & 0.3965 & 0.0412\ *[<span style="font-variant:small-caps;">stamp</span>]{}* & 0.0093 & 0.0411 & 0.0875 & 0.1539 & 0.0819 & 0.0852 & 0.0491\ [<span style="font-variant:small-caps;">ct</span>]{}& 0.0058 & 0.0308 & 0.0885 & 0.2882 & [$*$**0.2502**]{} & 0.1932 & 0.4255\ \ [<span style="font-variant:small-caps;">sknn</span>]{}& [$*$**0.0037**]{} & [$*$**0.0139**]{} & [$*$**0.0390**]{} & [$*$**0.0417**]{} & 0.0054 & 0.2937 & 0.1467\ & 0.0032 & 0.0116 & 0.0312 & 0.0352 & 0.0057 & 0.5886 & 0.1199\ [<span style="font-variant:small-caps;">stan</span>]{}& 0.0031 & 0.0126 & 0.0357 & 0.0402 & 0.0054 & 0.2979 & 0.1667\ [<span style="font-variant:small-caps;">vstan</span>]{}& 0.0024 & 0.0083 & 0.0231 & 0.0271 & 0.0060 & [$*$**0.6907**]{} & [**0.0566**]{}\ [<span style="font-variant:small-caps;">ar</span>]{}& 0.0018 & 0.0076 & 0.0200 & 0.0233 & 0.0059 & 0.5532 & 0.1049\ [<span style="font-variant:small-caps;">sr</span>]{}& 0.0010 & 0.0047 & 0.0134 & 0.0186 & 0.0074 & 0.5669 & 0.0711\ *[<span style="font-variant:small-caps;">narm</span>]{}* & & & & & & 0.4816 & 0.1119\ [<span style="font-variant:small-caps;">ct</span>]{}& 0.0006 & 0.0043 & 0.0126 & 0.0191 & [$*$**0.0111**]{} & 0.3357 & 0.4680\ *[<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}* & 0.0006 & 0.0032 & 0.0096 & 0.0148 & 0.0082 & 0.4283 & 0.0812\ *[<span style="font-variant:small-caps;">csrm</span>]{}* & 0.0005 & 0.0040 & 0.0109 & 0.0100 & 0.0021 & 0.0056 & 0.6478\ *[<span style="font-variant:small-caps;">nextitnet</span>]{}* & 0.0004 & 0.0024 & 0.0071 & 0.0139 & 0.0065 & 0.4851 & 0.0960\ *[<span style="font-variant:small-caps;">stamp</span>]{}* & 0.0003 & 0.0020 & 0.0063 & 0.0128 & & 0.5168 & 0.0872\ *[<span style="font-variant:small-caps;">gru4rec</span>]{}* & 0.0003 & 0.0020 & 0.0063 & 0.0130 & 0.0074 & &\ \ [<span style="font-variant:small-caps;">sknn</span>]{}& [$*$**0.0024**]{} & & [$*$**0.0343**]{} & [$*$**0.0377**]{} & 0.0054 & 0.2352 & 0.1622\ [<span style="font-variant:small-caps;">stan</span>]{}& 0.0022 & 0.0119 & 0.0313 & 0.0357 & 0.0052 & 0.2971 & 0.1382\ & 0.0021 & 0.0110 & 0.0276 & 0.0312 & 0.0056 & 0.4572 & 0.1064\ [<span style="font-variant:small-caps;">vstan</span>]{}& 0.0018 & 0.0086 & 0.0227 & 0.0265 & 0.0056 & [$*$**0.5192**]{} & 0.0757\ *[<span style="font-variant:small-caps;">narm</span>]{}* & & [**0.0131**]{} & & & [$*$**0.0083**]{} & 0.0788 & 0.1589\ *[<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}* & 0.0017 & 0.0123 & 0.0301 & 0.0330 & 0.0077 & 0.0211 & 0.1833\ [<span style="font-variant:small-caps;">ar</span>]{}& 0.0016 & 0.0088 & 0.0219 & 0.0255 & & 0.4529 & 0.0912\ *[<span style="font-variant:small-caps;">stamp</span>]{}* & 0.0015 & 0.0114 & 0.0256 & 0.0272 & 0.0061 & 0.0405 & 0.1374\ [<span style="font-variant:small-caps;">sr</span>]{}& 0.0012 & 0.0067 & 0.0166 & 0.0201 & & 0.4897 & [$*$**0.0657**]{}\ *[<span style="font-variant:small-caps;">csrm</span>]{}* & 0.0011 & 0.0087 & 0.0189 & 0.0204 & 0.0048 & 0.0417 & 0.1587\ *[<span style="font-variant:small-caps;">gru4rec</span>]{}* & 0.0007 & 0.0060 & 0.0132 & 0.0161 & 0.0051 & &\ [<span style="font-variant:small-caps;">ct</span>]{}& 0.0007 & 0.0054 & 0.0127 & 0.0170 & & 0.2732 & 0.2685\ #### Music Domain In Table \[tab:results-music\] we present the results for the music datasets. In general, the observations are in line with what we observed for the e-commerce domain regarding the competitiveness of the simple methods. - Across all datasets excluding the [8TRACKS]{}dataset, the nearest-neighbors methods are consistently favorable in terms of Precision, Recall, MAP and the Hit Rate, and the [<span style="font-variant:small-caps;">ct</span>]{}method leads to the best MRR. Moreover, the simple [<span style="font-variant:small-caps;">sr</span>]{}technique often leads to very good MRR values. - For [8TRACKS]{}dataset, the best Recall, MAP and the Hit Rate values are again achieved by neighborhood methods. The best Precision and the MRR values are, however, achieved by a neural method ([<span style="font-variant:small-caps;">narm</span>]{}). - Again, no consistent ranking of the algorithms can be found across the datasets. In particular the neural approaches take largely varying positions in the rankings across the datasets. Generally, [<span style="font-variant:small-caps;">narm</span>]{}seems to be a technique which performs consistently well on most datasets and measures. Coverage and Popularity ----------------------- Table \[tab:results-ec\] and Table \[tab:results-music\] also contain information about the popularity bias of the individual algorithms and coverage information. Remember that we described in Section \[subsec:evaluation-procedure\] how the numbers were calculated. From the results, we can identify the following trends regarding individual algorithms and the different algorithm families. #### Popularity Bias. - The [<span style="font-variant:small-caps;">ct</span>]{}method is very different from all other methods in terms of its *popularity bias*, which is much higher than for any other method. - The [<span style="font-variant:small-caps;">gru4rec</span>]{}method, on the other hand, is the method that almost consistently recommends the most unpopular (or: novel) items to the users. - The neighborhood-based methods are often somewhere in the middle. There are, however, also neural methods, in particular [<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}, which seem to have a similar or sometimes even stronger popularity bias than the nearest-neighbors approaches. The assumption that nearest-neighbors methods are in general more focusing on popular items than neural methods can therefore not be confirmed through our experiments. #### Coverage. - In terms of *coverage*, we found that [<span style="font-variant:small-caps;">gru4rec</span>]{}often leads to the highest values. - The coverage of the neighborhood-based methods varies quite a lot, depending on the specific algorithm variant. In some configurations, their coverage is almost as high as for [<span style="font-variant:small-caps;">gru4rec</span>]{}, while in others the coverage can be low. - The coverage values of the other neural methods also do not show a clear ranking, and they are often in the range of the neighborhood-based methods and sometimes even very low. Scalability ----------- We present selected results regarding the running times of the algorithms for two e-commerce datasets and one music dataset in Table \[tab:running-times\]. The reported times were measured for training and predicting for one data split. The numbers reported for predicting correspond to the average time needed to generate a recommendation for a session beginning in the test set. For this measurement, we used a workstation computer with an Intel Core i7-4790k processor and an Nvidia Geforce GTX 1080 Ti graphics card (Cuda 10.1/CuDNN 7.5). [1]{}[@Xrrrrrr@]{} & &\ Algorithm & [RSC15]{}& [ZALANDO]{}& [8TRACKS]{}& [RSC15]{}& [ZALANDO]{}& [8TRACKS]{}\ [<span style="font-variant:small-caps;">gru4rec2</span>]{}& 0.72h & 0.66h & 0.21h & 7.72 & 25.97 & 278.23\ [<span style="font-variant:small-caps;">stamp</span>]{}& 0.54h & 2.22h & 1.87h & 14.94 & 55.45 & 423.94\ [<span style="font-variant:small-caps;">narm</span>]{}& 3.76h & 13.30h & 10.40h & 7.83 & 25.00 & 211.35\ [<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}& 13.79h & 25.45h & 8.04h & 27.67 & 120.15 & 797.97\ [<span style="font-variant:small-caps;">csrm</span>]{}& 2.61h & 3.39h & 1.61h & 24.98 & 66.93 & 250.23\ [<span style="font-variant:small-caps;">nextitnet</span>]{}& 26.29h & – & – & 8.98 & – & –\ [<span style="font-variant:small-caps;">ar</span>]{}& 23.70s & 60.04s & 20.41s & 4.66 & 12.00 & 105.43\ [<span style="font-variant:small-caps;">sr</span>]{}& 24.74s & 31.82s & 15.14s & 4.66 & 11.77 & 101.98\ [<span style="font-variant:small-caps;">sknn</span>]{}& 10.81s & 7.52s & 3.29s & 37.82 & 27.77 & 291.26\ [<span style="font-variant:small-caps;">v-sknn</span>]{}& 11.24s & 8.03s & 3.26s & 18.75 & 30.56 & 278.51\ [<span style="font-variant:small-caps;">stan</span>]{}& 10.57s & 11.76s & 3.16s & 36.78 & 33.26 & 317.23\ [<span style="font-variant:small-caps;">vstan</span>]{}& 10.80s & 7.75s & 3.46s & 21.33 & 55.58 & 288.40\ [<span style="font-variant:small-caps;">ct</span>]{}& 0.18h & 0.26h & 0.07h & 73.34 & 484.87 & 1452.71\ The results generally show that the computational complexity of neural methods is, as expected, much higher than for the non-neural approaches. In some cases, researchers therefore only use a smaller fraction of the original datasets, e.g., or of the [RSC15]{}dataset. Several algorithms—both neural ones and the [<span style="font-variant:small-caps;">ct</span>]{}method—exhibit major scalability issues when the number of recommendable items increases. For the [<span style="font-variant:small-caps;">nextitnet</span>]{}method, for example, training on the [ZALANDO]{}dataset with its almost 190k items and its particularly long sessions did not complete within a reasonable time frame in our experiments. In some cases, like for [<span style="font-variant:small-caps;">ct</span>]{}or [<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}, not only the training time increases, but also the prediction times. In particular the prediction times can, however, be subject to strict time constraints in production settings. The prediction times for the nearest-neighbors methods are often slightly higher than those measured for methods like [<span style="font-variant:small-caps;">gru4rec</span>]{}, but usually lie within the time constraints of real-time recommendation (e.g., requiring about 30ms for one prediction for the [ZALANDO]{}dataset). Since datasets in real-world environments can be even larger, this leaves us with questions regarding the practicability of some of the approaches. In general, even in case where a complex neural method would slightly outperform one of the more simple ones in an offline evaluation, it remains open if it is worth the effort to put such complex methods into production. For the [ZALANDO]{}dataset, for example, the best neural method ([<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}) needs several orders of magnitude[^7] more time to train than the best non-neural method [<span style="font-variant:small-caps;">vstan</span>]{}, which also only needs half the time for recommending. Stability With Respect to New Data ---------------------------------- We report the stability results for the examined neural and non-neural algorithms on two datasets in Table \[tab:stability\_completed\]. We used two months of training data and 10 days of test data for both datasets, [DIGI]{}and [NOWP]{}. The reported values show how much the accuracy results of each algorithm degrades (in percent), averaged across the test days when there is no daily retraining. [1]{}[@Xrrrr@]{} & &\ Metrics & HR@20 & MRR@20 & HR@20 & MRR@20\ [<span style="font-variant:small-caps;">sknn</span>]{}& & & & **-14.29%**\ [<span style="font-variant:small-caps;">v-sknn</span>]{}& -2.28% & -0.64% & -27.20% & -14.36%\ [<span style="font-variant:small-caps;">vstan</span>]{}& -2.53% & -0.64% & -28.53% & -28.22%\ [<span style="font-variant:small-caps;">stan</span>]{}& -2.97% & -0.29% & -27.21% & -27.92%\ [<span style="font-variant:small-caps;">ar</span>]{}& -4.83% & -5.33% & -29.76% & -33.94%\ [<span style="font-variant:small-caps;">sr</span>]{}& -6.22% & -6.14% & -32.38% & -70.05%\ [<span style="font-variant:small-caps;">ct</span>]{}& -7.98% & -6.94% & -50.49% & -85.97%\ [<span style="font-variant:small-caps;">narm</span>]{}& **-1.84%** & **0.30%** & -35.10% & -70.28%\ [<span style="font-variant:small-caps;">gru4rec</span>]{}& -2.79% & -1.84% & -46.03% & -74.11%\ [<span style="font-variant:small-caps;">nextitnet</span>]{}& -3.75% & -4.69% & - & -\ [<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}& -3.76% & -2.14% & -46.05% & -75.74%\ [<span style="font-variant:small-caps;">csrm</span>]{}& -4.20% & -4.68% & **-17.84%** &\ [<span style="font-variant:small-caps;">stamp</span>]{}& -7.80% & -7.28% & -46.48% & -45.78%\ We can see from the results that the drop in accuracy without retraining can vary a lot across datasets (domains). For the [DIGI]{}dataset, the decrease in performance ranges between 0 and 10 percent across the different algorithms and performance measures. The [NOWP]{}dataset from the music domain seems to be more short-lived, with more recent trends that have to be considered. Here, the decrease in performance ranges from about 15 to 50 percent in terms of HR and from about 15 to 85 percent in terms of MRR.[^8] Looking at the detailed results, we see that in both families of algorithms, i.e., neural and non-neural ones, some algorithms are much more stable than others when new data are added to a given dataset. For the family of non-neural approaches, we see that nearest-neighbor approaches are generally better than the other baselines techniques based on association rules or context trees. Among the neural methods, [<span style="font-variant:small-caps;">narm</span>]{}is the most stable one on the [DIGI]{}dataset, but often falls behind the other deep learning methods on the [NOWP]{}dataset.[^9] On this latter dataset, the [<span style="font-variant:small-caps;">csrm</span>]{}method leads to the most stable results. In general, however, no clear pattern across the datasets can be found regarding the performance of the neural methods when new data comes in and no retraining is done. Overall, given that the computational costs of training complex models can be high, it can be advisable to look at the stability of algorithms with respect to new data when choosing a method for production. According to our analysis, there can be strong differences across the algorithms. Furthermore, the nearest-neighbors methods appear to be quite stable in this comparison. Observations From a User Study {#sec:user-study} ============================== Offline evaluations, while predominant in the literature, can have certain limitations, in particular when it comes to the question how the quality of the provided recommendations is *perceived* by users. We therefore conducted a controlled experiment, in which we compared different algorithmic approaches for session-based recommendation in the context of an online radio station. In the following sections, we report the main insights of this experiment. While the study did not include all algorithms from our offline analysis, we consider it helpful to obtain a more comprehensive picture regarding performance of session-based recommenders. More details about the study cam be found in [@ludewigjannach2019radio]. Research Questions and Study Setup ---------------------------------- #### Research Questions. Our offline analysis indicated that simple methods are often competitive than the more complex ones. Our main research question therefore was how the recommendations generated by such simple methods are perceived by its users in different dimensions, in particular compared to recommendations by a complex method. Furthermore, we were interested how users perceive the recommendations of a commercial music streaming service, in our case <span style="font-variant:small-caps;">Spotify</span>, in the same situation. #### Study Setup. An online music listening application in the form of an “automated radio station” was developed for the purpose of the study. Similar to existing commercial services, users of the application could select a track they like (called a “seed track”), based on which the application creates a playlist of subsequent tracks that are played automatically. While the music was played, the users could listen it to the end before moving to the next track, skip the track if they did not like the it, or press a “like” button. In case of a *like* action, the list of upcoming tracks was updated. Users were visually hinted that such an update takes place. Besides recording skips and like actions, additional feedback was collected from the study participants. Before going to the next track, they had to answer for each listened track (i) if they already knew the track, (ii) to what extent the track matched the previously played track, and (iii) to what extent they liked the track (independent of the playlist), see Figure \[fig:radio2\]. ![Track Rating Interface of the Application[]{data-label="fig:radio2"}](radio2.pdf){width="88.00000%"} Once the participants had listened to and rated at least 15 tracks, they were forwarded to a post-task questionnaire. In this questionnaire, we asked the participants 11 questions about how they perceived the service, see also [@Pu:2011:UEF:2043932.2043962]. Specifically, the participants were asked to provide answers to the questions using seven-point Likert scale items, ranging from “completely disagree” to “completely agree”. The questions, which include a twelfth question as an attention check, are listed in Table \[tab:quality-questions\]. \[h!t\] [1]{}[@lX@]{}\ Q1 & I liked the automatically generated radio station.\ Q2 & The radio suited my general taste in music.\ Q3 & The tracks on the radio musically matched the track I selected in the beginning.\ Q4 & The radio was tailored to my preferences the more positive feedback I gave.\ Q5 & The radio was diversified in a good way.\ Q6 & The tracks on the radio surprised me.\ Q7 & I discovered some unknown tracks that I liked in the process.\ Q8 & I am participating in this study with care so I change this slider to two.\ Q9 & I would listen to the same radio station based on that track again.\ Q10 & I would use this system again, e.g., with a different first song.\ Q11 & I would recommend this radio station to a friend.\ Q12 & I would recommend this system to a friend.\ The study itself was based on a between-subjects design, where the treatments for each user group correspond to different algorithmic approaches to generate the recommendations. We included algorithms from different families in our study. - [<span style="font-variant:small-caps;">ar</span>]{}: Association rules of length two, as described in Section \[sec:algorithms\]. We included this method as a simple baseline. - [<span style="font-variant:small-caps;">cagh</span>]{}: Another relatively simple baseline, which recommends the greatest hits of artists similar to those liked in the current session. This music-specific method is often competitive in offline evaluations as well, see [@Bonnin:2014:AGM:2658850.2652481]. - [<span style="font-variant:small-caps;">sknn</span>]{}: The basic nearest-neighbors method described above. We took the simple variant as a representative for the family of such approaches, as it performed particularly well in the ACM RecSys 2018 challenge [@Ludewig2018rsc]. - [<span style="font-variant:small-caps;">gru4rec</span>]{}: The RNN-based approach discussed above, used as a representative for neural methods. [<span style="font-variant:small-caps;">narm</span>]{}would have been a stable alternative, but did not scale well for the used dataset. - [<span style="font-variant:small-caps;">spotify</span>]{}: Recommendations in this treatment group were retrieved in real time from Spotify’s API. We optimized and trained all models on the Million Playlist Dataset Million Playlist Dataset (MPD) [^10] provided by Spotify. We then recruited study participants using Amazon’s Mechanical Turk crowdsourcing platform. After excluding participants who did not pass the attention checks, we ended up with *N=250* participants, i.e., 50 for each treatment group, for which we were confident that they provided reliable feedback. Most of the recruited participants (almost 80%) were US-based. The most typical age range was between 25 and 34, with more than 50% of the participants falling into this category. On average, the participants considered themselves to be music enthusiasts, with an average response of 5.75 (on the seven-point scale) to a corresponding survey question. As usual, the participants received a compensation for their efforts through the crowdsourcing platform. User Study Outcomes ------------------- The main observations can be summarized as follows. #### Feedback the Listening Experience. Looking at the feedback that was observed during the listening session, we observed the following. - *Number of Likes.* There were significant differences regarding the number of *likes* we observed across the treatment groups. Recommendations by the simple [<span style="font-variant:small-caps;">ar</span>]{}method received the highest number of likes (6.48), followed by [<span style="font-variant:small-caps;">sknn</span>]{}(5.63), [<span style="font-variant:small-caps;">cagh</span>]{}(5.38), [<span style="font-variant:small-caps;">gru4rec</span>]{}(5.36) and [<span style="font-variant:small-caps;">spotify</span>]{}(4.48). - *Popularity of Tracks.* We found a clear correlation (*r*=0.89) between the general popularity of a track in the MPD dataset and the number of likes in the study. The [<span style="font-variant:small-caps;">ar</span>]{}and [<span style="font-variant:small-caps;">cagh</span>]{}methods recommended, on average, the most popular tracks. The recommendations by [<span style="font-variant:small-caps;">spotify</span>]{}and [<span style="font-variant:small-caps;">gru4rec</span>]{}were more oriented towards tracks with lower popularity. - *Track Familiarity.* There were also clear differences in terms of how many of the recommended tracks were already known by the users. The [<span style="font-variant:small-caps;">cagh</span>]{}(10.83%) and [<span style="font-variant:small-caps;">sknn</span>]{}(10.13%) methods recommended the largest number of known tracks. The [<span style="font-variant:small-caps;">ar</span>]{}method, even though it recommended very popular tracks, led to much more unfamiliar recommendations (8.61%). [<span style="font-variant:small-caps;">gru4rec</span>]{}was somewhere in the middle (9.30%), and [<span style="font-variant:small-caps;">spotify</span>]{}recommended the most novel tracks to users (7.00%). - *Suitability of Track Continuations.* The continuations created by [<span style="font-variant:small-caps;">sknn</span>]{}and [<span style="font-variant:small-caps;">cagh</span>]{}were perceived to be the most suitable ones. The differences between [<span style="font-variant:small-caps;">sknn</span>]{}and [<span style="font-variant:small-caps;">ar</span>]{}, [<span style="font-variant:small-caps;">gru4rec</span>]{}, and [<span style="font-variant:small-caps;">spotify</span>]{}were significant. The recommendations made by the [<span style="font-variant:small-caps;">ar</span>]{}method were considered to match the playlist the least. This is not too surprising because the [<span style="font-variant:small-caps;">ar</span>]{}method only considers the very last played track for the recommendation of subsequent tracks. - *Individual Track Ratings.* The differences regarding the individual ratings for each track ratings are generally small and not significant. Interestingly, the playlist-independent ratings for tracks recommended by the [<span style="font-variant:small-caps;">ar</span>]{}method were the lowest ones, even though these recommendations received the highest number of likes. An analysis of the rating distribution shows that the [<span style="font-variant:small-caps;">ar</span>]{}method often produces very bad recommendations, with a *mode* value of 1 on the 1-7 rating scale. #### Post-Task Questionnaire The post-task questionnaire revealed the following aspects: - Q1: The radio station based on [<span style="font-variant:small-caps;">sknn</span>]{}was significantly more liked than the stations that used [<span style="font-variant:small-caps;">gru4rec</span>]{}, [<span style="font-variant:small-caps;">ar</span>]{}, and [<span style="font-variant:small-caps;">spotify</span>]{}. - Q2: All radio stations matched the users general taste quite well, with median values between 5 and 6 on a seven-point scale. Only the station based on the [<span style="font-variant:small-caps;">ar</span>]{}method received a significantly lower rating than the others. - Q3: The [<span style="font-variant:small-caps;">sknn</span>]{}method was found to perform significantly better than [<span style="font-variant:small-caps;">ar</span>]{}and [<span style="font-variant:small-caps;">gru4rec</span>]{}with respect to identifying tracks that musically match the seed track. - Q4: The adaptation of the playlist based on the like statements was considered good for all radio stations. Again, the feedback for the [<span style="font-variant:small-caps;">ar</span>]{}method was significantly lower than for the other methods. - Q5 and Q6: No significant differences were found regarding the surprise level of the different recommendation strategies. - Q7: Regarding the capability of recommending unknown tracks that the users liked, the recommendations by [<span style="font-variant:small-caps;">spotify</span>]{}were perceived to be much better than for the other methods, with significant differences compared to all other methods. - Q9 to Q12: The best performing methods in terms of the intention to reuse and the intention to recommend the radio station to others were [<span style="font-variant:small-caps;">sknn</span>]{}, [<span style="font-variant:small-caps;">cagh</span>]{}, and [<span style="font-variant:small-caps;">spotify</span>]{}. [<span style="font-variant:small-caps;">gru4rec</span>]{}and [<span style="font-variant:small-caps;">ar</span>]{}were slightly worse, sometimes with differences that were statistically significant. Overall, the study confirmed that methods like [<span style="font-variant:small-caps;">sknn</span>]{}do not only perform well in an offline evaluation, but are also able, according to our study, to generate recommendations that are well perceived in different dimensions by the users. The study also revealed a number of additional insights. First, we found that optimizing for *like* statements can be misleading. The [<span style="font-variant:small-caps;">ar</span>]{}method received the highest number of likes, but was consistently worse than other techniques in almost all other dimensions. Apparently, this was caused by the fact that the [<span style="font-variant:small-caps;">ar</span>]{}method made a number of bad recommendations; see also [@CHAU2013180] for an analysis of the effects on bad recommendations in the music domain. Second, it turned out that *discovery support* seems to be an important factor in this particular application domain. While the recommendations of [<span style="font-variant:small-caps;">spotify</span>]{}were slightly less appreciated than those by [<span style="font-variant:small-caps;">sknn</span>]{}, we found no difference in terms of the user’s intention to reuse the system or to recommend it to friends. We hypothesize that the better discovery support of [<span style="font-variant:small-caps;">spotify</span>]{}’s recommendations was an important factor for this phenomenon. This observation points to the importance of considering multiple potential quality factors when comparing systems. Conclusions and Ways Forward {#sec:discussion} ============================ Our work reveals that despite a continuous stream of papers that propose new neural approaches for session-based recommendation, the progress in the field seems still limited. According to our evaluations, today’s deep learning techniques are in many cases not outperforming much simpler heuristic methods. Overall, this indicates that there still is a huge potential for more effective neural recommendation methods in the future in this area. In particular, methods that leverage deep learning techniques to incorporate side information represent a promising way forward, see [@moreira2019contextual; @deSouzaPereiraMoreira2018; @Huang2018; @Hidasi:2016:PRN:2959100.2959167]. In a related analysis of deep learning techniques for recommender systems [@Ferraridacremaetal2019], the authors found that different factors contribute to what they call *phantom progress*. One first problem is related to the reproducibility of the reported results. They found that in less than a third of the investigated papers, the code was made available to other researchers. The problem also exists to some extent for session-based recommendation approaches. To further increase the level of reproducibility, we share our evaluation framework publicly, so that other researchers can easily benchmark their own methods with a comprehensive set of neural and non-neural approaches on different datasets. Through sharing our evaluation framework, we hope to also address other methodological and procedural issues mentioned in [@Ferraridacremaetal2019] that can make the comparison of algorithms unreliable or inconclusive. Regarding methodological issues, we for example found works that determined the optimal number of training epochs on the test set and furthermore determined the best Hit Rate and MRR values across different optimization epochs. Regarding procedural issues, we found that while researchers seemingly rely on the same datasets as previous works, they sometimes apply different data pre-processing strategies. Furthermore, the choice of the baselines can make the results inconclusive. Most investigated works do not consider the [<span style="font-variant:small-caps;">sknn</span>]{}method and its variants as a baseline. Some works only compare variants of one method and include a non-neural, but not necessarily strong other baseline. In many cases, little is also said about the optimization of the hyper-parameters of the baselines. The <span style="font-variant:small-caps;"></span> framework used in our evaluation should help to avoid these problems, as it contains all the code for data pre-processing, evaluation, and hyper-parameter optimization. Finally, our analyses indicated that optimizing solely for accuracy can be insufficient also for session-based recommendation scenarios. Depending on the application domain, other quality factors such as coverage, diversity, or novelty should be considered, because they can be crucial for the adoption and success of the recommendation service. Given the insights from our controlled experiment, we furthermore argue that more user studies and field tests are necessary to understand the characteristics of successful recommendations in a given application domain. Acknowledgement {#acknowledgement .unnumbered} =============== We thank Liliana Ardissono for her valuable feedback on the paper. [^1]: This work combines and significantly extends our own previous work published in [@ludewigjannach2019radio] and [@LudewigMauro2019]. This paper or a similar version is not currently under review by a journal or conference. This paper is void of plagiarism or self-plagiarism as defined by the Committee on Publication Ethics and Springer Guidelines. We plan to publish a pre-print version of this work, compliant to the rules of the journal. [^2]: Compared to our preliminary work presented in [@LudewigMauro2019], our present analysis includes considerably more recent deep learning techniques and baseline approaches. We also provide the outcomes of additional measurements regarding the scalability and stability of different algorithms. Finally, we also contrast the outcomes of the offline experiments with the findings obtained in a user study [@ludewigjannach2019radio]. [^3]: <https://github.com/rn5l/session-rec> [^4]: The number of days used for testing ($n$) was determined based on the characteristics of the dataset. We, for example, used the last day for the [RSC15]{}dataset, two for [RETAIL]{}, five for the music datasets, and seven for [DIGI]{}to ensure that train-test splits are comparable. [^5]: <https://rn5l.github.io/session-rec/umuai> [^6]: We also optimized the hyper-parameters on a subset of $T_0$ that was used as a validation set. The hyper-parameters were kept constant for the remaining measurements. [^7]: The training time for [<span style="font-variant:small-caps;">sr</span><span style="font-variant:small-caps;">gnn</span>]{}is 10.000 times higher than for [<span style="font-variant:small-caps;">vstan</span>]{}. [^8]: Generally, comparing the numbers across the datasets is not meaningful due to their different characteristics. [^9]: The experiments for [<span style="font-variant:small-caps;">nextitnet</span>]{}could not be completed on this dataset because the method’s resource requirements exceeded our computing capacities. [^10]: <https://recsys-challenge.spotify.com/>

Students Are Better Off Without a Laptop in the Classroom - thearn4 https://www.scientificamerican.com/article/students-are-better-off-without-a-laptop-in-the-classroom/ ====== zeta0134 Oh, okay, I thought the study was going to be on the benefits of attempting to use the laptop itself for classroom purposes, not for social media distractions. This would be more accurately titled, "Students Are Better Off Without Distractions in the Classroom." Though I suppose, it wouldn't make a very catchy headline. I found my laptop to be very beneficial in my classroom learning during college, but only when I made it so. My secret was to avoid even connecting to the internet. I opened up a word processor, focused my eyes on the professor's slides or visual aids, and typed everything I saw, adding notes and annotations based on the professor's lecture. This had the opposite effect of what this article describes: my focusing my distracted efforts on formatting the article and making my notes more coherent, I kept myself focused, and could much more easily engage with the class. Something about the menial task of taking the notes (which I found I rarely needed to review) prevented me from losing focus and wandering off to perform some unrelated activity. I realize my experience is anecdotal, but then again, isn't everyone's? I think each student should evaluate their own style of learning, and decide how to best use the tools available to them. If the laptop is a distraction? Remove it! Goodness though, you're paying several hundred (/thousand) dollars per credit hour, best try to do everything you can to make that investment pay off. ~~~ DINKDINK >I opened up a word processor, focused my eyes on the professor's slides or visual aids, and typed everything I saw There are studies that show that verbatim computer note taking is actually inferior to remembering the lecture content: A Learning Secret: Don’t Take Notes with a Laptop [https://www.scientificamerican.com/article/a-learning- secret...](https://www.scientificamerican.com/article/a-learning-secret-don-t- take-notes-with-a-laptop/) ~~~ ericcumbee Maybe they aren't as effective as hand written notes. but in my case Neatly typed, well organized notes using OneNote 2003 were more effective than hastily hand written mostly illegible notes. ~~~ nambit The reason hand written notes are more effective is that it helps towards better learning just by writing the thing down and slowing it to a pace where your mind can make memories. Even if afterwards the notes are completely illegible, I would argue it's more effective than typed notes. ~~~ preben Slowing down to a pace comfortable for you means, at least in my classes, that you'll miss the next thing in the presentation. Notes are not for immediate learning, they're for assisting in learning later on. As an physics engineering student, I take notes with a combination of LaTeX and OneNote on my Surface 3. Additional benefits by using a laptop to take notes is that they are searchable, archived and accessible for however long you like, and sharable between classmates. Hand written notes can obviously be shared and archived as well, but nowhere near as easily. ~~~ js8 > I take notes with a combination of LaTeX and OneNote on my Surface 3 I wonder how you do that - I can't imagine I would be able to make notes in LaTeX in real-time. To me, paper is just faster than any computer solution. Also sometimes you need to draw a diagram or arrow in the notes. > Slowing down to a pace comfortable for you means, at least in my classes, > that you'll miss the next thing in the presentation. I was thinking about this recently. I teach (assembly programming) in our company using slideshow. But most teachers at my university used blackboard (for math). I am beginning to think that using blackboard is better, despite more effort, because it also forces the teacher to slow down. ~~~ thedudemabry One of my favorite electrical engineering professors gave incredibly well- planned lectures via overhead transparencies. He was quick to adjust the pace of an individual lecture to the audience, but also provided his presentations as PDF downloads. His presentations were supplemental to the textbooks, but served as amazing base notes. In his classes, I found myself writing prompts for further review and stray observations, rather than attempting to summarize as the lecture progressed. Having worked on online learning applications since then, I still think that his was the best system for transferring complex knowledge in a classroom setting. An example PDF that I found through a quick Google search: [http://www.ittc.ku.edu/~jstiles/312/handouts/312_Introductio...](http://www.ittc.ku.edu/~jstiles/312/handouts/312_Introduction_present.pdf) ------ makecheck If students aren’t engaged, they aren’t going to become star pupils once you take away their distractions. Perhaps kids attend more lectures than before _knowing_ that they can always listen in while futzing with other things (and otherwise, they may skip some of the classes entirely). The lecture _format_ is what needs changing. You need a _reason_ to go to class, and there was nothing worse than a professor showing slides from the pages of his own book (say) or droning through anything that could be Googled and read in less time. If there isn’t some live demonstration, or lecture-only material, regular quizzes or other hook, you can’t expect students to fully engage. ~~~ tjr Most interesting, engaging class I have ever had was Philip Greenspun's short database class at MIT. All day for three days, a cycle of ~15 minute lecture, ~15 minute problem sets worked by each student on their own laptop, ~15 minutes of reviewing student solutions (and, if needed, presenting the "correct" solution). I imagine that many classes could be presented in a similar format. I also imagine it would be a lot of work on the part of the educators to do this. ~~~ rz2k That sounds like an excellent format. What were the hours? I can imagine that taking a lot of planning and refinement over multiple offerings to get the timing just right on the exercises. ~~~ tjr It was scheduled for 10-5 three days in a row, with a break for lunch, and a short break in the morning and afternoon. One of the days included a ~1-hour guest lecture from Michael Stonebraker, which did not fit into the lecture/problem set/review format. The last day fizzled out from the format a bit early, concluding with some random discussions. Web page for the course here: [http://philip.greenspun.com/teaching/three-day- rdbms/](http://philip.greenspun.com/teaching/three-day-rdbms/) ------ ourmandave This reminds me of the running gag in some college movie where the first day all the students show up. The next cut some students come to class, put a recorder on their desk and leave, then pick it up later. Eventually there's a scene of the professor lecturing to a bunch of empty desks with just recorders. And the final scene there's the professor's tape player playing to the student's recorders. ~~~ pmiller2 FYI, this gag appears exactly as described in _Real Genius_. I wonder if there are any other movies that use it? ~~~ kfriede Video link: [https://www.youtube.com/watch?v=Gt4vXaoPzF8](https://www.youtube.com/watch?v=Gt4vXaoPzF8) ------ stevemk14ebr I think this is a highly personal topic. As a student myself i find a laptop in class is very nice, i can type my notes faster, and organize them better. Most of my professors lectures are scatter brained and i frequently have to go back to previous section and annotate or insert new sections. With a computer i just go back and type, with a pen and paper i have to scribble, or write in the margins. Of course computers can be distractions, but that is the students responsibility, let natural selection take its course and stop hindering my ability to learn how i do best (I am a CS major so computers are >= paper to me). If you cannot do your work with a computer, then don't bring one yourself, dont ban them for everyone. ~~~ compuguy Some of us also have terrible handwriting, so taking notes by hand is out of the question. Though I will also surmise that they can also be a distraction. ~~~ izacus Why is improving your handwriting out of the question? ~~~ deadhead Its not an option for everyone. I had a classmate in undergrad who had a medical condition where they could not take notes by hand. They even had a doctor's note saying that they had to have a laptop in class. ~~~ scottLobster Not physically able to use hands != perfectly able to use hands but was failed by their elementary school system and now rationalizes that learning to write legibly is somehow a waste of time ;) Not to be too personal, 99% of college students (including myself back in the day) are lazy rationalizers in some fashion. In my experience it's not until Junior/Senior year that some majors start squeezing that out. ~~~ ghaff On the other hand, I had some number of years of handwriting class in grade school (Palmer script) and handwriting was consistently my lowest grade as I recall. It's never been good in spite of considerable practice--and it's slowly deteriorated to almost illegible today. ------ imgabe I went to college just as laptops were starting to become ubiquitous, but I never saw the point of them in class. I still think they're pretty useless for math, engineering, and science classes where you need to draw symbols and diagrams that you can't easily type. Even for topics where you _can_ write prose notes, I always found it more helpful to be able to arrange them spatially in a way that made sense rather than the limited order of a text editor or word processor. ~~~ e12e I think devices like the surface pro have shown that we have the technology needed for more advanced io now - we just need proper CAD programs and symbolic math packages that work well with pen/touch input - much along the lines of original Sketchpad[s]. In the same vein, I think "notebooks" of the Jupyter style for R, mathlab or Julia etc - could be a great addition to many classes - allowing interactive exploration etc. It's an odd time to think computers won't be transformative to learning (also in the classroom) - because we just got useful hardware in affordable packaging. True, the past decades, computers could probably help better with writing projects - but I know of few places that for example simply let students cooperate on writing up projects with their own wikimedia instance - rather than using crappy dtp/word processors. On the other hand, I don't think I knew anyone that got top marks on essays in high school who worked only by hand - it's a slow process to work through two- three drafts of a multi-page essay by hand. [s] [https://en.wikipedia.org/wiki/Sketchpad](https://en.wikipedia.org/wiki/Sketchpad) ~~~ panda88888 TBH Surface Pro, iPad Pro et al compared to paper is like NTSC vs 4K. The resolution and precision on digital writing surfaces are abysmal compared to paper. I tried taking notes on Surface Pro with OneNote and gave up because it feels like writing with crayons. ------ njarboe This is a summary of an article titled "Logged In and Zoned Out: How Laptop Internet Use Relates to Classroom Learning" published in Psychological Science in 2017; The DOI is 10.1177/0956797616677314 if you want to check out the details. Abstract: Laptop computers are widely prevalent in university classrooms. Although laptops are a valuable tool, they offer access to a distracting temptation: the Internet. In the study reported here, we assessed the relationship between classroom performance and actual Internet usage for academic and nonacademic purposes. Students who were enrolled in an introductory psychology course logged into a proxy server that monitored their online activity during class. Past research relied on self-report, but the current methodology objectively measured time, frequency, and browsing history of participants’ Internet usage. In addition, we assessed whether intelligence, motivation, and interest in course material could account for the relationship between Internet use and performance. Our results showed that nonacademic Internet use was common among students who brought laptops to class and was inversely related to class performance. This relationship was upheld after we accounted for motivation, interest, and intelligence. Class- related Internet use was not associated with a benefit to classroom performance. ~~~ throwawayjava _> ...Students who were enrolled in an introductory psychology course..._ Ugh. Also, from the paper: _> Five hundred seven students enrolled in an introductory psychology class in fall 2014... Each lecture lasted 1 hr and 50 min with a 10-min break in the middle._ Alternative headline: "500 person intro courses with meat-space lecture periods lasting TWO HOURS are stupid, and everything else is water under the bridge" edit2: Also from the paper: _> Participants who logged in for less than half of the sessions were excluded from analysis_ Why?! You don't think that frequency of use could correlate _at all_ with type of use?! It's like they're _willfully_ introducing unnecessary threats to validity... And it keeps going like that for the entire paper. I smell experiment design hacking. ~~~ quantum_magpie >And it keeps going like that for the entire paper. I smell experiment design hacking. This sort of thing is exactly what pops up in my mind as well. I think they just looked at complete set of data, which might have shown that there is low- to-moderate correlation (assuming most people only use laptops when there is a part of course that is completely irrelevant/boring/already known); once they dropped the most significant use-case, all was left is the butt-in-seat users. Also, I don't know why they never produce figures of a scatter plot for the data they are analyzing. A simple grade _vs_ laptop time (academic, non- academic, total) figure would explain the results so much better than the raw tables. Maybe I'm just used to other kind of articles though. P.S. There is also a really funny correlation in table 3, showing negative grade influence from playing games, where table 1 has 0 minutes spent for that across the board. ------ shahbaby "Thus, there seems to be little upside to laptop use in class, while there is clearly a downside." Thanks to bs articles like this that try to over generalize their results, I was unsure if I "needed" a laptop when returning to school. Got a Surface Book and here's what I've experienced over the last 2 semesters. \- Going paperless, I'm more organized than ever. I just need to make sure I bring my surface with me wherever I go and I'm good. \- Record lectures, tutorials, office hours, etc. Although I still take notes to keep myself focused, I can go back and review things with 100% accuracy thanks to this. \- Being at 2 places at once. ie: Make last minute changes before submitting an assignment for class A or attend review lecture to prepare for next week's quiz in class B? I can leave the surface in class B to record the lecture while I finish up the assignment for class A. If you can't control yourself from browsing the internet during a lecture then the problem is not with your laptop... ~~~ exodust That's a sensible and practical use of laptop that I wish I had back when I was at Uni (nobody had a laptop in the 90s). I wonder how many students today make efficient use of their computers like this? I guess it's a mix of good and bad. It occurs to me that educating younger students about "how to use a computer" for organising and the like, would be essential in early education before bad habits set in. ------ baron816 Why are lectures still being conducted in the classroom? Students shouldn't just be sitting there copying what the teacher writes on the board anyway. They should be having discussions, working together or independently on practice problems, teaching each other the material, or just doing anything that's actually engaging. Lecturing should be done at home via YouTube. ------ zengid Please excuse me for relating an experience, but it's relevant. To get into my IT grad program I had to take a few undergrad courses (my degree is in music, and I didn't have all of the pre-reqs). One course was Intro to Computer Science, which unfortunately had to be taught in the computer lab used for the programming courses. It was sad to see how undisciplined the students were. Barely anyone paid attention to the lectures as they googled the most random shit (one kid spent a whole lecture searching through images of vegetables). The final exam was open-book. I feel a little guilty, but I enjoyed seeing most of the students nervously flip through the chapters the whole time, while it took me 25 minutes to finish (the questions were nearly identical to those from previous exams). ------ rdtsc I had a laptop and left it home most of the time. And just stuck with taking notes with a pen and sitting upfront. I took lots notes. Some people claim it's pointless and distracts from learning but for me the act of taking notes is what helped solidify the concepts a better. Heck due to my horrible handwriting I couldn't even read some of the notes later. But it was still worth it. Typing them out just wasn't the same. ~~~ LyndsySimon As I get older, I find that physical notes help me more and more. I write in fairly neat cursive, using a fountain pen, and make it a point to never write down the words I'm hearing unless they're an important quote or something. Doing this helps me process the information while it's still fresh in my mind, which in turn leads to more thorough understanding. ~~~ rdtsc > make it a point to never write down the words I'm hearing unless they're an > important quote or something That's the key I think! The forced paraphrasing (while summarizing) helps process the information better. ------ alkonaut This is the same as laptops not being allowed in meetings. A company where it's common for meeting participants to "take notes" on a laptop is dysfunctional. Laptops need to be banned in meetings (and smartphones in meetings and lectures). Also re: other comments: A video lecture is to a physical lecture what a conference call is to a proper meeting. A professor rambling for 3h is still miles better than watching the same thing on YouTube. The same holds for tv versus watching a film on a movie screen. Zero distractions and complete immersion. Maybe VR will allow it some day. ------ brightball Shocker. I remember being part of Clemson's laptop pilot program in 1998. If you were ever presenting you basically had to ask everyone to close their laptops or their eyes would never even look up. ~~~ cmiles74 I see this a lot in the workplace as well. ~~~ xexers Even without laptops I see this in the workplace. In a meeting, if there is a PowerPoint presentation with words on it, people instinctively look at the bright and shiny screen. That's why I recommend throwing a few black slides in your presentation when you want people to focus back on the presenter. ~~~ roel_v Presentation remotes like those from Logitech have a button to do just that. ------ tsumnia I think its a double edge sword; not just paper > laptop or laptop > paper. As many people have already stated, its about engagement. Since coming back for my PhD, I've subscribed to the pencil/paper approach as a simple show of respect to the instructor. Despite what we think, professors are human and flawed, and being in their shoes, it can be disheartening to not be able to feed off your audience. That being said, you can't control them; however, I like to look at different performance styles. What makes someone binge watch Netflix episodes but want to nod off during a lecture. Sure, one has less cognitive load, but replace Netflix binge with anything. People are willing to engage, as long as the medium is engaging (this doesn't mean easy or funny, simply engaging). [Purely anecdotal opinion based discussion] This is one of the reasons I think flipping the classroom does work; they can't tune out. But, if its purely them doing work, what's your purpose there? To babysit? There needs to be a happy median between work and lecture. I like to look at the class time in an episodic structure. Pick a show and you'll notice there's a pattern to how the shows work. By maintaining a consistency in the classroom, the students know what to expect. To tie it back to the article, the laptop is a great tool to use when you need them to do something on the computer. However, they should be looking at you, and you should be drawing their attention. Otherwise, you're just reading your PowerPoint slides. ~~~ quantum_magpie >That being said, you can't control them; however, I like to look at different performance styles. What makes someone binge watch Netflix episodes but want to nod off during a lecture. Sure, one has less cognitive load, but replace Netflix binge with anything. I personally find that if the air quality is not perfect for my needs, I tend to go drowsy really fast. Since I hate the artificially dry air, in any setting where there is either excessive heating in the winter, strong AC in the summer or too many people in a classroom where you get excessive CO2 concentrations, the attention span plummets. A 15 min break every hour helps, where you can get outside for at least 5 minutes and get some fresh air. Also, rooms that have windows that actually open are a lifesaver. ~~~ tsumnia Not to be a jerk, but that's a discipline matter - you need to do what you need to do to maintain attention. Too much heating in my car in the winter and I get drowsy as well; and that's a situation where I need to be VERY engaged! If I fall asleep at the wheel, I can't blame it on the car, that was my fault. I do try to practice mindfulness, so I never let myself fall into "auto- pilot". Breaks help and are definitely needed, the classes I've taught have been anywhere from 1 to 2 hours. I'd typically do a 1 hour block, 10 minutes and finish (or 50 min then break depending on room vibe and natural progression of material). However, I cannot control things like AC or number of people. AC in a large- scale building is an unsolved problem as-is, I have no control over every person's thermal comfort level (plus everyone's different). In that situation, I view it more internally as "What can I do to stay engaged?" rather than "What can they do to keep me engaged?" With more students enrolling, all you can do is offer ways to let them receive the material outside the prescribed time. No one has a photographic memory and can remember literally everything - that's why I make Khan Academy-style videos of my lectures. I'd love to mirror a martial art class, where I can rely on more experienced students to help others, as they may be able to offer another viewpoint I skipped over (since, I already understand the material, they just figured it out). However, in a college setting, it's a harder thing to do, given its hard to convince TAs attend the class again and act as an assistant. Repetition is a very important tool for learning, but current Western education philosophy dislikes it. I could go on, but I'm starting to ramble on a tangent... ------ wccrawford I'd be more impressed if they also did the same study with notepads and doodles and daydreams, and compared the numbers. I have a feeling that people who aren't paying attention weren't going to anyhow. However, I'd also guess that at least some people use the computer to look up additional information instead of stopping the class and asking, which helps everyone involved. ~~~ aleksei > However, I'd also guess that at least some people use the computer to look > up additional information instead of stopping the class and asking, which > helps everyone involved. No it doesn't. Practically the only point of lectures is so students can ask questions. Otherwise just read the material and don't go. Moreover there are probably others in the class too shy to ask the same question, but at worst it reinforces everyone else's learning. ~~~ watwut I hated when people asked not needed questions in lecture for over hundred people. At least attempt to answer it yourself, don't slow other 99 people down. ------ emptybits It makes sense that during a lecture, simple _transcription_ (associated with typing) yields worse results than _cognition_ (associated with writing). So pardon my ignorance (long out of the formal student loop): Are students taught how to take notes effectively (with laptops) early in their academic lives? Before we throw laptops out of classrooms, could we be improving the situation by putting students through a "How To Take Notes" course, with emphasis on effective laptopping? It's akin to "how to listen to music" and "how to read a book" courses -- much to be gained IMO. ------ LaikaF My high school did the one laptop loan out thing (later got sued for it) and I can tell you it was useless as a learning tool. At least in the way intended. I learned quite a bit mainly about navigating around the blocks and rules they put in place. In high school my friends and I ran our own image board, learned about reverse proxying via meebo repeater, hosted our own domains to dodge filtering, and much much more. As far as what I used them for in class... if I needed to take notes I was there with note book and pen. If I didn't I used the laptop to do homework for other classes while in class. I had a reputation among my teachers for handing in assignments the day they were assigned. In college I slid into the pattern they saw here. I started spending more time on social media, paying less attention in class, slacking on my assignments. As my burnout increased the actual class times became less a thing I learned from and more just something I was required to sit in. One of my college classes literally just required me to show up. It was a was one of the few electives in the college for a large university. The students were frustrated they had to be there, and the teacher was tired of teaching to students who just didn't care. Overall I left college burnt out and pissed at the whole experience. I went in wanting to learn it just didn't work out. ------ Fomite Just personally, for me it was often a choice between "Laptop-based Distractions" or "Fall Asleep in Morning Lecture". The former was definitely the superior of the two options. ~~~ izacus Just stay at home and sleep in then instead of distracting everyone around you and taking up space? ------ free_everybody I find that having my laptop out is great for my learning, even during lectures. If somethings not clear or I want more context, I can quickly look up some information without interrupting the teacher. Also, paper notes don't travel well. If everything is on my laptop and backed up online, I know that if I have my laptop, I can study anything I want. Even if I don't have my laptop, I could use another computer to access my notes and documents. This is a HUGE benefit. ------ kyle-rb >students spent less than 5 minutes on average using the internet for class- related purposes (e.g., accessing the syllabus, reviewing course-related slides or supplemental materials, searching for content related to the lecture) I wonder if that could be skewed, because it only takes one request to pull up a course syllabus, but if I have Facebook Messenger open in another tab, it could be receiving updates periodically, leading to more time recorded in this experiment. ------ calvano915 Just putting in my 2c that as a senior in dual BS and a minor, technology has allowed me to be more successful than paper ever will. I can get more notes written, can draw (I've used a tablet from day one, upgraded to an SP4 recently), import everything to keep it all organized, etc. These arguments about tech vs. paper are the same about learning styles. People are different, and what works for them will be different. Professors should allow any tools that are effective for some to be used, as long as a student is not abusing the privilege by distracting/harming other's learning. I've let my mind wander (by means of browsing facebook or some other distraction) in maybe 10 lectures max over the last 3 years of school. The rest of the time, I had OneNote open and was fully engaged. When students aren't engaged, they will find distraction be it on paper or tech. STOP TELLING ME THAT A COMPUTER WILL LOWER MY GRADES. I have a 3.84 and rising, and I refuse to change what makes me successful. ------ BigChiefSmokem I'll give you no laptops in the class if you give me no standardized testing and only four 15-20 minute lectures per day and let the kids work on projects the rest of the time as a way to prove their learning and experiences in a more tangible way. Trying to fix the problem by applying only patches, as us technically inclined would say, always leads to horribly unreliable and broken systems. ------ TazeTSchnitzel > In contrast with their heavy nonacademic internet use, students spent less > than 5 minutes on average using the internet for class-related purposes This is a potential methodological flaw. It takes me 5 minutes to log onto my university's VLE and download the course materials. I then read them offline. Likewise, taking notes in class happens offline. Internet use does not reflect computer use. ------ fatso784 There's another study showing that students around you with laptops harm your ability to concentrate, even if you're not on a laptop yourself. This is in my opinion a stronger argument against laptops, because it harms those not privileged enough to have a laptop. (not enough time to find study but you can find it if you search!) ------ jon889 I have had lectures where I have had a laptop/iPad/phone and ones where I’ve not had any. i did get distracted, but I found that if I didn’t have say Twitter I’d get distracted for longer. With Twitter I’d catch up on my news feed and then a few minutes later be back to concentrating. Without it I’d end up day dreaming and losing focus for 10-20 minutes. The biggest problem isn’t distractions, or computers and social media. It’s that hour long lectures are an awful method of transferring information. In my first year we had small groups of ~8 people and a student from 3rd/4th year and we’d go through problems from the maths and programming lectures. I learnt much more in these. Honestly learning would be much more improved if lectures were condensed into half an hour YouTube videos you can pause, speed up and rewind. Then have smaller groups in which you can interact with the lecturers/assistants. ------ homie instructors are also better off without computers in the classroom. lecture has been reduced to staring at a projector while each and every students eyes roll to the back of their skull ------ dalbasal I think there is a mentality shift that _may_ come with digitizing learning which _might_ help here. The discussion on a topic like this can go in two ways. (1) Is to talk about how a laptop _can_ help if students use it to _xyz_ and avoid _cba_. It's up to the student. Bring a horse to water...(2) The second way you can look at this is to compare outomes, statistacally or quasi-statistically. IE, If laptops are banned we predict an N% increase in Z, where Z is (hopefully) a good proxy for learning or enjoyment or something else we want. IE, think about improving a college course the same way we think about optimizing a dating site. On a MOOC, the second mentality will tend to dominate. Both have downsides, especially when applied blindly (which tends to happen). In any case, new thinking tends to help. ------ brodock Any research that takes students as an homogenic group is flawed. People can be (more or less) in about one of the 7 different types of learning styles [https://www.learning-styles-online.com/overview/](https://www.learning- styles-online.com/overview/). So making claims like "doing X works better than Y" is meaningless without pointing to a specific learning style. That's why you hear people defending writing to paper, while others prefer just hearing the lectures or others have better performance while discussing with peers (and some hate all of the other interactions and can perform better by isolating and studying on your own... which is probably the one who will benefit the most of having a laptop available). ~~~ agentdrtran Learning styles are have been debunked. [https://en.wikipedia.org/wiki/List_of_common_misconceptions#...](https://en.wikipedia.org/wiki/List_of_common_misconceptions#Brain) ~~~ brodock debunked is a hard word for "hey, lack of peer review": "... Coffield's team found that none of the most popular learning style theories had been adequately validated through independent research." \- [https://en.wikipedia.org/wiki/Learning_styles](https://en.wikipedia.org/wiki/Learning_styles) sounds more like lack of funding than pseudoscience. ------ vblord During indoor recess at my kids school, kids don't eat their lunch and just throw it away because of the chromebooks. There are only have a few computers and they are first come first serve. Kids would rather go without lunch to be able to play on the internet for 20 minutes. ------ nerpderp83 Paying attention requires work, we need to purposefully use tools that are also distractions. ~~~ ahussain I definitely feel my attentiveness and focus dropped dramatically after computers were introduced into my work life. It's a shame that computers provide such a thin line between work and entertainment. ~~~ striking You can make that line thicker. You can create a new user on your computer specifically for work, with a restricted environment. You could use VMs or dualboot or something. Personally, I'm very happy that we have devices that are capable of doing so many things. ~~~ wott You can but you won't as long as it is possible to bypass the trick, because you are inevitably attracted (not to say addicted) to the online web content and interactions and you'll quickly switch back to it. ~~~ striking I see that as a problem with the person viewing the content, not the device that enables them. There are technological tools to help you. There are psychological tools to help you. You can call upon your friends and family for help. But for gods' sake, don't blame the computer. That's not going to help anyone. ~~~ ahussain This is a fair position, but we shouldn't forget that companies have poured billions of dollars into making these "tools" as addictive as possible, because that's ultimately how they make their money. See [1] and [2] for more. [1] - Addiction by Design ([https://www.amazon.co.uk/Addiction-Design-Machine- Gambling-V...](https://www.amazon.co.uk/Addiction-Design-Machine-Gambling- Vegas/dp/0691160880)) [2] - Chomsky on Advertising ([https://www.youtube.com/watch?v=3CFwSQiTu3I&t=186s](https://www.youtube.com/watch?v=3CFwSQiTu3I&t=186s)) ------ Zpalmtree I like having a laptop at uni just because I can program when the lectures are boring, I find the material is too easy in UK universities in CS at least, dunno about other courses or countries, but the amount of effort you need to get good marks along with the amount you're paying is a bit silly, and mostly you'll learn more by yourself... That said, if you're in a programming class, having a laptop to follow along and try out the concepts is really handy, when we were in an C++/ASM class, seeing the different ASM GCC/G++ and Microsoft's C++ compiler spat out was quite interesting. ~~~ bostand If its too simple and boring for you, why don't you leave? ------ zokier I love how any education-related topic brings out the armchair-pedagogist out from the woodworks. Of course a big aspect there is that everyone has encountered some amount of education, and especially both courses they enjoyed and disliked. And there is of course the "think of the children" aspect. To avoid making purely meta comment, in my opinion the ship has already sailed; we are going to have computers in classrooms for better or worse. So the big question is how can we make the best use of that situation. ~~~ discreditable I noticed that the article is speaking from a university perspective. I work in the high school realm, where teachers have more ability to reprimand students not on task. That seems to help students use computers more effectively, but at the same time it requires some effort on the part of the instructor. ------ erikb I'd argue that students are better off without a classroom as long as they have a laptop (and internet, but that is often also better at home/cafe than in the classroom). ------ zitterbewegung When I was in College I would take notes using a notebook and pad and paper. I audited some classes with my laptop using latex but most of the time I used a notebook. Also, sometimes I would just go to class without a notebook and get the information that way. It also helped that I didn't have a smartphone with Cellular data half of the time I was in school. ------ thisrod > First, participants spent almost 40 minutes out of every 100-minute class > period using the internet for nonacademic purposes I think that I'd be one of them; in the absence of a laptop, I'd spend that time daydreaming. How many people can really concentrate through a 100 minute nonstop lecture about differential geometry or the decline of the Majapahit empire? ------ kgilpin It sounds like what students need are better teachers. I haven't been to school in a while but I had plenty of classes that were more interesting than surfing YouTube; and some that weren't. The same is true for meetings at work. In a good session, people are using their laptops to look up contributing information. In a bad one... well... you know. ------ polote Well it depends on what you do in the classroom, when class is mandatory but you are not able to learn this way (by listening to a teacher), having a laptop can let you do other things. And then use your time efficiently, like doing some administrative work, send email, coding ... Some students are of course better with a laptop in the classroom ------ jessepage1989 I find taking paper notes and then reorganizing on the computer works best. The repetition helps memorization. ------ marlokk Students are better off with instructors who don't bore students into bringing out their laptops. ------ wh313 Could it be that the intermittent requests to servers by running apps, say Facebook Messenger or WhatsApp, be tracked as social media use? Because they all use HTTPS I don't see how the researchers distinguished between idle traffic vs sending a message. ------ mark_l_watson In what universe would it be a good idea for students use laptops in class? Use of digital devices should be limited because the very use of digital devices separates us from what is going on around us. Students should listen and take notes (in a notebook) as necessary. ------ _e Politicians are also better off without a laptop during legislative sessions [0]. [0] [http://www.snopes.com/photos/politics/solitaire.asp](http://www.snopes.com/photos/politics/solitaire.asp) ------ qguv Internet access, especially to Wikipedia, did wonders for me whenever the lecture turned to something I was already familiar with. That alone kept me from getting distracted and frustrated as I would in classes whose professors prohibited laptop use. ------ aurelianito Even better, just remove the surrounding classroom of the laptop. Now we can learn anything anywhere. Having to go to take a class were a professor recites something is ridiculous. ------ Radle If students thing the class is boring enough, they'll watch youtube whether on the laptop or on their mobile is no really important. ------ Glyptodon I feel like the conclusion is a bit off base: that students lack the self control to restrict the use of laptops laptops to class-related activities is somehow a sign that the problem is the laptop and not the students? I think it's very possible that younger generations have big issues with self-control and instant gratification. But I think it's wrong to think that laptops are the faulty party. ~~~ izacus Riiight, because teenagers and young adults are so known for their long-term planning skills and self-control. We're not animals, we don't get born with instincts. This is why humans require education and upbringing to teach. And yes, this ( _gasp_!) sometimes means you need to make a non-adult person to do something against their first whim. ~~~ Glyptodon I don't disagree except for the fact that college students are supposed to be at least semi-adults (though perhaps young and silly ones) and getting through a 50 minute class without giving in to digital temptations is really something that people ought to be capable of well before college. ~~~ jpindar In fact, it's probably helpful for them to practice that before they have to on the job. ------ Shinchy I've always find the idea of taking a laptop to a lecture pretty rude. I'm there to give the person teaching my full attention, not stare at a laptop screen. So personally I never use them in any type of lecturing / teaching environment simply as a mark of respect. ------ alistproducer2 "Duh" \- anyone who's ever been in a class with a laptop. ------ jonbarker Students need a GUI-less computer like a minimalist linux distro. ------ dorianm Pen and papers are the best. Also chromebooks are pretty cool ------ exabrial Students are best of with the least amount of distractions ------ rokhayakebe We really need to begin ditching most studies. We have the ability now to collect vast amount of data and use that to make conclusions based on millions of endpoints, not just 10, 100 or 1000 pieces of information. ~~~ Balgair informed consent for scientific research is very specific and very important. It's history is somewhat intersting, but goes back to the Geneva conventions in the aftermath of WW2 and the Axis efforts on human experimentation: [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2328798/](https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2328798/) ------ partycoder I think VR will be the future of education. ~~~ snakeanus How so? ------ ChiliDogSwirl Maybe it would be helpful if our operating systems were optimised for working and learning rather than to selling us crap and mining our data. ~~~ snakeanus There are many OSes that don't do that. ------ Kenji If you keep your laptop open during class, you're not just distracting yourself, you're distracting everyone behind you (that's how human attention works - if you see a bright display with moving things, your attention is drawn towards it), and that's not right. That's why at my uni, there was an unspoken (de-facto) policy that if you keep your laptop open during lectures, you're sitting in the backrows, especially if you play games or do stuff like that. It worked great - I was always in the front row with pen & paper. However, a laptop is very useful to get work done during breaks or labs when you're actually supposed to use it. ------ Bearwithme They should try this study again, but with laptops heavily locked down. Disable just about everything that isn't productive including a strict web filter. I am willing to bet the results would be much better for the kids with laptops. Of course if you let them have free reign they are going to be more interested in entertainment than productivity. ------ catnaroek This is why I like to program in front of a whiteboard rather than in front of my computer: to be more productive. ------ bitJericho The schools are so messed up in the US. Best to just educate children yourself as best you can. As for college kids, best to travel abroad. ~~~ robotresearcher > As for college kids, best to travel abroad. 15 of the top 20 universities in the world are in the US. [https://www.timeshighereducation.com/world-university- rankin...](https://www.timeshighereducation.com/world-university- rankings/2017/world- ranking#!/page/0/length/25/sort_by/rank/sort_order/asc/cols/stats) ~~~ izacus As claimed by US publication using their own US biases for ranking :) ~~~ robotresearcher It's a British publication. Choose any other well-regarded ranking and you'll get similar results. ~~~ robotresearcher E.g. The Shanghai AWRU index 2015 has 15 US schools in the top 20. [https://www.timeshighereducation.com/student/news/shanghai-r...](https://www.timeshighereducation.com/student/news/shanghai- ranking-academic-ranking-world-universities-2016-results-announced) ------ FussyZeus Disengaged and uninterested students will _find_ a distraction; yes, perhaps a laptop makes it easier but my education in distraction seeking during middle school, well before laptops were even close to schools, shows that the lack of a computer in front of me was no obstacle to locating something more interesting to put my attention to. The real solution is to engage students so they don't feel the urge to get distracted in the first place. Then you could give them completely unfiltered Internet and they would still be learning (perhaps even faster, using additional resources.) You can't substitute an urge to learn, no matter if you strap them to the chairs and pin their eyeballs open with their individual fingers strapped down, it won't do anything. It just makes school less interesting, less fun, and less appealing, which makes learning by extension less fun, less appealing, and less interesting.

The Microsoft® Web Platform offers the right tools for the right task. Design, build, debug, and deploy websites withchristian louboutin bridal shoes blue artichoke . And then test your sites in Windows® Internet Explorer® 10 using the built-in developer tools. Late tries from TJ Ioane and Arscott restored parity once more, as Cipriani missed the chance to settle a topsy turvy clash with four failed conversions.christian louboutin bridal shoes blue artichoke This is purely speculative: The Russians don't rely on oil revenues as much as do the Saudis, for them the biggest danger comes from rolling over their dollar debt, we are talking billions dollars. We hope you find the Consultation Draft useful and informative and we look forward to engaging with you during the consultation process in 2016. email us for more info Kids Photo Booth Hire Our Amusebooth kids size photo booth is specifically designed for young children to use, amuse and enjoy at any Birthday party, fun day, event and more.christian louboutin bridal shoes blue artichoke First up was the lovely Sarah Milman of Heart of Time (which we reviewed after True Believers) and Sian Jefferson whose The Book Of Fey we reviewed way back when. Colonel MustardFebruary 20th, 2016 09:57 And apropos to that some time ago a BBC documentary about local council allocation of housing and benefits to new arrivals demonstrated very clearly how much discretion even fairly low ranking "decision makers" are allowed.christian louboutin bridal shoes blue artichoke pyralspite garnets series of garnets of general formula A3Al2(SiO4)3 in which A is divalent, typically Mg (pyrope), Fe(II) (almandine) or Mn(II) (spessartine). SMART Replay for coaching Hawk Eye's SMART Replay technology can provide every angle of a player, team or opponent's performance live and post event to team coaches and video analysts. Herald Scotland has 'share' buttons to enable users of the website to share articles with their friends on websites like Facebook, Twitter and Google + social networks.christian louboutin bridal shoes blue artichoke

Star Trek: Paramount keen to avoid stigma of movie licenses Star Trek: The Video game launches in April, and license-holder Paramount has stressed that it won’t be another shoddy cash-in. The company has said it learned a great deal from previous licensed disasters. Speaking with Eurogamer Paramount’s Brian Miller explained that the company was well aware of terrible movie games, and that it used this knowledge to avoid common pitfalls. Said Miller, “Our goal was to make the most authentic Star Trek game we could. We’re not a licensed game – we’re funding this and making this ourselves. A traditional licensed game, you get a licensor and say they’ll give you some money to make the game. This is a game that we’re making in-house, and it’s been funded by Paramount Pictures from day one.” The game has been farmed out to Darkess 2 studio Digital Extremes, and looks set to deliver a barrage of third-person cover shooting and co-op shenanigans. “There’s a lot of stigma to movie-based games and there have been some that have done it well”, Miller continued. “But the majority haven’t lived up to expectations, and that was something that we’ve been cautious of since the day we started making this game.” What do you think of Star Trek: The Video Game so far? Does it appear to skirt around licensed game problems, or are you uninspired? Let us know below. Sometimes we include links to online retail stores. If you click on one and make a purchase we may receive a small commission. For more information, go here.

Q: visible indication that a cell is not evaluatable Occasionally I make cells not evaluatable. Is there any way to have some sort of visible indication (automatic) that reminds me if a cell is not evaluatable. One example of why I do this is that we have multiple environments: Production, UAT, and Development. I use different cells for each one, and only set the one I need to be evaluatable. Another example would be having test data that I need, for some of the time, but not for other times. I have, on occasion, run something with the wrong cell set up as evaluatable. I thought it might be helpful if there was a visual indicator, without having to lookup the cell properties, to remind me which cell is evaluatable. A: Here's another stylesheet way: Cell[ StyleData["Input"], CellBracketOptions -> { "Color" -> FEPrivate`If[ FEPrivate`SameQ[ FrontEnd`CurrentValue[FrontEnd`EvaluationCell[], Evaluatable], True ], GrayLevel[.7], GrayLevel[.9] ] } ] This makes the cell bracket very light if it can't be evaluated: You could also make it darker or thicker or whatever you want. Check Options[EvaluationCell[], CellBracketOptions] to see what you can play with A: You can make the cell appearance depend dynamically on it option values. For example, edit the stylesheet and add the options to the "Input" style: Cell[StyleData["Input"], CellDingbat -> Dynamic[If[CurrentValue[EvaluationCell[], Evaluatable], None, StyleBox["Ø", FontColor -> GrayLevel[0.7]]]]] [You can see a little horizontal tick on the non-executable cell bracket, but I can't usually see those things anymore in the notebook, at least not reliably. Thanks @ HighPerformanceMark.]

The Ahmedabad Escorts are truly one of a kind as they not just offer the in call administrations with exactness yet the out call administrations are likewise given proficiently by the provocative Ahmedabad Call Girls.

Key highlights: We assign Uber a fair value estimate of $110 billion as the firm is projected to increase its top line by 27% annually during the next 10 years, driven by continued expansion in new cities and regions globally, plus an increasing adoption rate as the company attracts more users. We expect Uber to grab nearly 50% of the ridesharing market by 2022 (up from 29% in 2017) as it leverages its first-mover advantage along with its network effect and data moat sources. We value Uber's total addressable market, which includes the aggregate of the global taxi, ridesharing, and food delivery industries along with the US markets for freight brokerage and the share we believe ridesharing companies can take from global public transport and US bikeshare, at $630 billion by 2022, representing a 26% five-year compound annual growth rate. We believe autonomy is the most transformative technology set to affect the world of ridesharing; we see powerful economic forces driving autonomous vehicle adoption in the ridesharing industry, from which Uber may benefit. Share: In this report, developed in collaboration with Morningstar, we take a deeper look at Uber, the most valuable VC-backed company in the US, ahead of its upcoming IPO. We believe that Uber is likely to maintain its competitive advantage via its network effect and intangible assets, which could position the firm to become profitable and generate excess returns on invested capital in the future.Note: This report was updated on August 2, 2018, to amend an error in a chart.

[Functional rating scales for amyotrophic lateral sclerosis]. Amyotrophic lateral sclerosis (ALS) is a progressive degeneration of the peripheral and central motor neurons. The principal consequence is a loss of motor functions. Evaluation of motor deficit implies an assessment of the resulting deficiency or incapacity and final disability. Many evaluation are proposed for patient follow-up in order to analyze the state of motor function and their consequences on activities of everyday life. Few recommendations can be formulated. Scales must be validated and relatively simple to use and generate ordinate results allowing statistical analysis. The choice of which scale to use depends on the clinical objective. Global scales (ALS Functional rating Scale, ALS Severity Scale, Appel scale, Norris scale and Honda scale) can be used to evaluate progression of the disability. Some of these scales are strongly correlated with patient survival. Other scales (ALS Health State Scale, global clinical impression) are used to classify patients by homogeneous stage of gravity. Still other scales, such as the Sadoul and Borg scales and the Epworth score are designed for more specific evaluation of a given function. The clinician should be aware of these different scales and their relative utility. Knowledge of these scales, their validity, their sensitivity to modification, and their specificity and interpretation pitfalls is a prerequisite to good evaluation in daily practice and clinical research.

Anomalous increase in dielectric susceptibility during isothermal aging of ultrathin polymer films. The aging dynamics of poly(2-chlorostyrene) (P2CS) ultrathin films with thicknesses less than 10 nm were investigated using dielectric relaxation spectroscopy. The imaginary part of the dielectric susceptibility ϵ″ for P2CS ultrathin films with a thickness of 3.7 nm increased with an increase in isothermal aging time, while this was not the case for P2CS thin films thicker than 9.0 nm. This anomalous increase in ϵ″ for the ultrathin films is strongly correlated with the presence of a mobile liquidlike layer within the thin films.

In English counties there are so non understandable dialects that people from neighbouring villages can't understand each other. English dialects from Edinburg or Wales are extremely hard to understand. So, even Englishmen need an interpretor to talk each other (but they have the same syntax! that's why that is English language). Yiddish? That sounds pure German C'mon it's 20 years of the Ukrainian independence, they don't have any fleet already (actually it grieves me). That's the whole point of the idiom. "German" at the turn of the 20th century was more of a continuum than a language. Hence, somebody from the low German lands would have a rather easy time understanding Dutch, but would be completely unable to understand Bavarian (a high German "dialect"). The question then, is why is Dutch a language, while other distinct forms of speech in the same family are only dialects of "German"? The difference between a language and a dialect is completely political, and I suspect that is why you are in disagreement with Nektarios. A good modern day example is Chinese. Really, the "dialects" of Chinese are languages in their own right (I would say that they are more diverse than the so-called Romance languages), but for political and historical reasons, they are termed dialects instead of languages. I actually find it sad that Mandarin, a tongue so different from Middle Chinese, was chosen to be the standard language. Hakka would have been a better choice. « Last Edit: May 15, 2012, 03:35:54 PM by Cavaradossi » Logged Be comforted, and have faith, O Israel, for your God is infinitely simple and one, composed of no parts. Quis custodiet ipsos custodes? Who can watch the watchmen?"No one is paying attention to your post reports"Why do posters that claim to have me blocked keep sending me pms and responding to my posts? That makes no sense. In English counties there are so non understandable dialects that people from neighbouring villages can't understand each other. English dialects from Edinburg or Wales are extremely hard to understand. So, even Englishmen need an interpretor to talk each other (but they have the same syntax! that's why that is English language). Yiddish? That sounds pure German C'mon it's 20 years of the Ukrainian independence, they don't have any fleet already (actually it grieves me). That's the whole point of the idiom. "German" at the turn of the 20th century was more of a continuum than a language. Hence, somebody from the low German lands would have a rather easy time understanding Dutch, but would be completely unable to understand Bavarian (a high German "dialect"). The question then, is why is Dutch a language, while other distinct forms of speech in the same family are only dialects of "German"? The difference between a language and a dialect is completely political, and I suspect that is why you are in disagreement with Nektarios. A good modern day example is Chinese. Really, the "dialects" of Chinese are languages in their own right (I would say that they are more diverse than the so-called Romance languages), but for political and historical reasons, they are termed dialects instead of languages. I actually find it sad that Mandarin, a tongue so different from Middle Chinese, was chosen to be the standard language. Hakka would have been a better choice. Chinese is a little unique, though, isn't it, in that writing is mutually intelligible? What I mean is, a Hakka-speaker could write a letter to a Cantonese-speaker and both would be able to understand the content. Contrariwise, were the same letter to be read aloud by the Hakka-speaker to the Cantonese-speaker, only the Hakka-speaker would understand what was/is being said. What I mean is, a Hakka-speaker could write a letter to a Cantonese-speaker and both would be able to understand the content. Contrariwise, were the same letter to be read aloud by the Hakka-speaker to the Cantonese-speaker, only the Hakka-speaker would understand what was/is being said. That is partially true. In practice, there are a lot of characters used in one regional tongue which do not appear in others. This is true of Cantonese, for example, where the characters used for the third person pronoun, the copula, the plural marker for pronouns, the possessive marker, and the verb to come (among others) are different from Mandarin. But yes, generally speaking, the writing can be mutually intelligible if characters common to both tongues are exclusively used, whereas speech is not generally mutually intelligible. « Last Edit: May 15, 2012, 09:56:13 PM by Cavaradossi » Logged Be comforted, and have faith, O Israel, for your God is infinitely simple and one, composed of no parts. Quis custodiet ipsos custodes? Who can watch the watchmen?"No one is paying attention to your post reports"Why do posters that claim to have me blocked keep sending me pms and responding to my posts? That makes no sense. Question a friend, perhaps he did not do it; but if he did anything so that he may do it no more.A hasty quarrel kindles fire,and urgent strife sheds blood.If you blow on a spark, it will glow;if you spit on it, it will be put out; and both come out of your mouth Yes, I saw it the first time. Although it acknowledges regional differences, it doesn't address how that affects its results, just what is "traditional." It also seems to show a growing preference of a course for Ukraine independent of the EU and Russia. Btw, substantiation means some action actually practicing what is preached, like the independence referendum. And you pretend to be a anglophone. Logged Question a friend, perhaps he did not do it; but if he did anything so that he may do it no more.A hasty quarrel kindles fire,and urgent strife sheds blood.If you blow on a spark, it will glow;if you spit on it, it will be put out; and both come out of your mouth That would be better, and a little more traditional. One has to be careful what transliteration one puts in front of Americans; some of the resulting sounds are simply ghastly. True, but unless an American already knows the language there is no way they'd differentiate between х and г (Ukrainian pronunciation). And it is doubtful they'd come up with anything close to и / ы for with "y". True, but unless an American already knows the language there is no way they'd differentiate between х and г (Ukrainian pronunciation). Still better that Poles. In the pronunciation I hear on TV the Americans (or native English speakers in general) seem to pronounce these two sounds (in English) as separate sounds, although they might not know that in Ukrainian there is such a distinction too. On the other hand in Poland the sound described in Cyrillic whit 'г' has already disappeared. Little amount of people can hear it, even less - pronounce. Quis custodiet ipsos custodes? Who can watch the watchmen?"No one is paying attention to your post reports"Why do posters that claim to have me blocked keep sending me pms and responding to my posts? That makes no sense. All both of them were Russians? I suppose there are Ukrainian linguists that claim Russian language if a dialect of the Ukrainian. It doesn't matter if one is Russian, what is important is whether one's political ideology is what drives one's scientific work. Lomonosov was very much a part of the ideology of the Russian Empire. Dismissing the Ukrainian language and people was part of the agenda. Trubetzkoy was a Eurasianist. If you read the linked essay, it isn't a scientific work at all. It is more a point of aesthetics. I don't think Vladik could produce a peer reviewed academic work published in the last thirty years that claims Ukrainian is just a dialect of Russian. I think only the most crazy of Ukrainians would claim Russian as a dialect of Ukrainian. Where Ukrainian nationalism appears in scholarship, it is usually connected with Ruthenians. In general the direction most scholars who don't simply regurgitate Muscovite propaganda are heading is to question the idea of East Slavic linguistic unity during the time of Kyivs'ka Rus'. Novgorod may yet prove to be the thorn in the side of Muscovite ambitions, thanks to the early attestation of its language. Question a friend, perhaps he did not do it; but if he did anything so that he may do it no more.A hasty quarrel kindles fire,and urgent strife sheds blood.If you blow on a spark, it will glow;if you spit on it, it will be put out; and both come out of your mouth True, but unless an American already knows the language there is no way they'd differentiate between х and г (Ukrainian pronunciation). Still better that Poles. In the pronunciation I hear on TV the Americans (or native English speakers in general) seem to pronounce these two sounds (in English) as separate sounds, although they might not know that in Ukrainian there is such a distinction too. On the other hand in Poland the sound described in Cyrillic whit 'г' has already disappeared. Little amount of people can hear it, even less - pronounce. just grab an Arab. We have it. غ Logged Question a friend, perhaps he did not do it; but if he did anything so that he may do it no more.A hasty quarrel kindles fire,and urgent strife sheds blood.If you blow on a spark, it will glow;if you spit on it, it will be put out; and both come out of your mouth That is for sure. We had a delegation of Russians here back in the '90's, and since the plant was in Ukraine, we had one of our Ukrainian engineers escort them as a translator. As he was addressing them, one of the delegation (who, indeed were Russian) asked him why he kept speaking to them in Polish. I'm well aware of the difference between syntax and lexicon. Even very basic things such as showing possession and obligation are much different in typical, spoken Ukrainian than Russian. Ukrainian is not just Russian with a few different words. Logged I would be happy to agree with you, but then both of us would be wrong. That is for sure. We had a delegation of Russians here back in the '90's, and since the plant was in Ukraine, we had one of our Ukrainian engineers escort them as a translator. As he was addressing them, one of the delegation (who, indeed were Russian) asked him why he kept speaking to them in Polish. I'm well aware of the difference between syntax and lexicon. Even very basic things such as showing possession and obligation are much different in typical, spoken Ukrainian than Russian. Ukrainian is not just Russian with a few different words. Logged Question a friend, perhaps he did not do it; but if he did anything so that he may do it no more.A hasty quarrel kindles fire,and urgent strife sheds blood.If you blow on a spark, it will glow;if you spit on it, it will be put out; and both come out of your mouth Didn't you claim to be Egyptian? Russian/Bulgarian г is like Egyptian ﺝ (geem). Ukrainian г is like Egyptian ﻩ‎ (ha). ﻍ‏ (ghain) ‎, on the other hand, is like French r, a sound which does not exist in Ukrainian or Russian. Ukrainian/Russian x is like Arabic ﺥ‎ (kha), Bulgarian x is like ﻩ‎ (ha). Church Slavonic, which is what I understand what was being discussed, pronounces it like غ Logged Question a friend, perhaps he did not do it; but if he did anything so that he may do it no more.A hasty quarrel kindles fire,and urgent strife sheds blood.If you blow on a spark, it will glow;if you spit on it, it will be put out; and both come out of your mouth The Slavons were such a Christian, holy people, that they never left church. That's why we call it Church Slavonic. Sometime around the time the Mongols destroyed Kiev, the Slavons who were left mysteriously vanished. Some say they were taken up to heaven like Elias. Even today, there is many a good priest who will tell you we will all speak Church Slavonic in heaven. And it's just so. Logged Quote from: GabrieltheCelt If you spend long enough on this forum, you'll come away with all sorts of weird, untrue ideas of Orthodox Christianity. Quote from: orthonorm I would suggest most persons in general avoid any question beginning with why. Hmm. That's odd. I've always heard it is Coptic from the Copts, Syriac from the Syrians, Ge'ez from the Tewahedo, etc. I guess maybe it will be like one of those museums where you pick up the headset of your choice language... Otto Meinardus has a lovely line in describing the world view of the Copts: "God takes care of his own, i.e. the Monophysite [sic] Copts, and will judge everyone else accordingly." Logged Question a friend, perhaps he did not do it; but if he did anything so that he may do it no more.A hasty quarrel kindles fire,and urgent strife sheds blood.If you blow on a spark, it will glow;if you spit on it, it will be put out; and both come out of your mouth Hahaha. That is so true. After liturgy last week I observed a conversation between two friends from the church, one of whom is from Cairo (I think) and the other from Alexandria, that went like this: Cairene: I really like Abouna Filemon (the priest who had served the liturgy that day)...he is a very holy man. You know while everyone was arguing among each other during the (agape) meal, I looked over and expected to see him sitting in his chair (the chair that is reserved for him out of respect), but instead he was sitting on the floor, quietly reading over the scriptures and praying. Just like a monk! He is more holy than the rest of us, I think. Alexandrian: Of course he is...you know why? He is from Alexandria, like me! They then commenced bickering and laughing at each other. "Ohhh, THIS guy...Alexandrians are like this, you see! They think they are better than everybody" "You are just jealous you aren't one of us!", etc. It's like going to the church of Mari Abbot and Costello sometimes, I swear...

615 F.Supp.2d 884 (2009) Laura A. HEIMLICHER and Lawrence W. Heimlicher, Plaintiffs, v. James O. STEELE, M.D., and Dickinson County Memorial Hospital, an Iowa non-profit corporation, dba Lakes Regional Healthcare, Defendants. No. C05-4054-PAZ. United States District Court, N.D. Iowa, Western Division. May 14, 2009. *893 Brian J. McKeen, McKeen & Associates, PC, Detroit, MI, James H. Cook, Dutton Braun Staack Hellman, Waterloo, IA, for Plaintiffs. Jim D. Dekoster, Stephen J. Powell, Swisher & Cohrt, PLC, Waterloo, IA, Joseph L. Fitzgibbons, Ned A. Stockdale, Fitzgibbons Law Office, Estherville, IA, for Defendants. MEMORANDUM OPINION AND ORDER ON DEFENDANTS' POST-TRIAL MOTIONS PAUL A. ZOSS, United States Magistrate Judge. I. BACKGROUND ........................................................................ 894 II. DESCRIPTION OF ISSUES RAISED IN THE MOTIONS ....................................... 896 III. STANDARDS FOR CONSIDERING POST-TRIAL MOTIONS ...................................... 897 A. Motions for Judgment as a Matter of Law ........................................ 897 B. Motions for New Trial .......................................................... 898 C. Motions to Amend Judgment ...................................................... 899 IV. ANALYSIS OF ISSUES RAISED IN THE MOTIONS ........................................... 900 A. Does a Physician's Certification Absolve a Hospital from Liability under EMTALA for Transferring a Patient to Another Hospital? ................... 900 1. Was Ms. Heimlicher's emergency medical condition stabilized before she was transferred to Sioux Valley Hospital? ....................... 903 2. Did Ms. Heimlicher make a written request to be transferred to Sioux Valley Hospital? ..................................................... 904 3. Did Dr. Steele properly certify that the benefits from the transfer outweighed the risks? ...................................................... 905 B. Did the Court Err in Placing the Burden of Proof on the Certification Defense on Lakes Hospital? .................................................... 909 C. Did the Court Err in Instructing the Jury on Dr. Steele's Negligence? ........... 910 D. Did the Court Err in Instructing the Jury on Lakes Hospital's Negligence? ................................................................... 911 E. Were the State-Law Negligence Claims against Lakes Hospital Preempted by EMTALA? .......................................................... 912 F. Did the Court Err in Refusing to Submit Ms. Heimlicher's Comparative Fault to the Jury? ................................................ 915 G. Did the Court Mislead the Jury into Assigning Lakes Hospital Double Liability? ..................................................................... 918 H. Did the Court Err in Allowing Plaintiffs' Counsel to Ask Expert Witnesses Questions Based on the Jury Instructions? ........................... 920 I. Did the Court Err in Permitting the Jury to Treat Dr. Low as an Agent of Lakes Hospital? ...................................................... 921 J. Did the Court Erroneously Allow Evidence of Grief into The Record? .............. 922 K. Did the Court Err in Allowing Photographs of the Fetus into Evidence? ..................................................................... 927 *894 L. Did the Court Err in Allowing Dr. Leavy to Testify to Matters Outside of His Expert Witness Designation? ............................................ 928 M. Did the Plaintiffs Waive Their EMTALA Claim by Not Submitting to the Court Timely Requested Jury Instructions on the Claim? .................... 931 N. Did the Court Err in Submitting Revised Damages Instructions to the Jury? ......................................................................... 931 O. Did the Court Err in Reading the Instructions to the Jury Before Any Evidence Was Received? ........................................................ 932 P. Did the Court Err in Not Granting the Various Motions for Mistrial Asserted by the Defendants Throughout the Trial? .............................. 933 Q. Was the Verdict Irrational, Arbitrary, Excessive, or Unjust? .................... 937 V. CONCLUSION ......................................................................... 942 APPENDIX ................................................................................. 942 DEFENDANTS' JOINT EXHIBIT H .............................................................. 943 PLAINTIFFS' EXHIBIT 5 .................................................................... 944 JOINT EXHIBIT 50, PAGE 15 ................................................................ 945 INSTRUCTION NO. 13 ....................................................................... 946 INSTRUCTION NO. 15 ....................................................................... 946 INSTRUCTION NO. 16 ....................................................................... 946 INSTRUCTION NO. 17 ....................................................................... 947 INSTRUCTION NO. 18 ....................................................................... 947 INSTRUCTION NO. 19 ....................................................................... 948 INSTRUCTION NO. 20 ....................................................................... 949 INSTRUCTION NO. 22 ....................................................................... 949 I. BACKGROUND The plaintiffs in this case are Laura A. Heimlicher and Lawrence W. Heimlicher. The defendants are Dickinson County Memorial Hospital, a hospital in Spirit Lake, Iowa ("Lakes Hospital" or "the Hospital"); and James O. Steele, M.D., a specialist in emergency medicine working at Lakes Hospital. On February 11, 2004, Ms. Heimlicher began experiencing vaginal bleeding, pain in her abdomen, and contractions. Joint Ex. 50, pp. 1-3. She was 34 weeks pregnant. She called "911" from her home, and was taken by ambulance to the Lakes Hospital emergency room, where she was examined by Dr. Steele. Id., p. 6. He conducted a vaginal examination, and then ordered an ultrasound. Id., p. 8. The ultrasound was performed by Tracy Evans, an ultrasound technician employed by Lakes Hospital. As Ms. Evans was performing the ultrasound examination, she described to Dr. Steele what she was seeing. Based on Ms. Evans's comments, Dr. Steele wrote in his notes that the ultrasound examination ruled out the possibility of a "placental abruption," a serious condition where the placental lining separates from the uterine wall. Id., pp. 7-9. Dr. Steele made this notation even though he was not qualified to read ultrasound images, *895 and he knew Ms. Evans was not qualified to read ultrasound images. He also knew that an ultrasound examination could never rule out a placental abruption.[1] No radiologist was available at Lakes Hospital to read the ultrasound images, so Ms. Evans transmitted the images electronically to "Dr. Low," a radiologist in Minnesota who was on call that night. Dr. Low and Ms. Evans then spoke on the telephone, and he told her his diagnosis was "mass vs. hemorrhage vs. fibroid." See Def. Joint Ex. H, the "ultrasound worksheet," a copy of which is attached to this ruling. Ms. Evans testified that she relayed this information to Dr. Steele. Dr. Steele testified he did not recall receiving this information, and he did not even know a radiologist had looked at the ultrasound images that evening. In fact, he testified he was not aware that Lakes Hospital had the capability of electronically sending ultrasound images to a radiologist for review. Dr. Steele testified that if he had been advised the images showed "mass vs. hemorrhage vs. fibroid," he would have ordered an immediate Cโ€”section. Dr. Steele consulted by telephone with Dr. Michael M. Fiegen, an obstetrician in Sioux Falls, South Dakota, about Ms. Heimlicher's care and about transferring her to Dr. Fiegen's care at Sioux Valley Hospital in Sioux Falls. Sioux Valley Hospital is a larger hospital, with better facilities and a more specialized staff, about 100 miles away. Dr. Steele confirmed to Dr. Fiegen that Ms. Heimlicher's placenta was not abrupting and her uterus was not ruptured, and told him her condition was stable. Based on these representations, Dr. Fiegen agreed to accept the transfer. Dr. Fiegen had Dr. Steele administer medication to Ms. Heimlicher to slow her contractions. The plaintiffs offered evidence that Dr. Steele failed to perform a proper differential diagnosis of Ms. Heimlicher's condition, and if he had done so, he would have diagnosed an abrupting placenta. There is no dispute that if Dr. Steele had known Ms. Heimlicher's placenta was abrupting, the applicable standard of care would have required him to order an immediate Cโ€” section. There also is no dispute that the Lakes Hospital staff was capable of performing Cโ€”sections, and could have performed one that evening. Inclement weather did not permit the use of a helicopter or an airplane, so Ms. Heimlicher was placed in a ground ambulance for transport to Sioux Valley Hospital. She was accompanied in the ambulance by Jennifer Helle, the nurse who had been caring for her at Lakes Hospital. After leaving Lakes Hospital in the ambulance, Ms. Heimlicher almost immediately began experiencing too-rapid contractions, profuse vaginal bleeding, and severe pain in her abdomen. At the same time, a fetal monitor was showing that the baby was in distress. Joint Ex. 50, p. 12. These symptoms were strong evidence of an abrupting placenta or a rupturing uterus. Nevertheless, Nurse Helle did not report the symptoms to Dr. Steele, or to anyone else, and the ambulance proceeded to Sioux Falls. Although there were hospitals capable of performing a Cโ€”section along the route to Sioux Falls, those options were not explored. As the ambulance traveled to Sioux Falls, the baby's condition deteriorated significantly, and by the time the ambulance reached its destination, the baby's heartbeat was almost nonexistent. Dr. Fiegen determined that Ms. Heimlicher was in "severe pain and clearly abrupting *896 her placenta or rupturing the uterus." An immediate Cโ€”section was performed, but the baby was stillborn. There is no dispute that the cause of death was a placental abruption, or that the baby likely could have been delivered without complications if a Cโ€”section had been performed at Lakes Hospital. The plaintiffs claim the defendants were negligent in failing to recognize Ms. Heimlicher's need for an emergency delivery, and in transferring her to the Sioux Valley Hospital without first determining that her medical condition and the medical condition of the unborn child were not likely to deteriorate materially during the transfer. The plaintiffs also claim Lakes Hospital was liable under the Emergency Medical Treatment and Active Labor Act ("EMTALA"), 42 U.S.C. ง 1395dd, because Dr. Steele ordered Ms. Heimlicher's transfer to Sioux Valley Hospital even though he knew she had an emergency medical condition that was not stabilized. Trial commenced before a jury on March 2, 2009, and after eight days of trial, the case was submitted. The jury returned a verdict in favor of the plaintiffs and against both defendants on the plaintiffs' negligence claim, and against Lakes Hospital on the plaintiffs' EMTALA claims. The jury found Dr. Steele to be 30% at fault, and Lakes Hospital to be 70% at fault. The jury awarded Ms. Heimlicher damages of $307,800 against Dr. Steele and $718,200 against Lakes Hospital, and awarded Mr. Heimlicher damages of $205,200 against Dr. Steele and $478,800 against Lakes Hospital. The total amount of damages awarded to the plaintiffs was $1,710,000. The defendants have filed five post-trial motions. Dr. Steele filed a motion for new trial and renewed motion for judgment as a matter of law, Doc. No. 136, and a motion to amend judgment, Doc. No. 139. Lakes Hospital filed a renewed motion for judgment as a matter of law, Doc. No. 132; a motion for new trial, Doc. No. 133, ง XIII, joining in Dr. Steele's motion for new trial, and a motion to amend judgment, Doc. No. 134. Dr. Steele joined in Lakes Hospital's motion to amend judgment, Doc. No. 137. All of the defendants' motions have been resisted by the plaintiffs. Doc. Nos. 142, 149, 150, 154, & 155. The defendants filed reply briefs. Doc. Nos. 156, 158. The court held telephonic arguments on the motions on May 13, 2009, and the motions are now fully submitted. II. DESCRIPTION OF ISSUES RAISED IN THE MOTIONS The defendants have raised a number of interrelated arguments in their various motions, and each defendant has joined in certain arguments raised by the other defendant. To address these arguments in an orderly manner, the court will break down the issues as follows: (A) Does a physician's certification under EMTALA absolve a hospital from liability under EMTALA for transferring a patient to another hospital? (Doc. No. 132, ง II; Doc. No. 133, งง I & III; Doc. No. 133-2, pp. 3-4; Doc. No. 158, pp. 2-4); (B) Did the court err in placing the burden of proof on the certification defense on Lakes Hospital? (Doc. No. 133-2, p. 4); (C) Did the court err in instructing the jury that Dr. Steele could be found negligent for transferring Ms. Heimlicher? (Doc. No. 136, ง I, ถ 2; Doc. No. 136-2, p. 5); (D) Did Lakes Hospital have a right or duty to diagnose or treat Ms. Heimlicher? (Doc. No. 133, ง VI; Doc. No. 133-2, p. 3; Doc. No. 158, pp. 1-2); (E) Are common law claims against a hospital based on negligent transfer *897 preempted by EMTALA? (Doc. No. 132, ง III; Doc. No. 133, ง II; Doc. No. 133-2, p. 4; Doc. No. 158, pp. 4-5); (F) Did the court err in not submitting Ms. Heimlicher's comparative fault to the jury? (Doc. No. 133, ง IX(D); Doc. No. 133-2, p. 7; Doc. No. 136, ง I, ถ 3; Doc. No. 136-2, pp. 3-4; Doc. No. 156, ถถ 2-3); (G) Did the court, in giving Jury Instruction No. 17, mislead the jury into assigning Lakes Hospital double liability? (Doc. No. 158, pp. 1-2); (H) Did the court err in allowing plaintiffs' counsel to ask expert witnesses questions based on the jury instructions? (Doc. No. 133, ง VIII; Doc. No. 133-2, pp. 5-6; Doc. No. 136, ง I, ถ 1); (I) Did the court err in permitting the jury to treat Dr. Low as an agent of Lakes Hospital? (Doc. No. 133, ง V); (J) Did the court erroneously allow evidence of grief to be presented to the jury? (Doc. No. 133, ง IX(A); Doc. No. 133-2, p. 6; Doc. No. 136, ง I, ถ 1; Doc. No. 136-2, pp. 6-7); (K) Did the court err in allowing photographs of the fetus to be presented to the jury? (Doc. No. 133, ง IX(B); Doc. No. 133-2, pp. 6-7; Doc. No. 136, ง I, ถ 1; Doc. No. 136-2, pp. 4-5); (L) Did the court err in allowing Dr. Leavy to testify to matters outside the designation of his testimony? (Doc. No. 133, ง IX(C); Doc. No. 136, ง I, ถ 1); (M) Did the plaintiffs waive their EMTALA claim by not submitting to the court timely requested jury instructions on the claim? (Doc. No. 133, ง IV); (N) Did the court err in submitting revised damages instructions to the jury? (Doc. No. 133, ง VII; Doc. No. 136, ง I, ถ 1); (O) Did the court err in reading the instructions to the jury before any evidence was received? (Doc. No. 133-2, pp. 2-3); (P) Did the court err in failing to grant the various motions for mistrial asserted by the defendants throughout the trial? (Doc. No. 136, ง I, ถ 4; Doc. No. 133, ง XIII); and (Q) Was the verdict irrational, arbitrary, excessive, or unjust? (Doc. No. 133, งง X, XI, & XII; Doc. No. 134; Doc. No. 136, ง I, ถ 1; Doc. No. 136-2, pp. 1-3; Doc. No. 139). III. STANDARDS FOR CONSIDERING POST-TRIAL MOTIONS A. Motions for Judgment as a Matter of Law The defendants' renewed motions for judgment as a matter of law were filed under Federal Rule of Civil Procedure 50, which provides: (a) Judgment as a Matter of Law. (1) In General. If a party has been fully heard on an issue during a jury trial and the court finds that a reasonable jury would not have a legally sufficient evidentiary basis to find for the party on that issue, the court may: (A) resolve the issue against the party; and (B) grant a motion for judgment as a matter of law against the party on a claim or defense that, under the controlling law, can be maintained or defeated only with a favorable finding on that issue. (2) Motion. A motion for judgment as a matter of law may be made at any time before the case is submitted to *898 the jury. The motion must specify the judgment sought and the law and facts that entitle the movant to the judgment. (b) Renewing the Motion After Trial; Alternative Motion for a New Trial. If the court does not grant a motion for judgment as a matter of law made under Rule 50(a), the court is considered to have submitted the action to the jury subject to the court's later deciding the legal questions raised by the motion. No later than 10 days after the entry of judgmentโ€”or if the motion addresses a jury issue not decided by a verdict, no later than 10 days after the jury was dischargedโ€”the movant may file a renewed motion for judgment as a matter of law and may include an alternative or joint request for a new trial under Rule 59. In ruling on the renewed motion, the court may: (1) allow judgment on the verdict, if the jury returned a verdict; (2) order a new trial; or (3) direct the entry of judgment as a matter of law. Fed.R.Civ.P. 50(a) & (b). In considering a motion or renewed motion for judgment as a matter of law filed under Rule 50, the court must "decide the record contains evidence sufficient to support the jury's verdict." Children's Broad. Corp. v. Walt Disney Co., 357 F.3d 860, 863 (8th Cir.2004). In doing so, the court "`must examine the sufficiency of the evidence in the light most favorable to [the prevailing parties] and view all inferences in [their] favor.'" Id. (quoting Racicky v. Farmland Indus., Inc., 328 F.3d 389, 393 (8th Cir.2003)). "Judgment as a matter of law is appropriate only when all of the evidence points one way and is susceptible of no reasonable inference sustaining [the prevailing party's] position." Id. See Foster v. Time Warner Ent. Co., 250 F.3d 1189, 1194 (8th Cir. 2001) ("Judgment as a matter of law is proper only when there is a complete absence of probative facts to support the conclusion reached so that no reasonable juror could have found for the nonmoving party." Internal quotation marks, citation omitted.); Stevenson v. Union Pacific R. Co., 354 F.3d 739, 744 (8th Cir.2004) (same). B. Motions for New Trial The defendants' motions for new trial were filed under Federal Rule of Civil Procedure 59(a), which provides, "The court may, on motion, grant a new trial on all or some of the issuesโ€”and to any party... after a jury trial, for any reason for which a new trial has heretofore been granted in an action at law in federal court." Fed.R.Civ.P. 59(a)(1)(A). Rule 59(a) has been explained as follows: In evaluating a motion for a new trial pursuant to Rule 59(a), "[t]he key question is whether a new trial should [be] granted to avoid a miscarriage of justice." McKnight v. Johnson Controls, Inc., 36 F.3d 1396, 1400 (8th Cir.1994). A new trial is appropriate when the trial, through a verdict against the weight of the evidence or legal errors at trial, resulted in a miscarriage of justice. White v. Pence, 961 F.2d 776, 780 (8th Cir.1992). However, legal errors must adversely and substantially impact the moving party's substantial rights to warrant relief. Fed.R.Civ.P. 61. Consistent with the plain language of Rule 59(a), the court may grant a partial new trial solely on the issue of damages. Fed.R.Civ.P. 59(a)(1)(A); see, e.g., Powell v. TPI Petro., Inc., 510 F.3d 818, 824-25 (8th Cir.2007) (remanding for partial new trial on damages). For example, a partial new trial on the issue of damages is appropriate when the jury's verdict is so grossly inadequate as to *899 shock the conscience or to constitute a plain injustice. Taylor v. Howe, 280 F.3d 1210, 1211 (8th Cir.2002); First State Bank of Floodwood v. Jubie, 86 F.3d 755, 759 (8th Cir.1996). "Each case must be reviewed within the framework of its distinctive facts." Wilmington v. J.I. Case Co., 793 F.2d 909, 922 (8th Cir.1986) (citing Hollins v. Powell, 773 F.2d 191, 197 (8th Cir.1985)). "In determining whether or not to grant a new trial, a district judge is not free to reweigh the evidence and set aside the jury verdict merely because the jury could have drawn different inferences or conclusions or because judges feel that other results are more reasonable." King v. Davis, 980 F.2d 1236, 1237 (8th Cir.1992) (citing White, 961 F.2d at 780). "[T]he `trial judge may not usurp the function of a jury ... [which] weighs the evidence and credibility of witnesses.'" White, 961 F.2d at 780 (quoting McGee v. S. Pemiscot Sch. Dist., 712 F.2d 339, 344 (8th Cir.1983)). "Instead, a district judge must carefully weigh and balance the evidence and articulate reasons supporting the judge's view that a miscarriage of justice has occurred." King, 980 F.2d at 1237. "The authority to grant a new trial ... is confided almost entirely to the exercise of discretion on the part of the trial court." Allied Chem. Corp. v. Daiflon, Inc., 449 U.S. 33, 36, 101 S.Ct. 188, 66 L.Ed.2d 193 (1980). On the issue of damages, the propriety of the amount of a verdict "is basically, and should be, a matter for the trial court which has had the benefit of hearing the testimony and of observing the demeanor of witnesses and which knows the community and its standards....'" Wilmington, 793 F.2d at 922 (quoting Solomon Dehydrating Co. v. Guyton, 294 F.2d 439, 447-48 (8th Cir.1961)). "[T]he assessment of damages is especially within the jury's sound discretion when the jury must determine how to compensate an individual for an injury not easily calculable in economic terms." Stafford [v. Neurological Med., Inc.], 811 F.2d [470,] 475 [(8th Cir. 1987)]; see also EEOC v. Convergys Customer Mgmt. Group, Inc., 491 F.3d 790, 798 (8th Cir.2007) (same). McCabe v. Mais, 602 F.Supp.2d 1025, 1029-30 (N.D.Iowa 2008) (Reade, C.J.). C. Motions to Amend Judgment The defendants' motions to amend judgment were filed under Federal Rule of Civil Procedure 59(e), which provides simply that a party may file a motion to alter or amend a judgment not later than ten days after the entry of judgment. Rule 59(e) has been explained as follows: The Eighth Circuit Court of Appeals has filled out this rather vague authorization for a new trial by explaining that "`[t]he key question is whether a new trial should [be] granted to avoid a miscarriage of justice.'" Belk [v. City of Eldon], 228 F.3d [872,] 878 [(8th Cir. 2000)] (quoting McKnight ex rel Ludwig v. Johnson Controls, 36 F.3d 1396, 1400 (8th Cir.1994)). Thus, "[a] new trial is appropriate where the verdict is against the clear weight of the evidence, clearly excessive, or the result of passion or prejudice." MacGregor v. Mallinckrodt, Inc., 373 F.3d 923, 930 (8th Cir. 2004) (citing Ouachita Nat'l Bank v. Tosco Corp., 686 F.2d 1291, 1294 (8th Cir.1982)). In White v. Pence, 961 F.2d 776 (8th Cir.1992), the Eighth Circuit observed: With respect to motions for new trial on the question of whether the verdict is against the weight of the evidence, we have stated: "In determining whether a verdict is against the weight of the evidence, the trial court can rely on its own reading of the evidenceโ€”it can `weigh the evidence, disbelieve witnesses, and grant a new trial even where there is substantial *900 evidence to sustain a verdict.'" Ryan v. McDonough Power Equip., 734 F.2d 385, 387 (8th Cir.1984) (citation omitted).... These cases establish the fundamental process or methodology to be applied by the district court in considering new trial motions and are in contrast to those procedures governing motions for judgment as a matter of law. Id. at 780. Thus, the court in Pence concluded the district court may grant a new trial on the basis that the verdict is against the weight of the evidence, if the first trial results in a miscarriage of justice. Id.; see also Ogden [v. Wax Works, Inc.], 214 F.3d [999,] 1010 [(8th Cir.2000)] (stating that a motion for new trial should only be granted if the jury's verdict was against the great weight of the evidence so as to constitute a miscarriage of justice) (citation omitted); Shaffer v. Wilkes, 65 F.3d 115, 117 (8th Cir.1995) (citing Pence for this standard); Nelson [v. Boatmen's Bancshares, Inc.], 26 F.3d [796,] 800 [(8th Cir.1994)] (stating "[a] motion for new trial should be granted if, after weighing the evidence, a district court concludes that the jury's verdict amounts to a miscarriage of justice."); Jacobs Mfg. Co. v. Sam Brown Co., 19 F.3d 1259, 1266 (8th Cir.1994) (observing that the correct standard for new trial is the conclusion that "the [jury's] verdict was against the `great weight' of the evidence, so that granting a new trial would prevent a miscarriage of justice."). While a ruling on a motion for judgment as a matter of law is reviewed de novo, a motion for new trial is reviewed for "clear abuse of discretion." See Belk, 228 F.3d at 878. Indeed, "`[w]hen the basis of the motion for a new trial is that the jury's verdict is against the weight of the evidence, the district court's denial of the motion is virtually unassailable on appeal.'" Children's Broad. Corp. [v. Walt Disney Co.], 357 F.3d [860,] 867 [(8th Cir. 2004)] (quoting Jones v. Swanson, 341 F.3d 723, 732 (8th Cir.2003) (internal quotations omitted)). Lopez v. Aramark Uniform & Career Apparel, Inc., 426 F.Supp.2d 914, 973-74 (N.D.Iowa 2006) (Bennett, J.). IV. ANALYSIS OF ISSUES RAISED IN THE MOTIONS A. Does a Physician's Certification Absolve a Hospital from Liability under EMTALA for Transferring a Patient to Another Hospital? In both its renewed motion for judgment as a matter of law and its motion for new trial, Lakes Hospital argues that because Dr. Steele signed a "Consent for Transfer" form authorizing Lakes Hospital to transfer Ms. Heimlicher to Sioux Valley Hospital, Lakes Hospital cannot be held liable under EMTALA. See Joint Ex. 50, p. 15, a copy of which is attached to this ruling. The court addressed this issue preliminarily in its ruling on Lakes Hospital's second motion for summary judgment (see Heimlicher v. Steele, 2007 WL 2384374 at *8-10 (N.D.Iowa, Aug.17, 2007)), but will revisit the issue now that the case has been fully tried. Lakes Hospital raises this issue in both its Rule 50 motion and its Rule 59(a) motion, so the court will consider the issue under the standards applicable to both rules. The court will decide whether the record contains sufficient evidence to support the jury's verdict, examining the sufficiency of the evidence in the light most favorable to the plaintiffs and viewing all inferences in their favor. The court also will examine the record to determine whether there has been a miscarriage of justice, although the court will not reweigh the evidence or otherwise usurp the function of the jury. EMTALA ("the Act"), 42 U.S.C. ง 1395dd (commonly known as the "Anti-Patient *901 Dumping" Act), was enacted into law in 1985. "[T]he purpose of the statute was to address a distinct and rather narrow problemโ€”the `dumping' of uninsured, underinsured, or indigent patients by hospitals who did not want to treat them." Summers v. Baptist Med. Ctr. Arkadelphia, 91 F.3d 1132, 1136 (8th Cir.1996) (en banc). "A patient is `dumped' when he or she is shunted off by one hospital to another, the second one being, for example, a so-called `charity institution.'" Id. Despite this "purpose," the statute applies to any individual, whether insured or not, and the fact that a hospital's motivation in a particular case was not to dump an uninsured or indigent patient does not defeat a claim under EMTALA. Id., 91 F.3d at 1137. Section (a) of EMTALA provides: In the case of a hospital that has a hospital emergency department, if any individual (whether or not eligible for benefits under this subchapter) comes to the emergency department and a request is made on the individual's behalf for examination or treatment for a medical condition, the hospital must provide for an appropriate medical screening examination within the capability of the hospital's emergency department, including ancillary services routinely available to the emergency department, to determine whether or not an emergency medical condition (within the meaning of subsection (e)(1) of this section) exists. Under this provision, if an individual comes to a hospital emergency room for examination or treatment, the hospital must provide an appropriate medical screening examination, within the hospital's capabilities, to determine "whether or not an emergency medical condition ... exists." However, EMTALA does not guarantee a proper diagnosis or provide a federal remedy for medical negligence. Summers, 91 F.3d at 1137. "EMTALA is not a federal malpractice statute and it does not set a national emergency health care standard; claims of misdiagnosis or inadequate treatment are left to the state malpractice arena." Id. An "inappropriate" screening examination "is one that has a disparate impact on the plaintiff." Id., 91 F.3d at 1138. As the Summers court explained: Patients are entitled under EMTALA, not to correct or non-negligent treatment in all circumstances, but to be treated as other similarly situated patients are treated, within the hospital's capabilities. It is up to the hospital itself to determine what its screening procedures will be. Having done so, it must apply them alike to all patients. Id. A faulty screening, as opposed to disparate screening or refusing to screen at all, does not contravene the statute. Id., 91 F.3d at 1139. If, after screening a patient, a hospital determines that the patient has an "emergency medical condition," the hospital must either (A) provide treatment "to stabilize" the medical condition, or (B) transfer the individual to another hospital. See EMTALA งง (b)(1)(A) & (B). For a pregnant woman, an "emergency medical condition" is either (A) a medical condition manifesting itself by acute symptoms of sufficient severity (including severe pain) such that the absence of immediate medical attention could reasonably be expected to result in placing the health of the woman or her unborn child in serious jeopardy; or (B) if she is having contractions, where there is inadequate time to effect her safe transfer to another hospital before delivery, or where that transfer may pose a threat to the health or safety of the woman or the unborn child. See EMTALA งง (e)(1)(A) & (B). The term "to stabilize" means, "with respect to an emergency medical condition described in paragraph *902 [(e)](1)(A), to provide such medical treatment of the condition as may be necessary to assure, within reasonable medical probability, that no material deterioration of the condition is likely to result from or occur during the transfer of the individual from a facility, or, with respect to an emergency medical condition described in paragraph [(e) ](1)(B), to deliver (including the placenta)." See EMTALA ง (e)(3)(A). A hospital has the duty to stabilize a patient or effect a proper transfer only if the hospital has actual knowledge that the patient has an emergency medical condition. Summers, 91 F.3d at 1140; Baber v. Hospital Corp. of America, 977 F.2d 872, 883 (4th Cir.1992) ("[T]he plain language of the statute dictates a standard requiring actual knowledge of the emergency medical condition by the hospital staff"); see Vickers v. Nash Gen. Hosp., Inc., 78 F.3d 139, 145 (4th Cir.1996) (EMTALA's stabilization and transfer requirements apply after the hospital determines that the patient has an emergency medical condition); Urban v. King, 43 F.3d 523, 526 (10th Cir.1994) (same). It is not enough that the hospital "should have known" the patient was suffering from an emergency medical condition; the hospital has to have actual knowledge. Baber, 977 F.2d at 883; see also Sauve v. Methodist Hosp., 33 Fed.Appx. 248, 248 (8th Cir. 2002). "A reasonableness standard does not apply." Bryant v. Adventist Health System/West, 289 F.3d 1162, 1166 (9th Cir. 2002). "The Act does not hold hospitals accountable for failing to stabilize conditions of which they are not aware, or even conditions of which they should have been aware." Baber, 977 F.2d at 883. If a hospital performs an appropriate screening of a patient and does not discover an emergency medical condition, then EMTALA would not forbid or regulate the transfer of the patient to another hospital. If a hospital does discover an emergency medical condition during screening, then the hospital can transfer the patient to another hospital after the condition has been stabilized. See EMTALA ง (c)(1). Even if the emergency medical condition has not been stabilized, the hospital can transfer the patient to another hospital if either (i) the individual "in writing requests transfer to another medical facility"; or (ii) a physician signs a certification "that based upon the information available at the time of transfer, the medical benefits reasonably expected from appropriate medical treatment at another medical facility outweigh the increased risks to the individual and, in the case of labor, to the unborn child from effecting the transfer." EMTALA ง (c)(1)(A)(i) & (ii); see Jury Instruction No. 18.[2] As the court held in Baber. EMTALA's transfer requirements do not apply unless the hospital actually determines that the patient suffers from an emergency medical condition.... Accordingly, to recover for violations of EMTALA's transfer provisions, the plaintiff must present evidence that (1) the patient had an emergency medical condition; (2) the hospital actually knew of that condition; (3) the patient was not stabilized before being transferred; and (4) prior to transfer of an unstable patient, the transferring hospital did not obtain the proper consent or follow the appropriate certification and transfer procedures.[3] Baber, 977 F.2d at 883. Applying these principles to this case, for the Heimlichers to prove their EMTALA *903 claims against Lakes Hospital, they first had to prove all of the following: (1) Ms. Heimlicher came to Lakes Hospital and requested examination or treatment for a medical condition; (2) she had an emergency medical condition; and (3) Lakes Hospital had actual knowledge that she had an emergency medical condition. None of these matters was seriously disputed at trial. Ms. Heimlicher was brought to Lakes Hospital by ambulance for examination and treatment of vaginal bleeding, pain in her abdomen, and premature uterine contractions, all serious symptoms in a woman who is 34 weeks pregnant. It was obvious that her condition fell within the definition of an "emergency medical condition" under either subsection (e)(1)(A) or subsection (e)(1)(B) of the Act. In section I, paragraph B of Dr. Steele's "Consent For Transfer" form, he checked the box stating that Ms. Heimlicher was a "patient with an emergency medical condition" See Joint Ex. 50, p. 15 (emphasis added). Because Dr. Steele signed the form, and Jennifer Helle, the Lakes Hospital nurse who was attending Ms. Heimlicher, witnessed the form (see Id., ง II.D.2.), they both obviously had actual knowledge that Ms. Heimlicher had an emergency medical condition. As discussed in Section IV.D. of this ruling, infra, their knowledge was imputed to Lakes Hospital. See Jury Instruction No. 17.[4] Under these circumstances, Lakes Hospital was prohibited by the Act from transferring Ms. Heimlicher to another hospital absent at least one of the following three justifications: (1) her emergency medical condition was stabilized (EMTALA ง (c)(1)); (2) her emergency medical condition was not stabilized, but she requested transfer to another hospital (EMTALA ง (c)(l)(A)(i)); or (3) her emergency medical condition was not stabilized, but a physician signed a certification that the medical benefits reasonably expected from medical treatment at another hospital outweighed the increased risks to her and her unborn child from the transfer (EMTALA ง (c)(l)(A)(ii)). The court will examine each of these possible justifications for Ms. Heimlicher's transfer in light of the evidence in this case. 1. Was Ms. Heimlicher's emergency medical condition stabilized before she was transferred to Sioux Valley Hospital? The first possible justification for transferring Ms. Heimlicher was that her emergency medical condition had been stabilized before the transfer. The evidence does not support such a conclusion. While in the care of Lakes Hospital and its agents, Ms. Heimlicher was having contractions and was suffering from acute symptoms, including profuse vaginal bleeding and severe pain. The absence of immediate medical attention reasonably could have been expected to place her health and the health of her unborn child in serious jeopardy, and subjecting her to a 100-mile ambulance ride through a snow storm posed a clear threat to the health and safety of the mother and the fetus. Under these circumstances, Ms. Heimlicher's condition could have been stabilized in only one of two ways. First, Lakes Hospital could have provided the medical treatment necessary to assure, within reasonable medical probability, that no material deterioration of her condition was likely to result from, or occur during, the transfer. This did not happen. The only treatment given to Ms. Heimlicher was medication to stop her contractions, which did not address *904 the possible causes of her pain or vaginal bleeding, such as an abrupting placenta or a ruptured uterus. The treatment provided no assurances that her condition would not deteriorate during the ambulance ride. Second, Lakes Hospital could have delivered the child. See EMTALA ง (e)(3)(A). The second option was not even considered. On the "Consent For Transfer" form, Dr. Steele marked the following box to certify that Ms. Heimlicher's condition had been stabilized: "This patient with an emergency medical condition has been stabilized such that, within a reasonable degree of medical certainty, no material deterioration of this patient's emergency medical condition is likely to result from or occur during transfer." See Joint Ex. 50, p. 15, ง I, ถ B. The certification is both curious and troublesome. While at Lakes Hospital, Ms. Heimlicher continued to have contractions, pain, and vaginal bleeding. Dr. Steele knew these symptoms were continuing, and he knew that likely explanations for the symptoms were an abrupting placenta or a ruptured uterus, both of which posed a serious risk of material deterioration in Ms. Heimlicher's condition during transfer, and the possibility of death to the mother and the fetus. Ms. Heimlicher's condition dramatically worsened within a few minutes after she was placed in the ambulance. At that time, she had not yet been transferred to Sioux Valley Hospital, and she was still in the care of Lakes Hospital and its agents. The medical records establish that throughout the ambulance ride, it was increasingly apparent that her health and the health of her unborn child were in serious jeopardy, and that immediate medical treatment was necessary to address the deteriorating condition. Before the ambulance was more than a few miles from Lakes Hospital, it should have been obvious to Nurse Helle that Ms. Heimlicher was far from stable. EMTALA's requirement that the patient be stabilized before transfer did not disappear simply because the ambulance had started on its journey. The only way to stabilize Ms. Heimlicher's condition was to deliver the baby, and this was not done. Dr. Steele marked the box on the form for certifying that Ms. Heimlicher's emergency medical condition "has been stabilized," and did not mark the box on the form for certifying that the patient's emergency medical condition "has not been stabilized." See Joint Ex. 50, p. 15, ง I, ถ C. Significantly, he then completed the part of the form for justifying the transfer of an unstabilized patient. See EMTALA ง (c)(l)(A)(ii). If Dr. Steele thought Ms. Heimlicher's condition had, in fact, been stabilized, this part of the form should have been left blank. The fact that Dr. Steele completed this part of the form suggests that when he signed the form, he knew her condition had not, in reality, been stabilized. The jury found that Ms. Heimlicher's emergency medical condition had not been stabilized at the time of transfer, and the evidence fully supports this finding. Therefore, the plaintiffs proved that the first possible justification for transferring her to another hospital did not exist. 2. Did Ms. Heimlicher make a written request to be transferred to Sioux Valley Hospital? The second possible justification for transfer under EMTALA was that Ms. Heimlicher's emergency medical condition had not been stabilized, but she requested, in writing, a transfer to another medical facility. The record establishes that she did not make such a request, although she did sign the "Consent For Transfer" form. In fact, Ms. Heimlicher signed the form in blank and on the wrong lineโ€”where a *905 person would sign the form on behalf of a patient, not where the patient would sign. Later, someone placed an arrow from her signature to the correct line on the form, and checked the box "consent to transfer." Ms. Heimlicher had the option of marking a box on the form to request a transfer, but she did not do so. Compare Joint Ex. 50, p. 15, with Pl. Ex. 5.[5] Under subsection (c)(1)(A)(i) of the Act, a written request for transfer authorizes a hospital to transfer a patient with an emergency medical condition that has not been stabilized to another hospital. A consent to transfer does not give a hospital this authority. Ms. Heimlicher never requested transfer from Lakes Hospital, so the second possible justification for transferring her to another hospital did not exist. 3. Did Dr. Steele properly certify that the benefits from the transfer outweighed the risks? The third possible justification for transfer under EMTALA was that Ms. Heimlicher's emergency medical condition had not been stabilized, but a physician signed a proper certification authorizing the transfer. Lakes Hospital states it "may transfer an unstabilized patient without incurring liability where a physician certifies that, based upon the information available at the time of transfer, the medical benefits reasonably expected from the provision of appropriate medical treatment at another medical facility outweigh the increased risk to the individual, and in the case of labor, to the unborn child, from effecting the transfer." Doc. No. 132-2, p. 2 (citing EMTALA ง (c)(l)(A)(ii)). The Hospital notes that Dr. Steele provided such a certification when he signed the "Consent For Transfer" form (Joint Ex. 50, p. 15). According to the Hospital, it "did not have an independent duty to determine the patient's medical condition because it was entitled to rely on the certification of a physician." The Hospital maintains that the jury should not have been permitted to look beyond the certification form itself, and argues the court erred in instructing the jury otherwise. Doc. No. 133-2, pp. 4-5; see Jury Instruction No. 19, ถ 3 (requiring the certification to be "reasonable").[6] The Hospital argues the form provides it with a complete defense to the plaintiffs' EMTALA claim. The plaintiffs respond by arguing that the "Consent For Transfer" form signed by Dr. Steele was seriously deficient, and therefore does not absolve Lakes Hospital from liability under EMTALA. The question presented to the jury at trial was whether, prior to Ms. Heimlicher's transfer, Lakes Hospital "follow[ed] the appropriate certification ... procedure." Baber, 977 F.2d at 883. The elements of the "certification" defense were described to the jury in Jury Instruction No. 20. To prove this defense, Lakes Hospital was required to prove (1) a physician who was acting as its agent or employee signed a certification that the medical benefits reasonably expected from the transfer of Ms. Heimlicher to the Sioux Valley Hospital outweighed the increased risks from the transfer to her and the unborn child, and (2) before signing the certification, the physician deliberated and weighed the medical risks and benefits of the transfer, and made a reasonable determination, based on the information available to him at the time, that the medical benefits reasonably expected from the transfer outweighed the increased risks *906 from the transfer to Ms. Heimlicher and the unborn child. There is no dispute that Dr. Steele signed a "Consent For Transfer" form. On the form, he certified as follows: "Based on the expected benefits of delivery on Cโ€”section of premature fetus 34 weeks and foreseeable risks of more bleeding, painful contractions to this patient, and based upon the information available to me at the time of this patient's transfer, I believe the medical benefits reasonably expected from the provision of appropriate medical treatment at another facility outweigh the increased risks to the patient's (and/or fetus') medical condition from effecting transfer." Joint Ex. 50, p. 15 (emphasis in original). There is, however, some question about whether or not a defense based on Dr. Steele's certification of "benefits versus risks" is even available to Lakes Hospital. On the Consent For Transfer form, Dr. Steele marked the box to certify that Ms. Heimlicher had been stabilized, and left unmarked the box that would have certified Ms. Heimlicher's emergency medical condition had not been stabilized. Compare ง I, ถ B with ง I, ถ C, on Joint Ex. 50. The certification of "benefits versus risks" under EMTALA subsection (c)(l)(A)(ii) applies to unstabilized patients, not to stabilized ones. Nevertheless, because the evidence establishes that Ms. Heimlicher was not, in fact, stabilized, the court will address Lakes Hospital's argument on this issue. Lakes Hospital cites Lopez-Soto v. Hawayek, 175 F.3d 170, 175-176 (1st Cir. 1999), in support of its position. In Lopez-Soto, the First Circuit Court of Appeals held that under EMTALA, the screening requirement is limited to emergency departments, but the stabilization requirement "unambiguously imposes certain duties on covered hospitals vis-a-vis any victim of a detected medical emergency, regardless of how that person enters the institution or where within the walls he may be when the hospital identifies the problem." Id., 175 F.3d at 173. On pages 175 to 176 of Lopez-Soto, the pages specifically cited in Lakes Hospital's brief (see Doc. No. 132-2, p. 2), the court made a passing reference to the certification process, but did not address any of the issues currently before this court. See Lopez-Soto, 175 F.3d at 176 ("Subsection (c) generally prohibits transfers of unstabilized patients unless ... a physician has certified that the medical benefits of an appropriate transfer outweigh the attendant risks, see [42 U.S.C.] ง 1395dd(c)(l)(A)(ii)."). The case is not helpful. Lakes Hospital also relies on Burditt v. United States Department of Health and Human Services, 934 F.2d 1362, 1371 (5th Cir.1991). The court in Burditt does provide some helpful analysis on this issue. The court held as follows: A hospital may violate [the certification] provision in four ways. First, before transfer, the hospital might fail to secure the required signature from the appropriate medical personnel on a certification form. But the statute requires more than a signature; it requires a signed certification. Thus, the hospital also violates the statute if the signer has not actually deliberated and weighed the medical risks and the medical benefits of transfer before executing the certification. FN9/ Likewise, the hospital fails to make the certification required by 42 U.S.C. ง 1395dd(c)(1)(A)(ii) if the signer makes an improper consideration a significant factor in the certification decision. [Footnote omitted.] Finally, a hospital violates the statute if the signer actually concludes in the weighing process that the medical risks outweigh the medical benefits of transfer, yet signs a certification that the opposite is true. FN11/ *907 FN9. In revising EMTALA, Congress has expressly provided that medical personnel must make a determination regarding medical risks and benefits, not just sign a paper stating as much. See 42 U.S.C.A. ง 1395dd(c)(1)(A)(iii) (West Supp.1991). .... FN11. Evidence that a signer was aware of certain medical risks and medical benefits before making a certification decision when that person claims not to have considered those risks and benefits may be used to prove this fourth class of violation under 42 U.S.C. ง 1395dd(c)(1)(A)(ii). Id., 934 F.2d at 1371. The court will review the record to see if a reasonable jury could have found that Lakes Hospital violated the certification provision of EMTALA in any of the ways identified in Burditt. There is no question that Dr. Steele signed the Consent for Transfer form, so the first potential violation identified in Burditt did not occur. There also is no evidence that he signed the form after reaching a conclusion that the medical risks actually outweighed the medical benefits of transfer. However, the evidence does suggest that Dr. Steele signed the form without actually deliberating and weighing the medical risks and benefits of the transfer, and he gave improper consideration to significant factors in the certification decision. On the form, Dr. Steele listed the expected benefits from the proposed transfer as "delivery on Cโ€”section of premature fetus 34 weeks." He listed the foreseeable risks as "more bleeding, painful contractions." The evidence establishes that these were not the true potential benefits and risks of transfer, and Dr. Steele was aware of this fact. The supposed benefit of "delivery on Cโ€”section" was not a benefit at all. Cโ€” sections were routinely performed at Lakes Hospital. There was no benefit from transferring Ms. Heimlicher to a hospital 100 miles away for a procedure that could have been performed without a transfer. The supposed expected benefit of better treatment for a premature baby delivered at 34 weeks also was not a true benefit. Although Sioux Valley Hospital had an advanced neonatal unit and Lakes Hospital did not, the fetus was beyond the age where complications from prematurity were likely. Lakes Hospital was completely capable of caring for a baby at 34 weeks or, if necessary, preparing the baby for transport to another hospital, such as Sioux Valley Hospital, after delivery. Thus, both of the "expected benefits" listed on the form were available at Lakes Hospital without the transfer. A reasonable jury could have found that Dr. Steele knew any expected benefits from the transfer were minimal. Dr. Steele listed the foreseeable risks of transfer as "more bleeding and painful contractions." Both of these "risks" were present regardless of whether or not Ms. Heimlicher was transferred. Dr. Steele was well aware of other serious increased risks of the transfer that he did not list on the form. His records show that when he was evaluating Ms. Heimlicher, he considered diagnoses of a ruptured uterus, placenta previa, and placenta abruptio, all serious, life-threatening conditions, and he specifically discussed these possibilities with Dr. Fiegen before the transfer. He knew that transferring a patient with any of these conditions presented a risk of death to the mother and fetus. He also knew that any of these diagnoses would have precluded any consideration of transfer, and would have required an immediate Cโ€”section. Although he had not ruled out a ruptured uterus or an abrupted placenta, neither of these risks was listed on the form. In Vargas v. Del Puerto Hospital, 98 F.3d 1202 (9th Cir.1996), the Ninth Circuit Court of Appeals considered an appeal from a bench trial of an EMTALA claim. *908 The plaintiff in that case, as here, argued that the certification was deficient because the certifying doctor failed to include an accurate summary of the benefits and risks. The court held as follows: The certification requirement is part of a statutory scheme with an overarching purpose of ensuring that patients ... receive adequate emergency medical care. Eberhardt v. City of Los Angeles, 62 F.3d 1253, 1255 (9th Cir.1995) (citing H.R.Rep. No. 241, 99th Cong., 1st Sess. (1986), reprinted in 1986 U.S.C.C.A.N. 726-27). The purpose of the certification requirement in particular is to ensure that a signatory physician adequately deliberates and weighs the medical risks and medical benefits of transfer before effecting such a transfer. Congress surely did not intend to limit the inquiry as to whether this deliberation process in fact occurred to an examination of the transfer certificate itself. While such a contemporaneous record may be the best evidence of what a physician was thinking at the time, we cannot accept the proposition that the only logical inference to be drawn from the absence of a written summary of the risks is that the risks were not considered in the transfer decision. Other factors might account for the absence of such a summary, such as the time-pressure inherent in emergency room decision-making. Although a contemporaneous record is certainly preferable, we believe it would undermine congressional intent to foreclose consideration of other evidence surrounding the transfer decision. See Romo v. Union Memorial Hosp., Inc., 878 F.Supp. 837, 844 (W.D.N.C.1995) (absence of summary of risk and benefits on transfer certificate does not create EMTALA liability as a matter of law, but creates a jury question as to whether risk/benefit analysis was properly made by physician). Vargas, 98 F.3d at 1205. The Vargas court held the hospital was not entitled to prevail simply because a doctor signed a certificate, and the fact-finder was not limited to consideration of only the transfer certificate, but could consider other factors as well. The court held that the ultimate question as to whether a proper risk/benefit analysis was made was an issue for the fact-finder at trial. Id.; see also Romo v. Union Memorial Hosp., Inc., 878 F.Supp. 837, 844 (W.D.N.C.1995) (absence of summary of risks and benefits on transfer certificate does not create EMTALA liability as a matter of law, but creates a jury question as to whether risk/benefit analysis was properly made by physician); cf. Cherukuri v. Shalala, 175 F.3d 446, 450 (6th Cir.1999) (question is whether doctor was "negligent" in transferring a patient when, under the circumstances, the doctor knew or should have known the benefits of transfer did not outweigh the risks). This court agrees with the Burditt holding that a doctor's certification "requires more than a signature." Burditt, 934 F.2d at 1371. A hospital is not entitled to the benefit of the certification defense under section (c)(1)(A)(ii) of the Act "if the signer has not actually deliberated and weighed the medical risks and the medical benefits of transfer before executing the certification," or "if the signer makes an improper consideration a significant factor in the certification decision." Id. The evidence establishes that Dr. Steele did not deliberate and weigh the medical risks and benefits of the transfer, and he did not make a reasonable determination, based on the information available to him at the time, that the medical benefits reasonably expected from the transfer outweighed the foreseeable risks from the *909 transfer to Ms. Heimlicher and her unborn child. See Jury Instruction No. 20, ถ 2. By justifying the transfer with nonexistent "benefits" and "risks," and ignoring the true foreseeable risks of the transfer, Dr. Steele gave improper consideration to significant factors in the certification decision. See EMTALA ง (c)(1)(A)(ii). He over-valued minimal or insignificant expected benefits, and he ignored serious foreseeable risks. This invalidated his certification. Thus, the third possible justification for transferring Ms. Heimlicher to another hospital did not exist. To the extent Lakes Hospital is arguing it is not responsible for the acts or omissions of a doctor who signs an EMTALA certification form, the argument does not apply here. This is not a case where the doctor signing the form was an independent contractor, with no agency or employment relationship with the Hospital. Here, the doctor was an agent of Lakes Hospital, and the Hospital acted through him. In this circumstance, Lakes Hospital is liable for his acts and omissions. See discussion in Section IV.D. of this ruling, infra; see also Jury Instruction No. 17. Lakes Hospital's renewed motion for judgment as a matter of law and its motion for new trial on this ground are denied. B. Did the Court Err in Placing the Burden of Proof on the Certification Defense on Lakes Hospital? Lakes Hospital argues, "Instruction No. 20 relating to the certification defense, was legally erroneous because it placed the burden of proof upon the hospital to prove that the medical judgment of the physician who certified that the benefits of transfer exceeded the risk, was reasonable when the hospital had no such duty under EMTALA as the hospital was entitled to rely upon the medical judgment of a physician." Doc. No. 133-2, p. 4. Lakes Hospital cites no authorities in support of this argument. Generally, as explained in Jury Instruction No. 5, "The obligation to prove a fact, or `the burden of proof,' is upon the party whose claim depends upon that fact." See Jenson v. Eveleth Taconite Co., 130 F.3d 1287, 1293 (8th Cir.1997) ("It is fundamental that a party pleading a claim or defense has the burden of proof to establish that claim or defense") (citing Fed.R.Civ.P. 8 & 9). Because Lakes Hospital asserted the certification defense, it had the burden of proving the defense. Whatever the merits of this argument, it was not raised at trial, so it has been waived. See Fed.R.Civ.P. 51(d)(1)(A) (party may assert "error in an instruction actually given, if that party properly objected") (emphasis added); Doyne v. Union Electric Co., 953 F.2d 447, 450 (8th Cir. 1992) (Rule 51 requires litigants to raise timely objections to instructions to afford trial court an opportunity to cure a defective instruction and to prevent litigants from covertly relying on the error in order to ensure a new trial in the event of an adverse verdict); see also Dupre v. Fru-Con Eng'g, Inc., 112 F.3d 329, 334 (8th Cir.1997) (making objections "on the record" entails not only stating the objection, but also stating the specific grounds for that objection); Cincinnati Ins. Co. v. Bluewood, Inc., 560 F.3d 798, 805 (8th Cir.2009) (same). In any event, the evidence discussed in Section IV. A. of this ruling, supra, firmly establishes that the certification signed by Dr. Steele was inappropriate, so any error in the instruction was harmless. Rush v. Smith, 56 F.3d 918, 922 (8th Cir.1995) (verdict should be reversed only if error prejudices the substantial rights of a party and would result in a miscarriage of justice if left uncorrected). *910 Lakes Hospital's motion for new trial on this ground is denied. C. Did the Court Err in Instructing the Jury on Dr. Steele's Negligence? Dr. Steele argues the court erred in allowing the jury to find him negligent in ordering Ms. Heimlicher's transfer from Lakes Hospital to Sioux Valley Hospital. Doc. No. 136, ง I, ถ 2. He states the following in his brief: In Jury Instruction No. 15, the court instructed the jury that it could find Dr. Steele was negligent in "transferring Ms. Heimlicher to Sioux Valley Hospital without first determining that her medical condition and the medical condition of the unborn child were not likely to materially deteriorate during the transfer." The language utilized in this instruction appears to have been drawn from the definitions of the terms "to stabilize" and "stabilized" in EMTALA, 42 U.S.C. ง 1395dd(e)(3)(A) and (B). The use of this language improperly injected an inapplicable statutory standard into the common law negligence equation. Doc. No. 136-2, p. 5. Dr. Steele argues that because a claim cannot be brought against a doctor under EMTALA,[7] the cause of action described in Jury Instruction No. 15[8] also cannot be brought against him. This argument assumes that because there is a potential cause of action under EMTALA against Lakes Hospital, a common law claim of negligence arising out of the same facts cannot be pursued against Dr. Steele. Dr. Steele has cited no authorities to support this argument. A doctor commits malpractice if he commits an affirmative act of negligence or if his actions demonstrate either a lack of skill or care, or failure to give careful and proper attention to his patient. Lagerpusch v. Lindley, 253 Iowa 1033, 1037, 115 N.W.2d 207, 210 (1962); see Jury Instruction No. 13.[9] To establish a prima facie case of medical malpractice, a plaintiff must produce evidence: (1) establishing the applicable standard of care, (2) demonstrating a violation of this standard, and (3) developing a causal relationship between the violation and the injury sustained. Oswald v. LeGrand, 453 N.W.2d 634, 635 (Iowa 1990). As the Iowa Supreme Court held in Peppmeier v. Murphy, 708 N.W.2d 57 (Iowa 2005), To establish a prima facie case of medical malpractice, the plaintiff must submit evidence that shows the applicable standard of care, the violation of the standard of care, and a causal relationship between the violation and the harm allegedly experienced by the plaintiff. Phillips [v. Covenant Clinic], 625 N.W.2d [714,] 718 [ (Iowa 2001) ]. Generally, expert testimony is required to establish specific negligence of a physician. Kennis v. Mercy Hosp. Med. Ctr., 491 N.W.2d 161, 165 (Iowa 1992). Id., 708 N.W.2d at 61-62. The plaintiffs in the present case proved all of the elements of a negligence claim against Dr. Steele by offering competent testimony and other evidence on each element of a prima facie case. The court disagrees with Dr. Steele's argument that a claim against a doctor for transferring an unstable patient from one hospital to another, *911 in violation of the applicable standard of care and resulting in harm to the patient, is not an appropriate specification of negligence. The court also disagrees with his contention that this is not an appropriate specification of negligence simply because an EMTALA claim cannot be brought against him. Dr. Steele's motions for new trial and for judgment as a matter of law on this ground are denied. D. Did the Court Err in Instructing the Jury on Lakes Hospital's Negligence? Lakes Hospital argues the court erred in instructing the jury that the Hospital had a common law duty to diagnose and treat Ms. Heimlicher's medical condition.[10] The Hospital maintains it had no right to diagnose or treat Ms. Heimlicher because "such duties can only be performed by a physician." Doc. No. 133, p. 6. The Hospital's position is that because it is an entity and not a doctor, it cannot practice medicine. In support of this argument, the Hospital cites State v. Miller, 542 N.W.2d 241, 246-47 (Iowa 1995). Miller is a criminal case in which the defendant was convicted of practicing medicine without a license. On appeal, he argued the record contained insufficient evidence to support the conviction. The Iowa Supreme Court discussed the instructions given to the jury defining the practice of medicine, and concluded there was sufficient evidence to support the conviction. Id., 542 N.W.2d at 246-47. This court can find nothing in the Miller case to support the Hospital's argument on this issue. In its reply brief, the Hospital argues paragraph (l)(a) of Jury Instruction No. 16 "imposed a direct duty on the hospital to diagnose a medical condition and forecast how the condition would, or would not, change." Doc. No. 133-2, p. 4. The Hospital asserts: As a matter of law a hospital, as a corporate entity cannot diagnose or treat a medical condition. Although the hospital had the duty to provide emergency room care, the hospital satisfied that duty by providing for the services of an emergency room physician, Dr. Steele. As instructed in Instruction No. 17, the hospital may or may not be liable for the acts of the emergency room physician. Because the hospital's liability for the act of the emergency room physician is indirect, it was error to instruct that the hospital had a direct and independent duty at common law, to diagnose and treat the patient. Instruction number 15 which imposed duties on Dr. Steele and mirrored Instruction 16 as to the hospital, which when considered with the agency liability Instruction number 17, doubled the duty on the hospital, which mostly likely had an adverse effect on the allocation of fault as between the defendants, as is evidence in the ratio of the jury's verdict. The court must confess that it cannot understand what the Hospital is attempting to say in this argument, but the court is fairly certain the argument was not presented during trial. To the extent it was not, it has been waived. See Fed.R.Civ.P. 51(d)(1)(A) (party may assert "error in an instruction actually given, if that party properly objected") (emphasis added); *912 Cincinnati Ins. Co., 560 F.3d at 805. Also, no authorities are cited in support of the argument, as required by Local Rule 7.b.3, and the court cannot independently discern anything meritorious in the argument. As the court stated in Jury Instruction No. 17, a hospital can be held vicariously liable "for the acts or omissions of its employees, officers, directors, and agents performed within the scope of their authority." As the Iowa Supreme Court explained in Wilkins v. Marshalltown Medical and Surgical Center, 758 N.W.2d 232 (Iowa 2008): "`[A]n emergency-room patient looks to the hospital for care, and not to the individual physicianโ€”the patient goes to the emergency room for services, and accepts those services from whichever physician is assigned his or her case.'" Wolbers v. The Finley Hosp., 673 N.W.2d 728, 734 (Iowa 2003) (quoting 40A Am.Jur.2d Hospitals & Asylums ง 48, at 460 (1999)); see also Mehlman v. Powell, 281 Md. 269, 378 A.2d 1121, 1124 (1977) (stating "all appearances suggest and all ordinary expectations would be that the Hospital emergency room, physically a part of the Hospital, was in fact an integral part of the institution"); Arthur v. St. Peters Hosp., 169 N.J.Super. 575, 405 A.2d 443, 447 (1979) (noting that absent a situation where the patient is directed by his own physician or where the patient makes an independent selection as to which physicians he will use, it is the reputation of the hospital itself upon which the patient relies). Wilkins, 758 N.W.2d at 237. See Wolbers v. The Finley Hosp., 673 N.W.2d 728, 734 (Iowa 2003) ("A hospital has an absolute duty to its emergency-room patients to provide competent medical care, a duty which cannot be delegated.") (citing 40A Am.Jur.2d Hospitals & Asylums ง 48, at 460 (1999)). Doctors practicing in a hospital emergency room can be agents of the hospital even if they are independent contractors of the hospital, and the hospital can be held responsible for malpractice committed by them. See Wilkins, 758 N.W.2d at 236-37 (hospital is liable to patient for negligence of emergency room doctor who is independent contractor of hospital if patient could infer an agency relationship from the circumstances). Substantial evidence established that Dr. Steele was an agent of Lakes Hospital, so the Hospital is liable for any negligence committed by him. The court finds "the instructions, taken as a whole and viewed in the light of the evidence and applicable law, fairly and adequately submitted the issues in the case to the jury." B & B Hardware, Inc. v. Hargis Indus., Inc., 252 F.3d 1010, 1012-13 (8th Cir.2001). Substantial evidence in the record supports the jury's decision that Lakes Hospital was vicariously liable for Dr. Steele's negligence, as well as for the negligence of its employees, Ms. Evans and Nurse Helle. Lakes Hospital's motion for new trial on this ground is denied. E. Were the State-Law Negligence Claims against Lakes Hospital Preempted by EMTALA? Lakes Hospital argues that as a result of section (f) of EMTALA[11] and the Supremacy Clause in Article VI of the United States Constitution, it "cannot be held liable for common law negligence under state law." Doc. No. 133, p. 4. Congressional intent determines whether federal law preempts a *913 state statute. See California Fed. Sav. & Loan Ass'n v. Guerra, 479 U.S. 272, 280, 107 S.Ct. 683, 689, 93 L.Ed.2d 613 (1987). In ascertaining Congressional intent, a court must consider any legislative provision, such as section (f) of EMTALA, that explicitly addresses preemption. "When Congress has considered the issue of preemption and has included in the enacted legislation a provision explicitly addressing that issue, and when that provision provides a reliable indicium of congressional intent with respect to state authority, there is no need to infer congressional intent to preempt state laws from the substantive provisions of the legislation." Cipollone v. Liggett Group, Inc., 505 U.S. 504, 517, 112 S.Ct. 2608, 2618, 120 L.Ed.2d 407 (1992). Lakes Hospital notes that in the plaintiffs' negligence claim against the Hospital, they allege the Hospital "had a duty to determine whether Laura Heimlicher's medical condition and that of the unborn child were, or were not, likely to materially deteriorate during the transfer." Doc. No. 132-2, p. 5; see Jury Instruction No. 16. The Hospital argues, "In contrast, EMTALA provides in its certification defense that a hospital is not liable for transferring a patient in an unstable medical condition where a physician certifies that the benefits exceed the risk of transfer." Doc. No. 132-2, p. 5. The Hospital asserts it "cannot be liable under state law where it is not liable under federal law, [and] the plaintiffs' negligent transfer claim fails as a matter of law." Id. This argument is based on the faulty premise that a hospital cannot be liable for its negligent transfer of a patient under state law if it is not liable for the transfer under EMTALA. No principle of preemption or supremacy requires such a result. Preemption requires that the state statute being preempted directly conflict with the federal law. This can take place in either of two ways: first, a state law can be preempted if "compliance with both federal and state regulations is a physical impossibility," Florida Lime & Avocado Growers, Inc. v. Paul, 373 U.S. 132, 142-43, 83 S.Ct. 1210, 1217-18, 10 L.Ed.2d 248 (1963); or second, a state law can be preempted if the state law is "an obstacle to the accomplishment and execution of the full purposes and objectives of Congress." Hines v. Davidowitz, 312 U.S. 52, 67, 61 S.Ct. 399, 404, 85 L.Ed. 581 (1941). See Draper v. Chiapuzio, 9 F.3d 1391, 1393 (9th Cir.1993). Lakes Hospital notes EMTALA provides for the recovery of damages available under state personal injury law (EMTALA ง (d)(2)(A)),[12] but subject to the "certification" defense in section (c)(l)(A)(ii) of the Act. The Hospital argues that because a state-law personal injury claim against a hospital is not subject to the EMTALA "certification" defense, allowing the state-law claim would render the enforcement of EMTALA "a physical impossibility." This argument is not persuasive. Even though the Act provides a hospital with a defense to certain claims under EMTALA, it does not follow that Congress intended to preempt state-law claims arising out of the same facts. Such a construction of the Act would render subsection (d)(2)(A) meaningless, because all of the state law claims that could be asserted under that subsection would be preempted. A statute should not be interpreted in a way the renders one of the *914 sections of the statute meaningless. See Bueford v. Resolution Trust Corp., 991 F.2d 481, 486 (8th Cir.1993) ("[S]tatutory provisions are to be read, whenever possible, in a way that does not render other provisions meaningless.") With regard to the second way a state law can be preempted, it is difficult to see how permitting state-law negligence claims against a hospital would create an obstacle to the accomplishment and execution of the full purposes of EMTALA. According to one court, "The core purpose of EMTALA... is to prevent hospitals from failing to examine and stabilize uninsured patients who seek emergency treatment." Hardy v. New York City Health & Hosp. Corp., 164 F.3d 789, 795 (2d Cir.1999). Another court summarized the "core purpose" of EMTALA as follows: Its core purpose is to get patients into the system who might otherwise go untreated and be left without a remedy because traditional medical malpractice law affords no claim for failure to treat. Brooks v. Maryland Gen. Hosp., Inc., 996 F.2d 708, 710 (4th Cir.1993) (recognizing that "[u]nder traditional state tort law, hospitals are under no legal duty to provide [emergency care to all]" and holding that EMTALA's purpose is simply to impose on hospitals the legal duty to provide such emergency care); Gatewood v. Washington Healthcare Corp., 933 F.2d 1037, 1041 (D.C.Cir.1991) (holding that EMTALA's purpose is "to create a new cause of action, generally unavailable under state tort law, for what amounts to failure to treat"). Numerous cases and the Act's legislative history confirm that Congress's sole purpose in enacting EMTALA was to deal with the problem of patients being turned away from emergency rooms for non-medical reasons. Bryan v. Rectors & Visitors of Univ. of Va., 95 F.3d 349, 351 (4th Cir.1996). The purpose of section (f) of the Act was to "[create] a remedy that could not be eliminated." Root v. Liberty Emergency Physicians, Inc., 68 F.Supp.2d 1086, 1092 (W.D.Mo.1999). Allowing a plaintiff to proceed with a state-law malpractice claim does not conflict with any of these purposes. Lakes Hospital relies on Riegel v. Medtronic, Inc., ___ U.S. ___, 128 S.Ct. 999, 1003, 169 L.Ed.2d 892 (2008) (federal preemption of the regulation of medical devices); Chicago and North Western Transportation Co. v. Kalo Brick & Tile Co., 450 U.S. 311, 101 S.Ct. 1124, 67 L.Ed.2d 258 (1981) (preemption of a shipper's claims against a carrier regulated by the Interstate Commerce Act); and Van Natta v. Sara Lee Corp., 439 F.Supp.2d 911, 933 (N.D.Iowa 2006) (preemption of state laws by ERISA). None of these cases supports Lakes Hospital's preemption argument in the present case. In Root v. New Liberty Hospital District, 209 F.3d 1068 (8th Cir.2000), the Eighth Circuit Court of Appeals applied section (f) of the Act, together with the Supremacy Clause, to strike down a state sovereign immunity statute. In Root, the plaintiffs sued a hospital under EMTALA asking for damages under Missouri personal injury law, as provided by section (d)(2)(A) of the Act. The defendant, a state agency, argued that Missouri personal injury law, including the Missouri sovereign immunity statute, is incorporated into EMTALA by section (d)(2)(A), so sovereign immunity should bar the plaintiffs' claims. The Eighth Circuit pointed out that section (f) applies only to a "State or local law requirement," id., 209 F.3d at 1070 (emphasis in original), and the state sovereign immunity statute does not require anyone to do anything. Instead, it informs potential plaintiffs that they may not sue public entities unless sovereign immunity is expressly *915 waived. Because the state sovereign immunity statute is not a "State or local law requirement," it can be preempted if it directly conflicts with EMTALA. The court held, "Missouri's sovereign immunity statute is in direct conflict with 42 U.S.C. ง 1395dd(d)(2)(A). The supremacy clause, see U.S. Const. art. VI, cl. 2, therefore dictates that Missouri's sovereign immunity statute must yield." Id. Iowa negligence law does not conflict at all with EMTALA. As observed by the federal courts, "The legislative history of EMTALA demonstrates that Congress never intended to displace state malpractice law.... [The] intent [was] to supplement, but not supplant, state tort law." Hardy v. New York City Health & Hosp. Corp., 164 F.3d 789, 793 (2d Cir.1999). "EMTALA is not a substitute for state malpractice actions, although `there may arise some areas of overlap between federal and local causes of action.'" Barris v. County of Los Angeles, 20 Cal.4th 101, 83 Cal.Rptr.2d 145, 972 P.2d 966, 972 (1999) (citing Gatewood v. Washington Healthcare Corp., 933 F.2d 1037 (11th Cir.1991)). It would be illogical for this court to hold that a federal law not intended to provide a remedy for medical malpractice, and that expressly leaves such claims to state law, preempts a state law intended to provide that remedy. "EMTALA and state tort laws provide distinct remedies for different wrongs." Tinius v. Carroll County Sheriff Dept., 321 F.Supp.2d 1064, 1088 (N.D.Iowa 2004). Lakes Hospital's motions for new trial and for judgment as a matter of law on this ground are denied. F. Did the Court Err in Refusing to Submit Ms. Heimlicher's Comparative Fault to the Jury? The defendants argue the court erred in excluding evidence that Ms. Heimlicher was at fault "in failing to seek medical attention when it was obvious that she should do so." Doc. No 133, ง IX(d), p. 8; Doc. No. 136, ง I, ถ 3. They claim the court erred in excluding evidence of her fault, and argue her comparative fault should have been submitted to the jury. On the evening of February 11, 2004, Ms. Heimlicher called "911" from her home. She at first told the operator she did not want an ambulance, but a short time later, she changed her mind and agreed that an ambulance should be sent. Scott Greer, an Emergency Medical Technician who lived in her neighborhood, arrived at her house before the ambulance. In his notes, he quoted Ms. Heimlicher as saying "that while shopping and upon returning home she began to bleed and [she said] that the bathroom was a mess and [she] had a towel between her legs." Joint Ex. 50, pp. 1-2. He tried to get Ms. Heimlicher to sit down, but she continued walking around, stating that "it hurt too bad" when she sat down. Id., p. 3. During trial, the defendants proffered testimony by Dr. Mark Landon, an obstetrician/gynecologist/specialist in maternal fetal medicine,[13] that if Ms. Heimlicher had sought medical attention earlier, she might have been hospitalized earlier and avoided the problems she faced that evening. See Trial Tr. at 542-44. From this evidence, the defendants argue the court should have allowed them to submit evidence of Ms. Heimlicher's alleged comparative fault to the jury. They further argue the court should have submitted jury instructions and a verdict form that would have allowed the jury to consider her fault. At a pretrial conference on the morning of the first day of trial, the court advised the defendants preliminarily that evidence of Ms. Heimlicher's alleged comparative fault would not be permitted, but they *916 could offer evidence during the trial to persuade the court otherwise. See FTR Gold recording of pretrial conference, March 2, 2007, beginning at 08:50:13; Trial Tr. at 537. During the trial, the court excluded the proffered testimony of Dr. Landon, Trial Tr. at 546, and all other evidence offered by the defendants to establish fault on the part of Ms. Heimlicher. In the jury instructions, the court told the jury not to consider Ms. Heimlicher's fault in arriving at their verdict. See Doc. No. 119; Trial Tr. at 815-16. In DeMoss v. Hamilton, 644 N.W.2d 302 (Iowa 2002), the Iowa Supreme Court addressed the question of "when, if ever, a patient's fault may be considered by the jury and compared with the alleged fault of the doctor." The court answered this question as follows: [A] patient's negligence must have been an active and efficient contributing cause of the injury, must have cooperated with the negligence of the malpractitioner, must have entered into proximate causation of the injury, and must have been an element in the transaction on which the malpractice is based. Accordingly, in a medical malpractice action, the defense of contributory negligence is inapplicable when a patient's conduct provides the occasion for medical attention, care, or treatment which later is the subject of a medical malpractice claim or when the patient's conduct contributes to an illness or condition for which the patient seeks the medical attention, care or treatment on which a subsequent medical malpractice claim is based. DeMoss, 644 N.W.2d at 306; see id. at 303-04. In deciding DeMoss, the Iowa Supreme Court relied on Fritts v. McKinne, 934 P.2d 371 (Okla.Civ.App.Div.1996), a case involving a patient who had been seriously injured in a car accident. The defendant emergency room doctor asked for a comparative fault instruction because the patient had been driving drunk. The appellate court found the instruction was not warranted, holding, "Those patients who may have negligently injured themselves are nevertheless entitled to subsequent non-negligent medical treatment and to an undiminished recovery if such subsequent non-negligent treatment is not afforded." Fritts, 934 P.2d at 374. These principles were applied by the Iowa Supreme Court in Wolbers v. The Finley Hospital, 673 N.W.2d 728 (Iowa 2003). In Wolbers, a patient was scheduled for surgery, and was told to stop smoking in preparation for the surgery. He ignored these instructions, and continued smoking up until the time he entered the hospital. Complications developed after the surgery, and the patient died from breathing complications. His estate brought a malpractice claim against the hospital. The trial court denied the hospital's request to have comparative fault submitted to the jury, and the hospital appealed. The Iowa Supreme Court affirmed, holding, "While it seems clear that smoking can produce increased secretions, such as the ones that caused a blockage to the airways of plaintiff's decedent, it seems equally clear that the present claim was based on the hospital staff's alleged failure to adequately treat the condition that existed, whatever its cause." Wolbers, 673 N.W.2d at 733. Under DeMoss and Wolbers, the defendants in the present case were not entitled to the submission of comparative fault. All of the evidence proffered by the defendants on the issue of comparative fault related to Ms. Heimlicher's conduct before she arrived at Lakes Hospital. No evidence was proffered to support a claim that after Ms. Heimlicher arrived at Lakes Hospital, she acted or failed to act in a *917 manner that contributed to the deterioration of her condition or the loss of the fetus. Even if Ms. Heimlicher delayed in calling "911" or in going to Lakes Hospital, or engaged in activities before admission to Lakes Hospital that contributed to her problems, she was entitled to an "undiminished recovery" for any subsequent acts of malpractice by the defendants. Fritts, 934 P.2d at 374. The defendants cite Reed v. Lyons, 752 N.W.2d 453 (Table), 2008 WL 2041686 (Iowa Ct.App.2008), in support of their argument. In Reed, the defendant doctor performed knee surgery on the plaintiff. After surgery, the plaintiff tested negative for infection. Later, the defendant doctor aspirated a large blood clot on the knee, noting in his medical record that there was no sign of infection. The plaintiff later developed an infection in his knee that required hospitalization. He filed suit against the doctor, alleging that negligent medical care provided by the doctor was a proximate cause of the infection. The defendant denied causation, and alleged that the plaintiff's own conduct contributed to the infection. At trial, the defense submitted evidence that on several occasions, the plaintiff had self-aspirated his knee joint. Reed, 2008 WL 2041686 at *1. The trial court submitted comparative fault to the jury, and the jury found the plaintiff 90% at fault and returned a defense verdict. The trial court denied the plaintiff's motion for new trial based on submission of comparative fault. The plaintiff appealed, arguing that "a comparative fault defense is inapplicable when a plaintiff's negligence occasioned the currently disputed medical treatment." Reed, 2008 WL 2041686 at *2. The Iowa Court of Appeals analyzed this argument as follows: Reed also contends the instruction was improper because even if there was proof Reed self-aspirated his knee before being treated by Dr. Lyons or during his follow-up care with the University of Iowa Hospitals physicians, this negligent conduct cannot be used as a defense in a medical malpractice action. The rule is in a medical malpractice action, the defense of contributory negligence is inapplicable when a patient's conduct provides the occasion for medical attention, care, or treatment which later is the subject of a medical malpractice claim or when the patient's conduct contributes to an illness or condition for which the patient seeks the medical attention, care or treatment on which a subsequent medical malpractice claim is based. Wolbers [v. The Finley Hosp.], 673 N.W.2d [728,] 732 [ (Iowa 2003) ], (quoting DeMoss [v. Hamilton], 644 N.W.2d [302,] 306 [(Iowa 2002)]). A patient that is injured by his or her own negligence is still entitled to subsequent non-negligent medical treatment and recovery should not be diminished if negligent medical care is given. Id. Reed's argument fails because he has not identified the relevant time period of conduct under this rule. See DeMoss, 644 N.W.2d at 306 ("[T]he question is which conduct is relevant to the cause of action."). Here defendant Lyons is not arguing Reed's self-aspiration before the surgeries contributed to the infection. Instead, Lyons argues the jury could find from circumstantial evidence Reed self-aspirated after the surgeries and the follow-up appointment, against medical advice, which caused or exacerbated the infection. The court properly submitted the issue of comparative fault to the jury and correctly overruled Reed's motion for a new trial on this ground. Reed, at *4. The decision in Reed does not conflict with the principles announced by the Iowa Supreme Court in DeMoss or Wolbers, and *918 is easily distinguishable from the present case. In Reed, after the defendant doctor began caring for the plaintiff, the plaintiff acted in a manner that allegedly contributed to his damages. No such allegation was made in the present case. Here, the defendants allege that Ms. Heimlicher was at fault "in failing to seek medical attention when it was obvious that she should do so." Doc. No 133, ง IX(d), p. 8 (emphasis added). This allegation, even if true, would not constitute comparative fault under Iowa law. The defendants' motions for new trial on this ground are denied. G. Did the Court Mislead the Jury into Assigning Lakes Hospital Double Liability? In its reply brief, Lakes Hospital argues for the first time that "in Instruction No. 17,[14] the jury was misled to believe that the hospital was liable for two errors of medical judgment, that is, its own and that of its emergency room physician. An instruction that erroneously imposes a duty is reversible error and grounds for a new trial where it misleads the jury or had a probable effect on the jury's verdict." Doc. No. 158, p. 2 (citing Sherman v. Winco Fireworks, Inc., 532 F.3d 709, 722 (8th Cir.2008)). Lakes Hospital then argues the jury was misled by the combination of Jury Instruction No. 16, the "elements" instruction for the plaintiffs' negligence claim against the Hospital, and Jury Instruction No. 17, the instruction explaining when a hospital is liable for the acts of its employees, officers, directors, and agents. Id. Based on the evidence, the jury's assignment of 70% of the fault to Lakes Hospital was to be expected. The most powerful evidence on the question of fault was about the ambulance ride from Lakes Hospital to Sioux Valley Hospital. From the beginning of the ride, it was readily apparent that Ms. Heimlicher and her unborn child were in serious trouble. Ms. Heimlicher was in severe pain and was bleeding profusely. In addition to these distressing symptoms, critical problems were being reflected on the monitors attached to her. The monitor for her uterus indicated she was having contractions that were too rapid, an indication of uterine bleeding. The monitor for the baby's heartbeat demonstrated a pattern of repeated "late decelerations," a serious sign of fetal distress. The Lakes Hospital nurse who was supposed to be monitoring Ms. Heimlicher and her baby failed to notify anyone of these problems or take any steps to address the situation. If she had called Dr. Steele as soon as these problems had become apparent and told him about them, he almost certainly would have ordered the ambulance back to Lakes Hospital for an emergency Cโ€”section. Under these circumstances, assignment of 70% of the fault to Lakes Hospital has ample support in this record. Under the facts of this case, the jury could have been expected to assign Lakes Hospital 100% of the fault based on its vicarious liability for the imputed negligence of its agents and employees. As explained by the Iowa Supreme Court in Wells Dairy, Inc. v. American Industrial Refrigeration, Inc., 762 N.W.2d 463, 471 (Iowa 2009): In the vicarious liability cases, the relationship of the indemnitor and the indemnitee *919 is such that fairness and justice requires that the party primarily responsible for the underlying injury should bear the liability. Vicarious liability is commonly used in cases involving respondeat superior, principals and agents, employers and employees, or other similar relationships. We have adopted indemnity based on vicarious liability in Iowa. Rozmajzl v. Northland Greyhound Lines, 242 Iowa 1135, 1143, 49 N.W.2d 501, 506 (1951). Id., 762 N.W.2d at 471. See Tigges v. City of Ames, 356 N.W.2d 503, 507 (Iowa 1984) ("Imputed negligence is the negligence of one person which is chargeable to another because of a relationship between the parties, e.g., the negligence of an agent within the scope of his employment is chargeable to the principal."); Gartin's Grocery v. Lucas County Co-op. Creamery Ass'n, 231 Iowa 204, 1 N.W.2d 275, 280 (1941) ("[F]ew doctrines of the law are more firmly established or more in harmony with accepted notions of social policy than that of the liability of the principal without fault of his own."). The evidence firmly established that all of the actors in this case (Dr. Steele, Nurse Helle, Ms. Evans, and even Dr. Low) were either agents or employees of the Hospital. As such, the Hospital was vicariously liable for the combined total of their fault, which would be 100%. No party requested that the defendants' fault be submitted together, and that they be treated as a unified tortfeasor. See, e.g., Peppmeier v. Murphy, 708 N.W.2d 57, 64 (Iowa 2005) (acts of principal and agent deemed that of one tortfeasor). If Lakes Hospital believes it has been assigned too much of the fault, or that it is entitled to indemnity or contribution from Dr. Steele or from anyone else, it can seek that relief in a separate action. See Biddle v. Sartori Mem. Hosp., 518 N.W.2d 795, 799 (Iowa 1994) (recognizing the "well settled rule that a principal found vicariously liable for the negligent acts of an agent retains a right of full indemnity against the actual tortfeasor"). It is too late to make such a claim here. The instructions, taken as a whole, do not suggest that Lakes Hospital should be held liable for "double fault" based on the combination of its own negligence and the negligence of the emergency room doctor, and the court finds the jury did not do so. See B & B Hardware, Inc. v. Hargis Indus., Inc., 252 F.3d 1010, 1012-13 (question is "whether the instructions, taken as a whole and viewed in the light of the evidence and applicable law, fairly and adequately submitted the issues in the case to the jury"). In any event, this objection to Jury Instruction No. 17 was not asserted at trial.[15] In fact, this argument was not even raised in Lakes Hospital's post-trial motions, but was asserted for the first time in its reply brief. This was too late. See L.R. 7.g.[16] If Lakes Hospital believed there was a risk *920 the jury would assign it "double fault," it should have objected to the instructions on this ground, or it should have requested that Lakes Hospital and Dr. Steele be treated in the instructions as a single defendant for purposes of fault. See Iowa Code ง 668.3(2)(b). These objections were not raised at trial, so they have been waived. See Fed.R.Civ.P. 51(d)(1)(A); Cincinnati Ins. Co. v. Bluewood, Inc., 560 F.3d 798, 805 (8th Cir.2009); McGhee v. Pottawattamie County, Iowa, 547 F.3d 922, 929 (8th Cir.2008). Lakes Hospital's motion for new trial on this ground is denied. H. Did the Court Err in Allowing Plaintiffs' Counsel to Ask Expert Witnesses Questions Based on the Jury Instructions? The defendants argue the court erred when it allowed the plaintiffs' lawyer to show their expert witnesses the court's "elements" instructions, and then ask them to express opinions about the elements. They maintain these opinions were improper and inadmissible, citing Southern Pine Helicopters, Inc. v. Phoenix Aviation Managers, Inc., 320 F.3d 838, 841 (8th Cir.2003). They also maintain they were materially prejudiced by this line of examination because it allowed the plaintiffs' experts "to usurp the function of the jury on the central legal issues in the case." Doc. No. 133, p. 7. Southern Pine Helicopters was an action to recover damages under an insurance policy. In commenting about the way the case was tried, the court observed: Our review of this case has been hampered not a little by the way that the parties chose to try it. The evidence took the form, essentially, of a battle of experts opining as to whether Southern Pine had violated FAA regulations. As we have had occasion to remark before, however, expert testimony on legal matters is not admissible. See United States v. Klaphake, 64 F.3d 435, 438-39 (8th Cir.1995). Matters of law are for the trial judge, and it is the judge's job to instruct the jury on them. See id. Here, the parties did not request instructions on the relevant federal legal principles and so the district court gave none. Of course, industry practice or standards may often be relevant in cases like the present one, and expert or fact testimony on what these are is often admissible. See Wood v. Minnesota Mining & Mfg., 112 F.3d 306, 310 (8th Cir.1997). But that is not what this case was about. This case was about whether federal law was contravened, and expert opinion as to that was simply inadmissible. Southern Pine Helicopters, 320 F.3d at 839. Unlike Southern Pine Helicopters, in the present case the evidence did not consist primarily of expert witnesses testifying about whether someone violated a law or regulation. In fact, the record contains little, if any, such evidence. Although several expert witnesses did testify at trial, the record contains substantial additional evidence for the jury to consider, including hospital records and testimony by fact witnesses. During both direct and cross examination of the expert witnesses, the lawyers from both sides asked questions about the elements of the claims. The court sustained objections to certain of these *921 questions, and overruled others. The Federal Rules of Evidence give the court wide latitude to control proceedings so as to "(1) make the interrogation and presentation effective for the ascertainment of the truth, (2) avoid needless consumption of time, and (3) protect witnesses from harassment or undue embarrassment." Fed.R.Evid. 611(a). A trial court's evidentiary rulings are reviewed under an abuse of discretion standard. White v. Honeywell, Inc., 141 F.3d 1270, 1274 (8th Cir. 1998). An error in admission of evidence is reversible if the ruling affected a substantial right of a party. See Fed.R.Evid. 103(a); see also Concord Boat Corp. v. Brunswick Corp., 207 F.3d 1039, 1057 (8th Cir.2000). The defendants argue the expert testimony about elements of the claims usurped the function of the jury on the central issues in the case. This argument is unpersuasive. The Eighth Circuit Court of Appeals "has repeatedly held that an expert, as distinguished from a lay witness, may express his opinion on the ultimate jury question." United States v. Two Eagle, 318 F.3d 785, 792 (8th Cir.2003). To the extent the defendants are arguing this testimony was not useful, doubts regarding usefulness generally should be resolved in favor of admissibility. Clark v. Heidrick, 150 F.3d 912, 915 (8th Cir.1998). Testimony by expert witnesses in this case concerning the elements of the claims or defenses did not result in a miscarriage of justice, nor did it adversely impact the defendants' substantial rights. The defendants' motions for new trial and for judgment as a matter of law on this ground are denied. I. Did the Court Err in Permitting the Jury to Treat Dr. Low as an Agent of Lakes Hospital? Lakes Hospital argues the court should order a new trial because Lakes Hospital "was prejudiced by the addition of an agency theory of liability against the hospital based on the diagnosis of a radiologist that was not pled in the Complaint." Doc. No. 133, p. 5. Lakes Hospital explains, "Notwithstanding that the alleged negligence of Dr. Low, a radiologist, was not in the case, the Court nonetheless admitted over objection, substantial adverse expert testimony that was critical of Dr. Low that the jury could impute to the hospital under the Court's Instruction No. 17." Id. After Ms. Heimlicher was brought by ambulance to Lakes Hospital, she was examined by Dr. Steele. He ordered an ultrasound examination, which was performed by Tracy Evans, a hospital ultrasound technician. Ms. Evans transmitted the images electronically to Dr. Low, a Minnesota radiologist who was on call that night, and then spoke with him on the telephone. When Dr. Steele's deposition was taken on May 7, 2007, he testified he did not know that on the evening in question, the ultrasound images had been reviewed by a radiologist. Apparently, the lawyers for the parties also were not aware of Dr. Low's involvement. This information came to light on July 2, 2007, when the lawyers deposed Ms. Evans. Dr. Low passed away before he could be deposed. The only record of the conversation between Ms. Evans and Dr. Low is an "Ultrasound Worksheet" containing some contemporaneous notes made by Ms. Evans. See Def. Joint Ex. H, attached to this order. The notes relate to Ms. Heimlicher's medical history, the ultrasound examination, and Ms. Evans's conversation with Dr. Low. On the worksheet, Ms. Evans noted, "placentaโ€”posterior/fundal," "no previa," "complex looking placenta in LUQ," and "placental lakes seen vs. hemorrhage." Id. At the bottom of the form, she noted, "teleraded to Dr. Low @ 9:30 *922 2/11/04 TE," and next to this language she wrote, "Dxโ€”mass vs. hemorrhage vs. fibroid." Id. Two weeks before trial, on February 17, 2009, the plaintiffs filed a motion for leave to amend their complaint. Doc. No. 81. In paragraph 11 of the proposed amended complaint, the plaintiffs alleged, "At 2125 an ultrasound was performed by Tracy Evans, an ultrasound technician employed by [Lakes Hospital], who then allegedly electronically transferred the ultrasound images to Dr. Lowe [sic], an agent and/or ostensible agent of [Lakes Hospital], whose diagnosis included mass vs. hemorrhage vs. fibroid." The motion to amend the complaint was denied. Doc. No. 82. In denying the motion, the court advised the plaintiffs' lawyer that the motion was untimely, but he was not precluded from offering evidence concerning Dr. Low at trial. In the Final Pretrial Order, the plaintiffs listed the following as issue number 4: "Whether Dr. Low was an ostensible agent/apparent authority of the Defendant Hospital for which they are vicariously liable." Doc. No. 102, p. 9. By the time of trial, there was no question that Dr. Low's agency was "in the case." Lakes Hospital argues evidence concerning "Dr. Low's agency" should have been excluded from the trial because the claim was not included in the complaint. This argument is unpersuasive. The Federal Rules of Civil Procedure require only that a complaint include "a short and plain statement of the claim showing that the pleader is entitled to relief." Fed.R.Civ.P. 8(a)(2). To comply with this requirement, a claimant need not "set out in detail the facts upon which he bases his claims," but must "`give the defendant fair notice of what the plaintiff's claim is and the grounds upon which it rests.'" Swierkiewicz v. Sorema N.A., 534 U.S. 506, 512, 122 S.Ct. 992, 998, 152 L.Ed.2d 1 (2002) (quoting Conley v. Gibson, 355 U.S. 41, 47, 78 S.Ct. 99, 2 L.Ed.2d 80 (1957)). Well before the plaintiffs' belated attempt to amend their complaint, Lakes Hospital had notice that the plaintiffs' evidence would include testimony concerning Dr. Low, and that the plaintiffs would claim he was an agent of Lakes Hospital. In any event, the evidence in the record suggesting negligence on the part of Dr. Low was not significant. One of the plaintiffs' expert witnesses testified that the ultrasound images reviewed by Dr. Low demonstrated a massive placental abruption. Another testified Dr. Low should have had direct communication with Dr. Steele that evening. This testimony was critical of Dr. Low, but from the evidence, it was unclear what Dr. Low actually said or did not say to Ms. Evans about the ultrasound images that evening. The court finds that any testimony implying Dr. Low might have been negligent had little, if any, impact at trial. The central focus of the evidence was not on Dr. Low, but on the alleged errors and omissions of Dr. Steele, Ms. Evans, and Nurse Helle. The court finds Lakes Hospital has shown no unfair prejudice from testimony concerning Dr. Low, or from the claim that he was an agent of Lakes Hospital. Lakes Hospital's motion for new trial on this ground is denied. J. Did the Court Erroneously Allow Evidence of Grief into The Record? The defendants argue the plaintiffs' lawyer placed "irrelevant and highly prejudicial grief evidence" into the record in contravention of the court's ruling on the defendants' motion in limine.[17] Doc. No. 133, ง IX(a); Doc. No. 136, ง I, ถ 1. *923 Under Iowa law, the wrongful death of a minor can give rise to two separate causes of action, one on behalf of the minor's estate under Iowa Code Section 611.20,[18] and the other by the minor's parents pursuant to Iowa Rule of Civil Procedure 1.206 ("Rule 1.206").[19] A cause of action under Section 611.20 is not available to the plaintiffs in this case because the child was stillborn, and a stillborn fetus is not a "person" for purposes of the statute. See Heimlicher, 2007 WL 2384374, *3-7. However, the second cause of action, by the minor's parents pursuant to Rule 1.206, is available to the plaintiffs because a stillborn fetus is a "minor child" for purposes of Rule 1.206. Dunn v. Rose Way, Inc., 333 N.W.2d 830, 832 (Iowa 1983). A claim pursuant to Rule 1.206 is not for the death of the child, but for the injury to the parents as a consequence of the death of the child. See Wardlow v. City of Keokuk, 190 N.W.2d 439, 443 (Iowa 1971). In a cause of action under Rule 1.206, a plaintiff is entitled to recover the actual loss of services, companionship, and society resulting from the death of the child. These damages can be recovered only for the period from the date of the child's death to the date the child would have attained his majority.[20]See E.L.K. v. Rohlwing, 760 F.Supp. 144, 145 (N.D.Iowa 1991) ("What appears to be well established, however, is that when a child dies, a parent can recover damages only until the child would have attained his majority."); Miller v. Wellman Dynamics Corp., 419 N.W.2d 380, 383 (Iowa 1988) (recovery restricted to benefits normally accrued during decedent's minority only). A plaintiff in an action under Rule 1.206 is not entitled to recover damages for pain, suffering, grief, or mental anguish from the loss of the child. Wardlow, 190 N.W.2d at 448. The jury in this case was told it could award damages for the reasonable value of past and future loss of services, companionship, and society of the child, less the probable and reasonable expense to the plaintiff of the child's board and maintenance. These are the damages allowed by Rule 1.206. The jury was told that the plaintiffs were not entitled to recover for pain, suffering, grief, or mental anguish from the loss of the child. The jury also was instructed that their judgment must not be exercised arbitrarily or out of sympathy or prejudice for or against the parties.[21] In Pagitt v. City of Keokuk, 206 N.W.2d 700 (Iowa 1973), the Iowa Supreme Court provided some guidance about the evidence that can be offered to prove a claim for loss of services, companionship, and society: [T]he trial court charged the jury on damages in the event they found plaintiff entitled to recover. We set out the important part of that instruction: The loss of services for each child includes the reasonable value of the loss of companionship and society of *924 each child from the date of his death..., until he reached his majority. In this connection, you are further instructed that the damages for loss of services, if any, must be diminished by the probable cost of each child's support and maintenance from the date of the death of each child until each child would have reached his majority. You are further instructed that in your consideration of damages for loss of services, if any you find, you are to give no consideration for grief, mental anguish or suffering to the Plaintiff by reason of the childrens' death. In connection with the claim of the Plaintiff for the loss of services of [his children], or one of them, if any you find, you are instructed that the services of a son in the form of companionship and society to his father cannot be measured with precision but you may take into consideration the circumstances of life of [the children], as disclosed by the testimony, including [their] age, health and strength, [their] activities in the household and community, and any other competent evidence which may have a bearing upon the claim of the Plaintiff for the loss of companionship and society, allowing therefor such amount as to you may appear to be fair and reasonable under the circumstances. The [city] asserts the trial court erred in letting the jury consider the "age, health and strength, activities in the house-hold and community and any other competent evidence which may have a bearing upon the claim of the plaintiff for the loss of companionship and society" in arriving at the damages for loss of services. * * * We cannot accept the argument that the characteristics which bear relationship to companionship and society may not be considered in arriving at the value of the loss sustained. The city insists this places a premium on the loss of a "genius" and discounts the value of an ordinary child or, even worse, that of a mentally or physically handicapped one. We believe this misconceives the nature of companionship and society. We readily agree a parent may suffer as much or more mental anguish and grief over the death of a handicapped child than over one who has no disability. However, this is not a factor in the award of damages. These items are specifically excluded. Carefully following the mandate of Wardlow [v. City of Keokuk, 190 N.W.2d 439 (Iowa 1971) ], the trial court told the jury it could not consider "grief, mental anguish or suffering" in assessing damages for loss of companionship and society. See Wardlow v. City of Keokuk, supra, 190 N.W.2d at 448. It is unrealistic to say All children furnish the same companionship and society to All parents. The former is defined as an "association as companions; fellowship"; the latter as used in this context means "those with whom one has companionship." The Random House Dictionary (1966). Quite obviously it is impossible to generalize on the extent to which personsโ€” including parents and childrenโ€”enjoy each other's companionship and society. This is a highly personal relationship which must of necessity be decided on a case-by-case basis. When it relates to a parent and child, it depends on all the circumstances important in the lives of a Particular parent and a Particular child. It takes into consideration not only the character, age, intelligence, interests and personality of the child but also those same factors as they are possessed, or not possessed, by the parent. After all, it is the parent's loss which is *925 being appraised, and the extent to which he has been deprived of the company of his minor child depends on the ability of the child to offer companionship and society and the ability of the parent to enjoy it. * * * We have frequently criticized the abstract statement of legal principles in instructions without affording the jury the assistance necessary to properly apply them to the facts in the particular case before it. Gibbs v. Wilmeth, 261 Iowa 1015, 1022, 157 N.W.2d 93, 97 (1968) and citations. By including those factors to which objection is now made (all of which had evidentiary support), the trial court correctly sought to avoid this pitfall. We believe all these elements had a true bearing on loss of companionship and society. We do not mean to limit instructions in future cases to those same circumstances. Other facts shown by the evidence might well be made part of such an instruction in a given case. Our holding that the instruction presents no reversible error is necessarily limited to the record now before us. Pagitt, 206 N.W.2d at 703-04. In ruling on objections to testimony offered on the plaintiffs' claimed loss of services, companionship, and society in the present case, the court attempted to recognize the factors set out in Pagitt. The plaintiffs were permitted to testify about their own, and each other's, character, intelligence, interests, and personality.[22] They also were permitted to testify about the kind of parents they are, and about the nature of the relationships they have with their other children. All of this evidence was relevant under Pagitt to the kind of relationship they likely would have had with the stillborn child. The court understood that, under Iowa law, damages for pain, suffering, grief, and mental anguish ("grief" damages) were not recoverable, see Wardlow, 190 N.W.2d at 448, and attempted to exclude evidence of these types of damages. "Grief" is a "deep and poignant distress" caused by the loss of a loved one. Webster's Collegiate Dictionary 512, 107 (10th ed.1994). "Companionship" and "society" are, essentially, interchangeable. "Companionship" is "the fellowship existing among companions," and "society" is "companionship or association with one's fellows." Id. at 233, 1115. Thus, the plaintiffs were entitled to recover damages caused by the loss of fellowship with the child, but not for the deep and poignant distress caused by the loss. This was not always an easy line to draw. During the trial, the court recognized that precise categorization of the evidence on damages often would be difficult due to the razor-thin distinction between "grief" and "loss of companionship and society." In an effort to protect against mistakes or confusion on this subject, during the trial the court orally instructed the jury as follows: First, Mr. and Ms. Heimlicher are the only plaintiffs in this case. Their two children are not parties to the case, nor is the estate of Cole Heimlicher. At the conclusion of the case you will be asked to consider only the claims of Mr. and Ms. Heimlicher for loss of services, companionship, and society of the unborn child, from the date of the child's death until the child would have reached the age of eighteen years. You are not to consider any other claims or items of damage. *926 Second, in considering the claims of Mr. and Ms. Heimlicher, you are not to assign any degree of fault to them. Third, you are reminded that the plaintiffs are not entitled to recover damages for pain, suffering, grief, or mental anguish from the loss of the child. They also are not entitled to recover damages for the delivery or for recuperation following delivery. Finally, damages do not have to be measured by any exact or mathematical standard. However, you must use your sound judgment based upon an impartial consideration of the evidence, and your judgment must not be exercised arbitrarily, or out of sympathy or prejudice for or against any party. Doc. No. 119; Trial Tr. at 815-16. Later in the trial, immediately after Mr. Heimlicher began to testify about his wife's "grief and remorse," the court interjected: Ladies and gentlemen of the jury, it is the law in Iowa you cannot consider grief or remorse. That's not part of this case. And disregard that. I know it is difficult to make a distinction, but that's not part of the case. Trial Tr. at 832-33. These cautionary instructions were given to minimize any prejudice from evidence that arguably suggested the plaintiffs were entitled to recover "grief" damages. A cautionary instruction is "`generally sufficient to alleviate prejudice flowing from improper testimony.'" United States v. Beltran-Arce, 415 F.3d 949, 953-54 (8th Cir.2005) (quoting United States v. Davidson, 122 F.3d 531, 538 (8th Cir.1997)); see Harrison v. Purdy Bros. Trucking Co., Inc., 312 F.3d 346, 353 (8th Cir.2002) (cautionary instruction was sufficient to cure any prejudice that might have been caused by testimony). There was no way to hide from the jury the fact that the plaintiffs grieve the loss of their child, or that they have suffered pain and mental anguish from the loss. The jury would have deduced this even if the plaintiffs had not testified. However, the jury was instructed not to consider grief evidence in deciding this case, and there is no reason to believe it disobeyed those instructions. The court is convinced that the cautionary instructions given in this case were sufficient to alleviate any unfair prejudice to the defendants from grief evidence that may inadvertently have been placed before the jury. See United States v. Davidson, 122 F.3d 531, 538 (8th Cir.1997) (trial court is in the best position to weigh the effect of improper testimony). The court finds any evidence of the plaintiffs' grief that found its way into the record did not result in a miscarriage of justice. The defendants argue the plaintiffs' lawyer intentionally and inappropriately placed grief before the jury, both in the questioning of his clients and in argument. "Misconduct by an attorney that results in prejudice may serve as a basis for a new trial." In re Air Crash Disaster, 86 F.3d 498, 524 (6th Cir.1996) (citing City of Cleveland v. Peter Kiewit Sons' Co., 624 F.2d 749, 756 (6th Cir. 1980)). "The burden of showing prejudice rests with the party seeking the new trial, and district courts have broad discretion in deciding whether to grant a motion for a new trial." Id. (citing Allied Chem. Corp. v. Daiflon, Inc., 449 U.S. 33, 36, 101 S.Ct. 188, 190, 66 L.Ed.2d 193 (1980)). The court finds the defendants have failed to sustain this burden. Although the plaintiffs' lawyer made a few stray remarks about grief, and asked questions of his clients that arguably were designed to elicit grief evidence, the court promptly struck those matters from the record or sustained the defendants' objections to them. These incidents were not so pervasive as to have fatally tainted the trial. *927 The defendants' motions for new trial and for judgment as a matter of law on this ground are denied. K. Did the Court Err in Allowing Photographs of the Fetus into Evidence? The defendants argue the court abused its discretion by admitting into evidence three photographs of the stillborn baby, Plaintiffs' Exhibits 10-A, 10-B, and 10-C. They claim the photographs "were intended to, and did, induce sympathy and served no countervailing probative purpose." Doc. No 133, ง IX(b), p. 7; see Doc. No. 133-2, pp. 6-7; Doc. No. 136, ง I, ถ 1. A week before trial, Dr. Steele filed an amended motion in limine asking the court to exclude from evidence any photographs of the stillborn child. Doc. No. 88. Lakes Hospital joined in the motion. Doc. No. 91. The court granted the motion in part, holding the plaintiffs' lawyer could not show the photographs to the jury without first displaying the photographs to the court and defense counsel outside the presence of the jury and obtaining permission from the court to offer them into evidence. Doc. No. 103. Shortly before trial commenced, the court was provided with copies of the photographs, and ruled that the plaintiffs could offer five of them into evidence.[23] The photographs all show what appears to be a sleeping, fully-clothed or covered, newborn infant. They are not overly-sentimental, gruesome, or inflammatory. After looking at the photographs, the court believed they were probative on the plaintiffs' claim for loss of companionship. A large part of a parent's companionship with a child, especially in infancy, is simply looking at the child, and these photographs depicted the child at whom the plaintiffs would be looking. The court found that the probative value of the photographs was not substantially outweighed by any unfair prejudice to the defendants. Based on this finding, the court allowed the photographs into evidence. Relevant evidence may be excluded under Federal Rule of Evidence 403 "if its probative value is substantially outweighed by the danger of unfair prejudice, confusion of the issues, or misleading the jury, or by considerations of undue delay, waste of time, or needless presentation of cumulative evidence." All evidence is inherently prejudicial. It is only when unfair prejudice substantially outweighs probative value that Rule 403 permits exclusion of relevant evidence. The Advisory Committee Note to Rule 403 states, "`Unfair prejudice' within its context means an undue tendency to suggest decision on an improper basis, commonly, though not necessarily, an emotional one." See Block v. R.H. Macy & Co., Inc., 712 F.2d 1241, 1244 (8th Cir.1983). The admission of photographs is a matter within the discretion of the trial court. Giblin v. United States, 523 F.2d 42, 44 (8th Cir.1975); United States v. Delay, 500 F.2d 1360, 1366 (8th Cir.1974); see Campbell v. Keystone Aerial Surveys, 138 F.3d 996, 1004 (5th Cir.1998) (trial court "has broad discretion in assessing admissibility under Rule 403"). The fact that photographs may be chilling or gruesome does not mean they must be excluded. Haley v. Gross, 86 F.3d 630, 645-646 (7th Cir.1996); see In re Air Crash Disaster Near New Orleans, 767 F.2d 1151 (5th Cir.1985) (district court did not abuse its discretion in admitting photographs of bodies of plane crash victims with third degree burns where conscious pain and suffering was an issue); United States v. Bowers, 660 F.2d 527, 529-30 (5th Cir. *928 1981) (prejudice inherent in color photographs of child's lacerated heart in criminal prosecution for child's death did not substantially outweigh the probative value of the evidence to show cruel and excessive physical force); United States v. Kaiser, 545 F.2d 467, 476 (5th Cir.1977) (admission of photographs of murder scene was not abuse of discretion). Appellate courts generally have held that when the photographs are probative of a relevant fact, even if not necessarily a disputed one, admission of even gruesome photographs under Rule 403 is not reversible error. "Gruesomeness alone does not make photographs inadmissible." United States v. Naranjo, 710 F.2d 1465, 1468 (10th Cir.1983). See, e.g., United States v. Ortiz, 315 F.3d 873, 897 (8th Cir.2002) (in capital case, admission of graphic photos of bloody corpse was not abuse of discretion, as they corroborated testimony regarding victim's murder and established that it was heinous and depraved); United States v. Rezaq, 134 F.3d 1121, 1138 (D.C.Cir.1998) (autopsy photographs were relevant to determination of "force and violence" in hijacking case and corroboration of government theory regarding systematic executions); United States v. Cruz-Kuilan, 75 F.3d 59, 61 (1st Cir.1996) (lacerations on victim's head corroborated government theory regarding stray bullets); State v. Alfieri, 132 Ohio App.3d 69, 724 N.E.2d 477 (1998) (affirming admission into evidence of photographs of fetus); State v. Williamson, 919 S.W.2d 69 (Tenn. Crim.App.1995) (same); but see Navarro de Cosme v. Hospital Pavia, 922 F.2d 926, 931 (1st Cir.1991) (affirming discretionary exclusion from evidence of "inflammatory," "gruesome" photographs of stillborn fetus in medical malpractice action against doctor and hospital); Kelly v. Al-Qulali, 728 N.W.2d 852 (Table), 2007 WL 108462 (Iowa Ct.App.2007) (affirming discretionary exclusion from evidence of photographs of stillborn fetus offered as evidence on loss of consortium claim); Steele v. Atlanta Maternal-Fetal Medicine, P.C., 271 Ga.App. 622, 610 S.E.2d 546, 553-54 (2005) (affirming discretionary exclusion of "emotionally provocative" and "inflammatory" photographs of stillborn fetus on grounds that their "slight probative value was substantially outweighed by the danger of unfair prejudice"). Obviously, photographs of a stillborn child could have an emotional impact on almost anyone, including persons sitting on a jury. All evidence concerning the loss of a child is likely to be emotional. However, this is precisely what this case is aboutโ€” the plaintiffs' loss of companionship and society with their deceased child. The fact that the subject matter of a case is tragic does not mean that a plaintiff is not entitled to present relevant evidence to prove his or her claim. In deciding whether or not to admit such evidence, the court is required to balance the probative value of the evidence against any unfair prejudice. That is what the court did here. The court continues to believe the probative value of the three photographs of the stillborn fetus was not substantially outweighed by any unfair prejudice to the defendants. The defendants' motions for new trial on this ground are denied. L. Did the Court Err in Allowing Dr. heavy to Testify to Matters Outside of His Expert Witness Designation? The defendants argue the court admitted previously-undisclosed testimony by the plaintiffs' expert Dr. Phillip Leavy that was "critical of the hospital and its staff." Doc. No 133, ง IX(c), p. 8; see Doc. No. 136, ง I, ถ 1. They argue, "This testimony was materially prejudicial and should have been excluded pursuant to Federal Rule of Civil Procedure 37(c)(1)." In their brief, they do not specify how Dr. Leavy's testimony fell outside the scope of *929 the plaintiffs' expert witness disclosures or why the defendants were unfairly or materially prejudiced. The plaintiffs offered Dr. Leavy as an expert in emergency medicine. In his expert report, Dr. Leavy stated he would be giving the following opinions at trial: Given Ms. Heimlicher's complaints of excessive bleeding and pain upon arrival to Lakes Regional Healthcare, James O. Steele, M.D., as an emergency room physician, was negligent in failing to properly assess her condition, failing to call in an obstetrician to further evaluation [sic] her condition, and if one was not available, failing to consult with an obstetrician at another facility for guidance, failing to obtain an accurate diagnosis of her condition, including abruptio placenta, failing to order appropriate diagnostic tests, specifically laboratory studies, failing to timely consult with a radiologist to interpret the ultrasound images, failing to administer oxygen therapy, intravenous fluids, and/or blood products to a patient with a large amount of blood loss, and failing to intervene on her behalf by calling in the available medical service, specifically a general surgeon or ob/gyn, in a timely manner to perform an emergent c-section, and avoid transferring her to another facility while she was unstable. Had Dr. Steele admitted Ms. Heimlicher and acted in the above manner, this would have alerted the nursing staff and attending physicians to an abruptio placenta, such as the one that lead to the death of [the child], thereby allowing timely medical intervention to save his life. Doc. No. 117-3, ถถ 2 & 3. In the Final Pretrial Order, Doc. No. 102, the scope of his testimony was described as follows: [Dr. Leavy] will give testimony in a manner consist with his expert report, deposition testimony and the allegations outlined in plaintiff's complaint. Further that Dr. Steele was negligent and deviated from the standard of care by failing to diagnose, and treat a placental abruption; by failing to make arrangements for Mrs. Heimlicher to be promptly delivered at Lakes Regional Healthcare; by allowing Mrs. Heimlicher to be sent to a remote hospital when she was in the midst of a life threatening emergency to wit; placental abruption with non reassuring fetal heart tracings. The standard of care would have required administration of oxygen, IV fluids and blood products depending upon the lab findings. Dr. Leavy will give a more detailed opinion during his trial testimony. Doc. No. 102, pp. 4-5. In his testimony, Dr. Leavy was critical of both Dr. Steele and Lakes Hospital, as well as its staff. The defendants cite Wegener v. Johnson, 527 F.3d 687, 690 (8th Cir.2008), as support for their argument. In Wegener, the plaintiff attempted to supplement her expert witness disclosures shortly before trial, but the trial court excluded the testimony. The Eighth Circuit Court of Appeals affirmed the trial court's ruling. The court commented that "the exclusion of evidence is a harsh penalty and should be used sparingly," 527 F.3d at 692 (citing ELCA Enterprises v. Sisco Equipment Rental & Sales, 53 F.3d 186, 190 (8th Cir.1995)), but found that the trial court had not abused its discretion in excluding the testimony. The Eighth Circuit has held, "The district court has wide discretion in deciding whether to allow the testimony of witnesses not listed prior to trial, and any such decision will be overturned only if it results in a clear abuse of discretion." Long v. Cottrell, Inc., 265 F.3d 663, 668 (8th Cir.2001) (citing Boardman v. Nat'l Med. Enters., 106 F.3d 840, 843 (8th Cir. *930 1997)). "The decision whether to admit evidence is a matter peculiarly within the competence of the trial court and will not be reversed absent a clear abuse of discretion." U.S. for Use and Benefit of Treat Bros. Co. v. Fidelity & Deposit Co., 986 F.2d 1110, 1117 (7th Cir.1993). In Shuck v. CNH America, LLC, 498 F.3d 868 (8th Cir.2007), the defendant argued the testimony of an expert witness exceeded the scope of his opinion as disclosed by the plaintiffs under Federal Rule of Civil Procedure 26(a)(2)(B), and the district court should have instructed the jury not to consider certain aspects of the testimony. The Eighth Circuit affirmed the trial court's ruling that allowed testimony not previously disclosed, holding: We review the admission of expert testimony and the denial of a motion in limine for abuse of discretion. United States v. Triplett, 195 F.3d 990, 998 (8th Cir.1999); United States v. Littrell, 439 F.3d 875, 884 (8th Cir.2006). Similarly, we review for abuse of discretion a district court's election regarding how to treat evidence that was not disclosed in accordance with Rule 26(a)(2)(B). Davis v. U.S. Bancorp, 383 F.3d 761, 765 (8th Cir.2004) (applying an abuse of discretion standard to a district court's handling of a failure to disclose under Rule 26(a)(1)). Finally, we note that, under Federal Rule of Civil Procedure 37(c)(1), evidence not disclosed under Rule 26(a) is admissible if harmless. Shuck, 498 F.3d at 873-74. See The Shaw Group, Inc. v. Marcum, 516 F.3d 1061, 1068 (8th Cir.2008) (citing Allied Sys., Ltd. v. Teamsters Auto. Transp., Local 604, 304 F.3d 785, 791 (8th Cir.2002)). Most recently, in Kahle v. Leonard, 563 F.3d 736 (8th Cir.2009), the Eighth Circuit affirmed the trial court's admission of a supplemental expert report that was submitted twelve days prior to trial. A psychologist had examined the plaintiff in 2004, and had authored a report describing the plaintiff's diagnoses. Three weeks prior to trial, in early 2008, the psychologist interviewed the plaintiff again to update the report. He learned the plaintiff expected to be released from prison in two years, and his supplemental report included the estimated cost of her post-incarceration treatment. The defendant argued that because the updated report included new information (the cost estimate), it was not a supplemental report and was untimely. The trial court allowed the updated report, finding the defendant "was not prejudiced by the disclosure, as the updated report quantified a previous assessment of the need for treatment." Kahle, 563 F.3d at 741. The appellate court held admission of the report was not an abuse of discretion. Id. (citing Davis v. U.S. Bancorp, 383 F.3d 761, 765 (8th Cir.2004) ("no abuse of discretion to allow testimony when `district court reasonably found that there was no unfair surprise' about the topic of testimony"); and Farmland Indus., Inc. v. Morrison-Quirk Grain Corp., 54 F.3d 478, 482 (8th Cir.1995) ("district court did not abuse its discretion by allowing testimony when opposing party `was neither surprised nor confused at the substance' of the testimony")). The underlying principle in these cases is that the trial court has the discretion to admit or exclude such evidence based on the circumstances in each case. Here, a review of Dr. Leavy's trial testimony reveals that some of his responses on direct examination could be viewed as exceeding the scope of his Rule 26 disclosures and the Final Pretrial Order. However, a broader reading of his testimony shows the questions to which the defendants objected were asked to lay a foundation for Dr. Leavy's opinions regarding Dr. Steele's actions. For example, plaintiffs' counsel asked Dr. Leavy questions about *931 the standard of care at a community hospital with regard to a pregnant woman in Ms. Heimlicher's condition. Lakes Hospital's attorney objected on the basis that these questions were beyond the scope of Dr. Leavy's report. However, the questions related to the issue of whether Dr. Steele failed to abide by the appropriate standard of care at a community hospital in his evaluation and treatment of Ms. Heimlicher. Dr. Steele was an agent of Lakes Hospital, so testimony about his acts and omissions often implicated Lakes Hospital as well, and testimony about Hospital staff often implicated him. In their briefs, the defendants have not directed the court to a single statement or opinion by Dr. Leavy they claim surprised or prejudiced them. This likely is because much of his testimony was cumulative of evidence provided by the plaintiffs' other expert witnesses. The defendants have failed to show they were materially and unfairly prejudiced by Dr. Leavy's testimony, or that it resulted in a miscarriage of justice. The defendants' motions for new trial and for judgment as a matter of law on this ground are denied. M. Did the Plaintiffs Waive Their EMTALA Claim by Not Submitting to the Court Timely Requested Jury Instructions on the Claim? Lakes Hospital argues the court should order a new trial because the plaintiffs did not submit timely proposed EMTALA jury instructions to the court as required by the court's pretrial orders. The Hospital argues its rights were "adversely affected by the court's submission of Jury Instruction Nos. 18, 19 and 20."[24] Doc. No. 133, p. 4. The Hospital does not make any showing of how it was adversely affected by the court's submission of these instructions to the jury, nor does it cite any authorities to support this argument. When a party is ordered to submit proposed jury instructions on a claim but neglects to do so, it remains within the discretion of the trial court to instruct on the claim anyway. See Siems v. City of Minneapolis, 560 F.3d 824, 826 (8th Cir. 2009) (sanction for violation of pretrial order within discretion of trial court); Sentis Group, Inc. v. Shell Oil Co, 559 F.3d 888, 899 (8th Cir.2009) (same); Sellers v. Mineta, 350 F.3d 706, 711 (8th Cir.2003) (same). Although the court was not pleased that it was required to draft relatively novel instructions on the plaintiffs' EMTALA claim without suggestions or input from the parties, the court nevertheless did so. The court then gave the parties an opportunity to suggest changes in the instructions and, eventually, to object to them. The court believes substantial justice was accomplished by this process. "There is a strong policy favoring a trial on the merits and against depriving a party of his day in court." Fox v. Studebaker-Worthington, Inc., 516 F.2d 989, 996 (8th Cir.1975). Lakes Hospital's motions for new trial and for judgment as a matter of law on this ground are denied. N. Did the Court Err in Submitting Revised Damages Instructions to the Jury? The defendants argue a new trial should be granted because the Court erred in giving one damages instruction to the jury at the outset of the case, see Doc. No. 111, Instruction No. 22, and then giving the jury a different damages instruction at the end of the case, see Doc. No. 126, Instruction No. 22. According to the defendants, "Error occurred because the instructions were inconsistent in substance and in form, [and] were confusing, misleading, and therefore prejudicial." Doc. No. 133, p. 6; see Doc. No. 136, ง I, ถ 1. *932 The court read its instructions to the jury immediately after jury selection. Each juror was given a copy of the jury instructions to follow along as they were read, but the copies were collected by the deputy clerk of court after they were read. As the trial progressed, the court determined that Jury Instruction Nos. 22 and 23, relating to damages, needed to be revised. At the conclusion of the evidence, and immediately before argument, the court advised the jury that Jury Instruction Nos. 22 and 23 had been revised. The court then provided each juror with a revised set of the instructions, and read to the jury revised Instruction Nos. 22 and 23, along with the final jury instruction, Jury Instruction No. 28, dealing with deliberations. The jurors were allowed to keep their copies of the revised set of instructions for use during deliberations. The court has broad discretion in formulating jury instructions. B & B Hardware, Inc. v. Hargis Indus., Inc., 252 F.3d 1010, 1012-13 (8th Cir.2001). "[J]ury instructions do not need to be technically perfect or even a model of clarity." Id. The question is "whether the instructions, taken as a whole and viewed in the light of the evidence and applicable law, fairly and adequately submitted the issues in the case to the jury." Id.; see Gill v. Maciejewski, 546 F.3d 557, 564 (8th Cir.2008); Mems v. City of St. Paul, Dept. of Fire & Safety Servs., 327 F.3d 771, 781 (8th Cir. 2003). The form and language of jury instructions are committed to the sound discretion of the trial court so long as the jury is instructed correctly on the substantive issues in the case. Gross v. FBL Fin'l Servs., Inc., 526 F.3d 356, 363 (8th Cir. 2008). An appellate court reviews a trial court's jury instructions for abuse of discretion, Warren v. Prejean, 301 F.3d 893, 900 (8th Cir.2002), and will only reverse if an instructional error affected the substantial rights of the parties, Gill, 546 F.3d at 563-64; see Gasper v. Wal-Mart Stores, Inc., 270 F.3d 1196, 1200 (8th Cir.2001). The court fails to see how the jury could have been confused or misled under the circumstances in this case. At the beginning of an eight-day trial, the court read twenty-eight instructions to the jury. At the end of the trial, immediately before argument, the court advised the jurors that two of the instructions had been modified, and the court read the revised instructions to the jury. Each juror was given a complete set of jury instructions containing the two revised instructions to keep throughout deliberations. The revised instructions tracked precisely along with the verdict form, which referenced the revised damages instructions, see Doc. No. 130, p. 5, and the verdict form was properly completed by the jury at the conclusion of its deliberations. The defendants have not demonstrated that this procedure confused or misled the jury. Before reading the revised instructions to the jury, the court provided copies of the revised instructions to the lawyers for the parties, and then asked for objections. Although the lawyers asserted several substantive objections, no objection was made to the court's decision to give revised damages instructions to the jury. In particular, no lawyer complained that this procedure was confusing or misleading. Any objection to this procedure has been waived. See Cincinnati Ins. Co. v. Bluewood, Inc., 560 F.3d 798, 805 (8th Cir. 2009). The defendants' motions for new trial on this ground are denied. O. Did the Court Err in Reading the Instructions to the Jury Before Any Evidence Was Received? Lakes Hospital argues the court erred in instructing the jury on the law applicable to the case before any evidence *933 was received. Doc. No. 133-2, pp. 2-3. The Hospital argues that "by committing to substantive instructions before any evidence was received, the court cast the die and turned the presentation of the evidence into argument. The prejudicial effect of this practice occurred in this case because the court gave multiple instructions as to the duties of the hospital that likely served as a quantitative basis for the allocation of fault." Id. This objection was not made at any time during the trial, see FTR Gold recording of instruction conference, March 2, 2007, beginning at 08:19:41, so it has been waived. See Cincinnati Ins. Co., 560 F.3d at 805. In any event, Federal Rule of Civil Procedure 51(b)(3) provides that the court "may instruct the jury at any time before the jury is discharged." Cf. Seltzer v. Chesley, 512 F.2d 1030, 1034 (9th Cir.1975) ("Federal courts also follow their own rules ... in the manner and method of giving instructions to the jury."). No argument or authority has been cited by the defendants to suggest that the court committed error in instructing the jury at the beginning of the case. The defendants' motions for new trial on this ground are denied. P. Did the Court Err in Not Granting the Various Motions for Mistrial Asserted by the Defendants Throughout the Trial? The defendants asserted numerous motions for mistrial throughout the trial, all of which were denied. In his motion for new trial, Dr. Steele claims that "[m]isconduct and irregularity in the proceedings of the prevailing party, as set forth in each motion for mistrial made by Defendant during the trial, prevented the defendant from having a fair trial." Doc. No. 136, ง I, ถ 4. Lakes Hospital joins in this motion. Doc. No. 133, ง XIII. In their post-trial motions, neither defendant has cited to any particular motion for mistrial, nor has the court been provided with any new argument or authorities in support of the mistrial motions. The defendants moved for mistrial a total of ten times, with the nonmoving defendant joining in every motion. Three of the motions for mistrial were based, at least in part, on claims that "grief" evidence was improperly presented to the jury. See Trial Tr. 3-4, 833-37, 1743-44. The grief evidence issue was addressed in Section IV. J. of this ruling, supra, but the court will address these motions for mistrial separately. The first motion for mistrial based on the introduction of grief evidence was asserted during voir dire examination, after the plaintiffs' lawyer asked the prospective jurors questions relating to grief damages. Voir dire proceedings have not been transcribed, but the court recalls sustaining objections to these questions, and promptly instructing the panel that they were not to consider grief damages. In the motion, the defendants argue they were entitled to a mistrial because the plaintiffs' lawyer had "rung the bell" by mentioning grief damages, and the bell could not be "unrung." Trial Tr. 4-5. The second such motion was asserted during testimony by Mr. Heimlicher about his wife's "grief and remorse." As discussed previously in this ruling, see Section IV.J., supra, the court immediately admonished the jury not to consider this evidence. Trial Tr. 832-33.[25] The third such motion *934 was during closing arguments, when the plaintiffs' counsel read to the jury part of a poem about the loss of a child. Trial Tr. 1743-44. The court denied these three motions for mistrial, ruling in the first two instances that the court's prompt admonition was sufficient to avoid any prejudice, and in the third instance that the argument was not improper. As discussed in Section IV.J. of this ruling, supra, the jury was instructed clearly and specifically not to award grief damages. There is no evidence to show the jury did not follow these instructions. The court finds the defendants were not unfairly prejudiced in any of these three instances. The defendants also moved for mistrial during voir dire based on the plaintiffs' counsel's alleged violation of the "Golden Rule." Trial Tr. 4-5. The "Golden Rule" prohibits arguments which ask jurors to place themselves in the position of a party. The rule "is universally condemned because it encourages the jury to depart from neutrality and to decide the case on the basis of personal interest and bias rather than on the evidence." Lovett ex rel. Lovett v. Union Pac. R.R. Co., 201 F.3d 1074, 1083 (8th Cir.2000). The court recalls that the plaintiffs' counsel asked the prospective jurors what they thought would be a fair amount of money in a case like this, and then asked how they might feel if they lost a child. The court recalls that the questions were general in nature, and did not purport to reflect the actual facts of this case. The court also recalls that to the extent proper objections were made to the questions, the objections were sustained. Questions asked during voir dire are not argument, so the "Golden Rule" arguably did not even apply. See Jury Instruction No. 6 ("Statements, arguments, questions, and comments by the lawyers [are not evidence]."). To the extent the "Golden Rule" did apply, the defendants were not unfairly prejudiced by the plaintiffs' counsel's voir dire questions. Near the end of his final argument, the plaintiffs' counsel stated, "And I don't think two million dollars is at all out of the question. But you, ladies and gentlemen, decide what you think is appropriate. What would it be if it were one of their children [referring to defense counsel] taken because of malpractice?" Trial Tr. 1742-43. The court immediately struck the last remark, and directed the jury to disregard it. Trial Tr. 1743. The defendants moved for mistrial based on this remark.[26]Id. The remark was inappropriate, and was stricken promptly by the court. The court finds there was no prejudice to the defendants from the remark. The defendants moved for mistrial because the plaintiffs' counsel used the names of the defense attorneys in framing questions to witnesses concerning what the attorneys had said during their opening statements. The court sustained objections to these questions, and when counsel continued with this practice, the court directed him to stop. Trial Tr. 646-47, 664-65, 670-72. The court finds there was no prejudice to the defendants from these incidents. The next motion for mistrial was based on the argument that Dr. Leavy testified *935 about matters that had not been disclosed in his Rule 26 report. This argument was addressed in Section IV.L. of this ruling, supra. Two more motions for mistrial were made during Mr. Heimlicher's testimony. At one point, he testified that one of their children suffered from cystic fibrosis. His counsel then asked him to tell the jury about cystic fibrosis. There were no objections to the question. Trial Tr. 818. After Mr. Heimlicher testified that the child had an uncertain prognosis, Lakes Hospital's attorney objected, and the objection was sustained. Id. No motion to strike was asserted, but counsel asked to "reserve a motion later." Id. At another point in Mr. Heimlicher's testimony, he stated his two children were excited when Ms. Heimlicher was expecting, and "they always used to kiss [Ms. Heimlicher's] belly." Trial Tr. 792. After this testimony, Lakes Hospital's lawyer stated he was "reserv[ing] the motion." Id. At the recess, both defense counsel moved for mistrial based on these two answers by Mr. Heimlicher. Trial Tr. 798, 809, 828. The court denied the motions, and the following morning gave the jury a cautionary instruction. Doc. No. 119; Trial Tr. 815-16. The court finds that the cautionary instruction prevented any prejudice to the defendants from Mr. Heimlicher's responses. Later in the testimony of Mr. Heimlicher, his counsel asked, "Is there any amount of money that to you would replace [the child] in your life?" Trial Tr. 834. Lakes Hospital's attorney objected to the question, and the objection was sustained. Id. Motions for mistrial were asserted based on this unanswered question, and the motions were denied. Trial Tr. 835-36. The jury was instructed at the beginning of the trial that questions by the lawyers were not evidence. Jury Instruction No. 6. The court finds the defendants were not prejudiced by this question. The final motion for mistrial was asserted during the plaintiffs' attorney's final argument. See Trial Tr. 1738. The attorney made the following statements: Where would the average American citizen be in the civil justice if they didn't have the ability to hire an attorney who could hire experts to present their case for them? You would be disenfranchised, you would be out of court, and that's what they want because they don't want accountability. Trial Tr. 1737. The court immediately struck the last remark. Id. In their motions for mistrial, defense counsel asserted that this remark was "obviously a reference to insurance." Trial Tr. 1738. Of course, any such reference would have been improper. See, e.g., Halladay v. Verschoor, 381 F.2d 100, 112 (8th Cir.1967) ("Under the general rule, the fact that [a party] is protected by insurance or other indemnity cannot be shown.") (citing, inter alia, Kester v. Travelers Indem. Co., 257 Iowa 1146, 136 N.W.2d 261, 264 (1965)). The court denied the motions, finding that the remark, while inappropriate, was not a reference to insurance, and would not have been construed as such by the jury. Instead, the court found that the remark was an ill-advised attempt at responding to attacks on the plaintiffs' expert witnesses, which was the primary focus of the defense attorneys' closing arguments. The attorney for Dr. Steele stated the following during his closing argument: I don't care if we're talking about plaintiff's experts, defendant's experts, any experts, it is, ladies and gentlemen, a huge industry. The experts that the plaintiff called in this caseโ€”and they are [plaintiffs' counsel's] celebrity Aโ€”team *936 of experts, have worked for him collectively, between the experts he called, in over 100 cases. We're talking about huge money. And we're not just talking about [plaintiffs' attorney] using these people in case after case after case after case. We're talking about them being used by lawyers everywhere, 40 some states. It's huge money. Could you question the plaintiffs' experts with those credentials? Well, did you think to yourself at any point in time, wow, I mean these people have testified a bunch for [plaintiffs' attorney]. He seems to use them a lot. He's paying them a lot of money. Is that the way it works? I mean we haven't been jurors. Is that the way it works? Oh, yeah. Oh, yeah, that's the way it works, if you let it. If you let it work that way, that's exactly the way it works. Trial Tr. 1676-67 (emphasis added). The attorney for Lakes Hospital stated the following during his closing argument: I want you to reflect on every witness for the plaintiff who rolled into Sioux City and gave their testimony. Every one of them, every one of them is a frequent flier. And if the suggestion that they're professional witnesses is extreme, place that blame on me, but reflect on the fact that some of these people make well in excess of $125,000 a year coming in here and telling you these things. Trial Tr. 1695-96 (emphasis added). And I started to tell you a little bit about my recollection of what these individuals said, these experts, these people who go from courthouse to courthouse, in case after case after case, with the same attorney, same types of cases, and they put on their evidence. And when they leave here from Sioux City, when they leave here last week, this week, they're going to show up in another place down the road, the same team, making the same objections, making the same testimony, making the same amount of money. It's an industry. It's an industry of people out there that are trying to take away the ability for jurors like you to establish what is the appropriate standard of care by invoking their opinions, based on money, based on their experiences in the courtroom. Trial Tr. 1698 (emphasis added). But you should really question what's that all about? Is that part of this subindustry out there that we have now seen and learned that is involved in cases like this? Trial Tr. 1702 (emphasis added). While the plaintiffs' attorney's remark was inappropriate, it was obvious to the court that it was in response to the argument by the defendants' attorneys that the plaintiff's experts were part of an "industry," and not an improper insertion of insurance into the case. Finally, the defendants argue that the errors raised in the mistrial motions, cumulatively if not individually, resulted in an unfair trial. Even when individual errors are deemed harmless, their cumulative effect may result in an unfair trial. See United States v. Eizember, 485 F.3d 400, 405 (8th Cir.2007). "Evidentiary errors affect a party's substantial rights when the cumulative effect of the errors is to substantially influence the jury's verdict." Williams v. City of Kansas City, Mo., 223 F.3d 749, 755 (8th Cir.2000) (citing Nichols v. Am. Nat'l Ins. Co., 154 F.3d 875, 889 (8th Cir.1998)). However, a "`[c]umulative-error analysis should evaluate only the effect of matter determined to be in error, not the cumulative effect of non-errors.'" United States v. Vining, 224 Fed.Appx. 487, 498 (6th Cir.2007) (quoting McKinnon v. Ohio, No. 94-4256, 1995 WL 570918, at *12 (6th Cir. Sept.27, *937 1995) (unpublished case), in turn quoting United States v. Rivera, 900 F.2d 1462, 1471 (10th Cir.1990)). This is especially true here, where many of the defendants' claims of error border on the frivolous. The court finds that none of the matters raised in the defendants' multiple motions for mistrial, either separately or in combination, affected the defendants' substantial rights or resulted in a miscarriage of justice. See Littleton v. McNeely, 562 F.3d 880, 888 (8th Cir.2009) (even if court's evidentiary rulings were abuse of discretion, any error must affect a party's substantial rights to warrant new trial). The motions for mistrial were denied properly during the trial, and the defendants' motions for new trial and for judgment as a matter of law on these grounds are denied. Q. Was the Verdict Irrational, Arbitrary, Excessive, or Unjust? The jury awarded the plaintiffs a total of $1,710,000 in damages for loss of parental consortium. The defendants argue this amount "is so excessive that it manifests an arbitrary verdict based on sympathy and grief and mental anguish for loss of a child, in contravention of Jury Instruction No. 22." Doc. No. 134, ถ 1. They also contend the verdict was irrational, arbitrary, excessive, and unjust. Doc. No. 133, งง X, XI, & XII; Doc. No. 134; Doc. No. 136, ง I, ถ 1; Doc. No. 136-2, pp. 1-3; Doc. No. 139. The plaintiffs disagree. The defendants specifically challenge four components of the verdict: (a) the award of $500,000 for past loss of companionship and society ($300,000 to Ms. Heimlicher and $200,000 to Mr. Heimlicher); (b) the deduction of only $10,000 for past expenses attributable to raising the child ($6,000 for Ms. Heimlicher and $4,000 for Mr. Heimlicher); (c) the award of $1,300,000 for future loss of services, companionship, and society, from the date of the verdict until the child would have reached the age of eighteen ($780,000 to Ms. Heimlicher and $520,000 to Mr. Heimlicher); and (d) the deduction of only $100,000 for future expenses attributable to raising the child ($60,000 for Ms. Heimlicher and $40,000 for Mr. Heimlicher). Id., ถ 1(A)-(D). The court first must determine whether state or federal law controls this issue. The court has jurisdiction in this case because the plaintiffs' EMTALA claims present a federal question. 28 U.S.C. ง 1331. EMTALA provides that damages for violation of the Act are "those damages available for personal injury under the law of the State in which the hospital is located[.]" EMTALA ง (d)(2)(A). Therefore, Iowa law applies to the plaintiffs' damages claim under EMTALA. Damages for the state-law negligence claims also are determined by Iowa law. Thus, Iowa law provides the rules for determining damages for all of the plaintiffs' claims in this case. "In cases in which the federal rule for determining damages is furnished by state law, ... the federal rule for determining excessiveness [of a jury award] is also furnished by state law." E.T. Holdings, Inc. v. Amoco Oil Co., 1998 WL 34113907 at *15 (N.D.Iowa, Dec. 27, 1998) (Melloy, C.J.) (citing Gasperini v. Center for Humanities, Inc., 518 U.S. 415, 116 S.Ct. 2211, 135 L.Ed.2d 659 (1996); Johnson v. Cowell Steel Structures, Inc., 991 F.2d 474, 477 (8th Cir. 1993); 12 Moore's Federal Practice ง 59.13[2][g][iii][C] (3d ed.1998)). Accordingly, Iowa law controls the issue of whether the jury's verdict was excessive. In Triplett v. McCourt Manufacturing Corp., 742 N.W.2d 600 (Iowa Ct. App.2007), the court explained the test for reviewing a jury verdict under Iowa law: *938 Because fixing the amount of damages is a function for the jury, we are "loath to interfere with a jury verdict." Sallis v. Lamansky, 420 N.W.2d 795, 799 (Iowa 1988). In considering a contention that the jury verdict is excessive, the evidence must be viewed in the light most favorable to the plaintiff. Id. The verdict must not be set aside merely because the reviewing court would have reached a different conclusion. Id. When considering a remittitur, we will reduce or set aside a jury award only if it is: (1) flagrantly excessive or inadequate; (2) so out of reason as to shock the conscience; (3) a result of passion, prejudice, or other ulterior motive; or (4) lacking in evidentiary support. Spaur v. Owens-Corning Fiberglas Corp., 510 N.W.2d 854, 869 (Iowa 1994). If a verdict meets this standard or fails to do substantial justice between the parties, the district court must grant a new trial or enter a remittitur. Id. Triplett, 742 N.W.2d at 602-03. See Shehata v. Landau, 759 N.W.2d 812 (Table), 2008 WL 4725150 at *3 (Iowa Ct.App.2008) (same). The court must "consider whether the verdict is so excessive as to raise a presumption that it was motivated by passion or prejudice on the part of the jury." WSH Properties, L.L.C. v. Daniels, 761 N.W.2d 45, 50 (Iowa 2008). "[A] flagrantly excessive verdict raises a presumption that it is the product of passion or prejudice." Id. (citations omitted). However, "not every excessive verdict results from passion or prejudice." Id. (citing Miller v. Town of Ankeny, 253 Iowa 1055, 1063, 114 N.W.2d 910, 915 (1962); Curnett v. Wolf, 244 Iowa 683, 689, 57 N.W.2d 915, 919 (1953)); accord 58 Am.Jur.2d New Trial ง 313, at 313 (2002) ("[T]he fact that a damage award is large does not in itself... indicate that the jury was motivated by improper considerations in arriving at the award."). The trial court "`has had the benefit of hearing the testimony and of observing the demeanor of the witnesses and... knows the community and its standards.'" St. John v. United States, 240 F.3d 671, 678 (8th Cir.2001) (quoting Solomon Dehydrating Co. v. Guyton, 294 F.2d 439, 447 (8th Cir.1961)); accord McCabe v. Mais, 602 F.Supp.2d 1025, 1030 (N.D.Iowa 2008). Therefore, a trial court's assessment of a damages award is reviewed for abuse of discretion under a deferential standard, "unless there is plain injustice or a monstrous or shocking result." Id. (internal quotation marks omitted) (citing Solomon Dehydrating Co., 294 F.2d at 448; Gasperini v. Center for Humanities, Inc., 518 U.S. 415, 434-35, 116 S.Ct. 2211, 2223, 135 L.Ed.2d 659 (1996)); see also Jasper v. H. Nizam, Inc., 764 N.W.2d 751, 772 (Iowa 2009). The defendants assert that "[i]n substance the jury was asked to quantify the immeasurable." Doc. No. 134, ถ 2. In principle, the court agrees with this assertion. "[T]he assessment of damages is especially within the jury's sound discretion when the jury must determine how to compensate an individual for an injury not easily calculable in economic terms." Stafford v. Neurological Med., Inc., 811 F.2d 470, 475 (8th Cir.1987); see E.E.O.C. v. Convergys Customer Mgmt. Group, Inc., 491 F.3d 790, 798 (8th Cir.2007) (same). The jury was, however, presented with evidence from which it could determine the amount of the Heimlicher's damages. The Heimlichers testified about their relationships with their other children, and about their plans for interacting with the deceased child. They also testified about their own background, interests, and personalities. This testimony provided the jury with important evidence regarding what the Heimlichers' relationship likely *939 would have been with their deceased son. See Pagitt, 206 N.W.2d at 703-04. The plaintiffs did not offer any evidence on the past or future expenses for the child's board or maintenance, but this is not fatal to their claims. In Haumersen v. Ford Motor Co., 257 N.W.2d 7 (Iowa 1977), the Iowa Supreme Court affirmed an award of damages for the loss of services, companionship, and society of a child even though no evidence was presented by either the plaintiffs or the defendant on the cost of raising the child. The court reasoned as follows: The first question for consideration is whether plaintiffs should be barred from receiving any award for loss of services where no evidence appears in the record as to the cost of maintaining decedent through his minority. The present value of such costs are to be deducted from recovery, but does a plaintiff have an affirmative duty to present evidence of such costs and can a defendant fail to present such evidence himself and still object on this ground on appeal? Other jurisdictions have considered this question and concluded that absence of evidence as to the cost of maintenance does not bar recovery for loss of services. [Citations omitted.] We hold the following language to be controlling, from Smyth v. Hertz Driv-Ur-Self Stations, Inc., [93 S.W.2d 56,] 60 [(Mo.Ct.App. 1936) ]: Appellant also complains of the fact that there was no evidence from which the jury might have estimated the cost of the support of plaintiffs' minor son until he would have attained his majority, and consequently urges that for want of such evidence the instruction served to give the jury a roving commission to assess such damages as they might see fit without proper regard to the compensatory nature of the award. In other words, while conceding, as it must, that the basis laid down for the assessment of damages was correct (Oliver v. Morgan (Mo.), 73 S.W.2d 993), it complains of the lack of evidence to have enabled the jury to make application of the measure of damages announced in the instruction, and insists not only that the burden was upon plaintiffs to have furnished proof affording a reasonable basis for the jury's finding, but also that such proof was of a character to have been capable of reasonable ascertainment. We do not believe that there is any merit to this contention. Obviously there could have been no accurate proof of what it would have cost to have supported plaintiffs' son until he would have reached his majority. In the very nature of things this element of the case was problematical, depending upon circumstances which no one could have foreseen with absolute certainty. Plaintiffs might indeed have attempted to estimate such cost, but for that matter, so could the jurors themselves, who are presumed to have been reasonable men, acquainted with the ordinary affairs of life, and doubtless as well informed as plaintiffs themselves regarding the expenses reasonably incident to the support of a boy of the age of the deceased. Furthermore it is to be borne in mind that though this feature of the case was one which was calculated only to reduce the damages, appellant nevertheless made no attempt to make any showing upon it.... * * * A jury is in a better position than a court to take on the difficult task of placing a dollar amount o[n] the loss of services, companionship, and society of a child. The verdict in this case, although large, does not shock the conscience or go beyond the bounds of the evidence. *940 We are not willing to disturb the finding of the jury. Haumersen, 257 N.W.2d at 17-19. The jury awarded $300,000 to Ms. Heimlicher and $200,000 to Mr. Heimlicher for past loss of consortium during the five years prior to the date of the verdict. This breaks down to $60,000 per year for Ms. Heimlicher and $40,000 per year for Mr. Heimlicher. The jury further awarded $780,000 to Ms. Heimlicher and $520,000 to Mr. Heimlicher for future loss of consortium. The jury used the same per-year figures to reach these amounts; i.e., $60,000 per year for Ms. Heimlicher and $40,000 per year for Mr. Heimlicher. A parent's relationship with a child is perhaps the most special relationship that exists between human beings. Parents delight in their children's first words, first steps, and first day at school. They share the joys and woes of their children's successes and failures in school, sports, and relationships, and hold their breath as their children learn to drive, fall in love, and go off to school or work. The dollar value of these experiences is, as the defendants point out, almost immeasurable. The court agrees with the Haumersen court's analysis that the jury is in a better position than a court to take on this difficult task. The court finds the amount awarded to the Heimlichers for past and future loss of consortium was not "so excessive as to raise a presumption that it was motivated by passion or prejudice on the part of the jury." WSH Properties, L.L.C. v. Daniels, 761 N.W.2d 45, 50 (Iowa 2008). However, the jury's determination of past and future costs of raising the child is not supported by the record. The jury deducted $10,000 ($6,000 assessed to Ms. Heimlicher and $4,000 to Mr. Heimlicher) for the child's board and maintenance for the five years preceding the date of the verdict, and $100,000 ($60,000 assessed to Ms. Heimlicher and $40,000 to Mr. Heimlicher) for the child's board and maintenance for the thirteen years from the date of the verdict until the child would have reached his majority. These figures represent 10% of each award of damages. For the five years preceding the trial, the $10,000 deduction amounts to only $2,000 per year as the cost of raising the child. This is far below what would be a reasonable annual cost to raise a child. Similarly, for the thirteen years from the date of the verdict to the child's majority, the $100,000 deduction amounts to only $7,692.31 per year to raise the child. Although more reasonable than $2,000 per year, the court again finds this amount is far below what would be the expected reasonable annual cost to raise a child from age five years to age eighteen years. The court does not believe the jury was acting out of passion or prejudice when it underestimated the deductions for past and future expenses to raise the child. Instead, it appears the jury calculated these deductions by simply taking a flat percentage of the damages. This process resulted in deductions that were too low. It also resulted in a disproportionate share of the costs being assigned to Ms. Heimlicher instead of Mr. Heimlicher.[27] Because the award of damages to Ms. Heimlicher was larger, the jury assigned to her a larger percentage of the expenses. The jury made these mistakes because it calculated the expenses "arbitrarily," in contravention of Jury Instruction No. 22. Under these circumstances, the court may grant the defendants a new trial, or the court may "conditionally grant a motion for new trial but allow plaintiff[s] to avoid a new trial if plaintiff'[s] agree[] to *941 remit an amount of damages as determined by the Court." Shepard v. Wapello County, Iowa, 303 F.Supp.2d 1004, 1024 (S.D.Iowa 2003) (citing Hetzel v. Prince William County, Va., 523 U.S. 208, 211, 118 S.Ct. 1210, 1211, 140 L.Ed.2d 336 (1998); Donovan v. Penn Shipping Co., 429 U.S. 648, 648-49, 97 S.Ct. 835, 836, 51 L.Ed.2d 112 (1977); Thorne v. Welk Investment, Inc., 197 F.3d 1205, 1212 (8th Cir.1999)). The court has decided remittitur is appropriate in this case. Although consideration of whether the damages award was excessive was based on Iowa state law, "[a] decision to grant remittitur `is a procedural matter governed by federal, rather than state law.'" Taylor v. Otter Tail Corp., 484 F.3d 1016, 1018-19 (8th Cir.2007) (quoting Parsons v. First Investors Corp., 122 F.3d 525, 528 (8th Cir. 1997)). A trial court's grant of remittitur is reversed only "`for a manifest abuse of discretion,'" id., 484 F.3d at 1019 (quoting Peoples Bank & Trust Co. v. Globe Int'l Publishing, Inc., 978 F.2d 1065, 1070 (8th Cir.1992)), based on "whether the remittitur was ordered for an amount less than the jury could reasonably find." Id. (quoting Slatton v. Martin K. Eby Constr. Co., 506 F.2d 505, 508-09 (8th Cir.1974)). In their testimony, the plaintiffs described an active lifestyle and an upscale standard of living. The court has some idea of what the reasonable costs would be to raise a child in such an environment. For general reference, the court has looked at estimates provided by the United States Department of Agriculture for the costs of raising children. For a third child raised in a household located in the Midwest, which includes Iowa, the expected annual cost to raise the child is $11,673.[28] This amount takes into consideration the costs of housing, food, transportation, clothing, health care, child care and education, and other miscellaneous expenses. The court finds that the appropriate deduction for the past costs of raising the child is $70,000, of which the court allocates $28,000 to Ms. Heimlicher and $42,000 to Mr. Heimlicher. The court finds that the appropriate deduction for the future costs of raising the child is $200,000, of which the court allocates $80,000 to Ms. Heimlicher and $120,000 to Mr. Heimlicher. In the jury verdict, Ms. Heimlicher was awarded net past damages of $294,000[29] and net future damages of $732,000,[30] for a total of $1,026,000. Mr. Heimlicher was awarded net past damages of $196,000[31] and net future damages of $488,000,[32] for a total of $684,000. This accounts for the total of $1,710,000 in damages awarded by the jury. Adjusting these calculations to reflect the increased costs of raising the child determined by the court, Ms. Heimlicher should have been awarded net past damages of $272,000[33] and net future damages of $712,000,[34] for a total of $984,000. Mr. Heimlicher should have been awarded net past damages of $158,000[35] and net future damages of $408,000,[36] for a total of *942 $566,000. This would have the effect of reducing the total net damages awarded to the plaintiffs by $160,000, from $1,710,000 to $1,550,000. Accordingly, the defendants' motions for new trial on the ground that the jury's verdict was excessive are conditionally granted. However, the court finds the issue of the amount of damages is distinct and separable from the liability issues, such that a new trial solely on the issue of damages may be had without injustice. Thus, a new trial, if one is had, will be limited to the issue of damages. See Gasoline Products Co. v. Champlin Refining Co., 283 U.S. 494, 499, 51 S.Ct. 513, 515, 75 L.Ed. 1188 (1931); Burke v. Deere & Co., 6 F.3d 497, 513 (8th Cir.1993). The plaintiffs may avoid a new trial by consenting to a remittitur of damages in the following amounts: Ms. Heimlicher must remit $22,000 for past damages and $20,000 for future damages. Mr. Heimlicher must remit $38,000 for past damages and $80,000 for future damages. By May 25, 2009, the plaintiffs must file a notice in this case advising the court and the defendants as to whether they will consent to or reject the entry of a remittitur order.[37] The court reserves ruling on the defendants' motions to amend judgment, Doc. Nos. 134 & 139, pending the plaintiffs' decision on remittitur. V. CONCLUSION For the reasons stated, the court conditionally grants the defendants' motions for new trial, Doc. Nos. 133 & 136 (in part); reserves ruling on the defendants' motions to amend judgment, Doc. Nos. 134 & 139; and denies the defendants' motions for judgment as a matter of law, Doc. Nos. 132 & 136 (in part).[38] IT IS SO ORDERED. APPENDIX *943 DEFENDANTS' JOINT EXHIBIT H *944 PLAINTIFFS' EXHIBIT 5 *945 JOINT EXHIBIT 50, PAGE 15 *946 INSTRUCTION NO. 13 NEGLIGENCEโ€”DUTY OF CARE For a physician, "negligence" means the failure to use the degree of skill, care, and learning ordinarily possessed and exercised by other physicians in similar circumstances. The locality of practice in question is one circumstance to take into consideration but is not an absolute limit upon the skill required. A physician's conduct must be viewed in light of the circumstances existing at the time of diagnosis and treatment, and not retrospectively. If a physician exercised a reasonable degree of care and skill under the circumstances as they existed, though not as seen in perfect hindsight, then the physician is not negligent. For a hospital, negligence means the failure to use the degree of skill, care, and learning ordinarily possessed and exercised by other hospitals in similar circumstances. INSTRUCTION NO. 15 CLAIM AGAINST DR. STEELE FOR LOSS OF PARENTAL CONSORTIUM For a plaintiff to recover on his or her claim against James 0. Steele, M.D., for loss of parental consortium, the plaintiff must prove all of the following propositions: 1. Dr. Steele was negligent in one or more of the following ways: a. failing to recognize Ms. Heimlicher's need for an emergency delivery; b. transferring Ms. Heimlicher to Sioux Valley Hospital without first determining that her medical condition and the medical condition of the unborn child were not likely to materially deteriorate during the transfer. 2. Dr. Steele's negligence was a proximate cause of the still birth of the child and of the plaintiffs damages. 3. The amount of the plaintiffs damages. If a plaintiff has proved all of these propositions with respect to Dr. Steele, then that plaintiff is entitled to recover damages from Dr. Steele in some amount. If a plaintiff has failed to prove any of these propositions, then that plaintiff is not entitled to recover damages from Dr. Steele. INSTRUCTION NO. 16 CLAIM AGAINST HOSPITAL FOR LOSS OF PARENTAL CONSORTIUM For a plaintiff to recover on his or her claim against Dickinson County Memorial Hospital for loss of parental consortium, the plaintiff must prove all of the following propositions: 1. The hospital was negligent in one or more of the following ways: a. failing to recognize Ms. Heimlicher's need for an emergency delivery; b. transferring Ms. Heimlicher to Sioux Valley Hospital without first determining that her medical condition and the medical condition of the unborn child were not likely to materially deteriorate during the transfer. 2. The hospital's negligence was a proximate cause of the still birth of the child and of the plaintiffs damages. *947 3. The amount of the plaintiffs damages. If a plaintiff has proved all of these propositions with respect to the hospital, then that plaintiff is entitled to recover damages from the hospital in some amount. If a plaintiff has failed to prove any of these propositions, then that plaintiff is not entitled to recover damages from the hospital on this claim. INSTRUCTION NO. 17 LIABILITY OF HOSPITAL CORPORATION Dickinson County Memorial Hospital is a corporation. Although a corporation often is treated under the law as if it were a person, a corporation can act only through its employees, officers, directors, and agents. Therefore, a corporation is held responsible under the law for the acts or omissions of its employees, officers, directors, and agents performed within the scope of their authority. Employees, officers, directors, and agents of a corporation are acting "within the scope of their authority" only when they are engaged in the performance of duties expressly or impliedly assigned to them by the corporation. Unless you are instructed otherwise, a corporation is not responsible for the acts or omissions of its employees, officers, directors, or agents performed outside the scope of their authority. Generally, a doctor or other health care provider who is not employed by a hospital is not an agent of the hospital, even if the doctor or the other health care provider uses the facilities of the hospital. However, a hospital emergency room patient ordinarily looks to the hospital for care, and not to the individual physician or other health care provider, and accepts the care provided by the physician or health care provider assigned to her case. A hospital is liable for the actions of a non-employee physician or other health care provider providing services to a hospital emergency room patient when all of the following is proven: 1. The hospital, by its actions, holds out the physician or other health care provider as its agent or employee; 2. The patient looks to the hospital for care, and not to the individual physician or other health care provider; 3. The patient has no control over the assignment of the physician or other health care provider to provide treatment or services to her; 4. The patient receives treatment or services from the physician or other health care provider in the reasonable belief that the treatment or services are being rendered on behalf of the hospital; and 5. The patient accepts the treatment or services in reliance on the belief that the treatment or services are being rendered on behalf of the hospital. INSTRUCTION NO. 18 THE EMERGENCY MEDICAL TREATMENT AND ACTIVE LABOR ACT The plaintiffs allege a claim against Dickinson County Memorial Hospital pursuant to the Emergency Medical Treatment and Active Labor Act, a federal law known as "EMTALA." Under EMTALA, if an individual comes to a hospital's emergency department and requests examination or treatment, then the hospital must provide for an appropriate medical screening examination within the capability of the hospital's emergency *948 department to determine whether or not the individual is suffering from an emergency medical condition. In the case of a pregnant woman, the term "emergency medical condition" includes: 1. a medical condition manifesting itself by acute symptoms of sufficient severity, including severe pain, such that the absence of immediate medical attention could reasonably be expected to result in placing the health of the woman or her unborn child in serious jeopardy; and 2. when there is inadequate time to effect a safe transfer of the woman to another hospital before delivery or when the transfer may pose a threat to the health or safety of the woman or the unborn child. If a pregnant woman suffering from an emergency medical condition comes to a hospital, then the hospital must provide necessary treatment to "stabilize" the woman. With respect to paragraph (1), above, the term "stabilize" means to provide such medical treatment as may be necessary to assure, within reasonable medical probability, that no material deterioration of the condition is likely to result from, or occur during, the transfer. With respect to paragraph (2), above, the term "stabilize" means to wait until the woman has delivered the child. A hospital cannot transfer a pregnant woman who is having contractions to another hospital if there is not enough time for her to be transferred safely before delivery, or if the transfer could pose a threat to the health or safety of the woman or the unborn child. A hospital may transfer a pregnant woman suffering from an emergency medical condition even if her condition has not been stabilized if a physician signs a certification that the medical benefits reasonably expected from the transfer outweigh the increased risks from the transfer to the woman and the unborn child. Before signing such a certification, the physician has a duty to deliberate and weigh the medical risks and benefits of the transfer. INSTRUCTION NO. 19 CLAIM AGAINST HOSPITAL UNDER EMTALA For a plaintiff to recover on his or her EMTALA claim against Dickinson County Memorial Hospital, the plaintiffs must prove all of the following propositions: 1. Ms. Heimlicher came to Dickinson County Memorial Hospital on the evening of February 11, 2004, suffering from an emergency medical condition. 2. The hospital knew Ms. Heimlicher was suffering from an emergency medical condition. 3. The hospital transferred Ms. Heimlicher to Sioux Valley Hospital without first making a reasonable determination that her emergency medical condition had stabilized. 4. The transfer of Ms. Heimlicher to Sioux Valley Hospital was a proximate cause of the plaintiffs damages. 5. The amount of the plaintiffs damages. If a plaintiff has proved all of these propositions, then that plaintiff is entitled to recover damages on his or her EMTLA claim against the hospital, unless the hospital proves its "certification" defense, as described in Instruction No. 20. If a plaintiff has failed to prove any of these propositions, then that plaintiff is not entitled to recover on his or her EMTALA claim against the hospital. *949 INSTRUCTION NO. 20 CERTIFICATION DEFENSE To prove its "certification" defense under EMTALA claim, Dickinson County Memorial Hospital must prove both of the following propositions: 1. A physician who was acting as an agent or employee of the hospital signed a certification that the medical benefits reasonably expected from the transfer of Ms. Heimlicher from Dickinson County Memorial Hospital to Sioux Valley Hospital in Sioux Falls, South Dakota, outweighed the increased risks from the transfer to her and the unborn child; and 2. Before signing the certification, the physician deliberated and weighed the medical risks and benefits of the transfer, and made a reasonable determination, based on the information available to him at that time, that the medical benefits reasonably expected from the transfer outweighed the increased risks from the transfer to Ms. Heimlicher and the unborn child. If the hospital has proved both of these propositions, then the plaintiffs are not entitled to recover on their EMTALA claim against the hospital. INSTRUCTION NO. 22 DAMAGES If you find a plaintiff is entitled to recover damages, it is your duty to determine the amount. In doing so, you must consider only the following items: a. The reasonable value to the plaintiff of future loss of services of the child, from the present time until the child would have reached the age of eighteen years. Loss of services includes both the amount the child would have earned and the economic or financial value of the child's labor at home. b. The reasonable value to the plaintiff of past loss of companionship and society of the child, from the date of death to the present time. c. The reasonable value to the plaintiff of future loss of companionship and society of the child, from the present time until the child would have reached the age of eighteen years. d. The past probable and reasonable expense to the plaintiff of the child's board and maintenance, from the date of death to the present time. e. The future probable and reasonable expense to the plaintiff of the child's board and maintenance, from the present time until the child would have reached the age of eighteen years. Damages for future loss of services (item "a," above) are to be reduced to their present value. For this purpose, "present value" is the sum of money received now that, together with interest earned on the money in the future at a reasonable rate of return, would equal the present total of all of the future receipts. Future expense for board and maintenance (item "e," above) also are to be reduced to present value. For this purpose, "present value" is the sum of money received now that, together with interest earned on the money in the future at a reasonable rate of return, would equal the present total of all of the future expenses. Damages for companionship and society are not to be reduced to present value. If you award damages to one of the plaintiffs and reduce those damages by expenses of the child's board and maintenance, you are not to reduce any damages *950 you award to the other plaintiff by those same expenses. In other words, you are not to "double count" the expenses of the child's board and maintenance. The plaintiffs are not entitled to recover damages for pain, suffering, grief, or mental anguish from the loss of the child. They also are not entitled to recover damages for the delivery or for recuperation following delivery. The amount you assess for loss of services, companionship, and society in the past and future cannot be measured by any exact or mathematical standard. You must use your sound judgment based upon an impartial consideration of the evidence. Your judgment must not be exercised arbitrarily, or out of sympathy or prejudice for or against the parties. The amount you assess for any item of damages must not exceed the amount caused by the defendants as proved by the evidence. NOTES [1] Although an ultrasound test cannot rule out a placental abruption, in some cases it can confirm one. The plaintiffs' expert radiologist testified the ultrasound images taken on February 11, 2004, showed that Ms. Heimlicher's placenta was massively abrupting. [2] A copy of Jury Instruction No. 18 is attached to this ruling. [3] These elements are substantially the same as those submitted to the jury in the present case. See Jury Instruction Nos. 19 & 20, copies of which are attached to this ruling. [4] This instruction describes the liability of a hospital for the acts and omissions of its employees, officers, directors, and agents. A copy of Jury Instruction No. 17 is attached to this ruling. [5] Copies of these exhibits are attached to this ruling. [6] A complete copy of Jury Instruction No. 19, in which the court describes the elements of the plaintiffs' EMTALA claim, is attached to this ruling. [7] The doctor cannot be held liable under subsection (d)(2)(A) of the Act. As this court has previously held, "EMTALA does not provide a cause of action for damages against an individual physician." Heimlicher v. Steele, 442 F.Supp.2d 685, 692 (N.D.Iowa 2006). [8] A copy of Jury Instruction No. 15 is attached to this ruling. [9] A copy of Jury Instruction No. 13, describing a physician's duty of care, is attached to this ruling. [10] In Jury Instruction No. 16, the court instructed the jury in paragraph 1(a) that the Hospital could be found negligent for "failing to recognize Ms. Heimlicher's need for an emergency delivery," and in paragraph 1(b) for "transferring Ms. Heimlicher to Sioux Valley Hospital without first determining that her medical condition and the medical condition of the unborn child were not likely to materially deteriorate during the transfer." A copy of Jury Instruction No. 16 is attached to this ruling. [11] Section (f) of the Act provides, "The provisions of this section do not preempt any State or local law requirement, except to the extent that the requirement directly conflicts with a requirement of this section." [12] Subsection (d)(2)(A) of the Act provides, "Any individual who suffers personal harm as a direct result of a participating hospital's violation of a requirement of this section may, in a civil action against the participating hospital, obtain those damages available for personal injury under the law of the State in which the hospital is located, and such equitable relief as is appropriate." [13] See Trial Tr. at 452. [14] In Jury Instruction No. 17, the court explained that a hospital is responsible under the law for the acts or omissions of its employees, officers, directors, and agents performed within the scope of their authority, and under certain circumstances a hospital also may be responsible for the acts or omissions of a doctor, such as an emergency room physician, who is not an employee or agent of the hospital. [15] Lakes Hospital objected to Jury Instruction No. 17 as an "expansion of the law of agency," not because it might have misled the jury into assigning Lakes Hospital "double fault" based on the combination of its own negligence and the negligence of the emergency room doctor. See FTR Gold recording of instruction conference, March 2, 2007, at 9:07:00. If Lakes Hospital had made this "double fault" objection at trial, the court could have addressed the issue with a further instruction. See Doyne v. Union Electric Co., 953 F.2d 447, 450 (8th Cir. 1992). [16] In McGhee v. Pottawattamie County, Iowa, the court held: Defendants raised this argument in the district court for the first time in their summary judgment reply brief. The district court did not consider this argument. See S.D. Iowa L.R. 7(g) (A reply brief may be filed `to assert newly-decided authority or to respond to new and unanticipated arguments made in the resistance [brief].').... The district court did not abuse its discretion or otherwise commit error by following the court's local rule prohibiting new arguments submitted in a reply brief. 547 F.3d 922, 929 (8th Cir.2008). This court's Local Rules provide, in pertinent part, that "the moving party may, within five court days after a resistance to a motion is served, file a reply brief, not more than five pages in length, to assert newly-decided authority or to respond to new and unanticipated arguments made in the resistance." LR 7.g. [17] In its ruling on the defendants' motion in limine, the court held, "The plaintiffs and their counsel are not to refer to any of the following in the presence of the jury: (1) elements of damages not recoverable in this action, including pain, suffering, grief, or mental anguish from the loss of the child...." Doc. No. 103, Order on Motions in Limine, filed February 27, 2009. [18] "All causes of action shall survive and may be brought notwithstanding the death of the person entitled or liable to the same." Iowa Code ง 611.20. [19] "A parent, or the parents, may sue for the expense and actual loss of services, companionship and society resulting from injury to or death of a minor child." Iowa R.App. P. 1.206. [20] Iowa has removed the restriction on damages after age 18, see Iowa Code ง 613.15A, but only with respect to actions filed on or after July 1, 2007. [21] See Jury Instruction No. 22, a copy of which is attached to this ruling. [22] Because the child was stillborn, no evidence could be offered about the personal characteristics of this "Particular child." See Pagitt, 206 N.W.2d at 703. [23] The plaintiffs offered only three of the photographs into evidence. See Pl. Ex. 10. [24] Copies of these instructions are attached to this ruling. [25] The plaintiffs' attorney asked the question of Mr. Heimlicher, "How has [your wife] experienced the societyโ€”loss of society and companionship of [the child] from your observations as her spouse?" Mr. Heimlicher began to respond by stating, "Obviously, from my standpoint, it's been aโ€”it's been, you know, obviously very difficult on us without him. Herโ€”her grief and remorse andโ€” ...." The plaintiffs' attorney immediately broke in to clarify that he was "talking about companionship and society," and the court admonished the jury not to consider grief or remorse. Trial Tr. at 832-33. [26] Actually, the lawyers asked to "reserve a motion," but neglected to assert a motion later. See Trial Tr. 1743. Nevertheless, the court will treat this matter as if a motion for mistrial had been asserted. [27] Mr. Heimlicher operates a business, while Ms. Heimlicher is a stay-at-home mother, so Mr. Heimlicher should have been held responsible for the greater share of these costs. [28] This figure was obtained using a calculator provided by the USDA as part of its 2007 report, "Expenditures on Children by Families." Although the figures are based on 2007 data, they are adequate for the court's purposes. See http://www.cnpp.usda.gov/ ExpendituresonChildrenbyFamilies.htm. [29] $300,000 - $6,000 = $294,000. [30] $792,000 - $60,000 = $732,000. [31] $200,000 - $4,000 = $196,000. [32] $528,000 - $40,000 = $488,000. [33] $300,000 - $28,000 = $272,000. [34] $792,000 - $80,000 = $712,000. [35] $200,000 - $42,000 = $158,000. [36] $528,000 - $120,000 = $408,000. [37] "[A] plaintiff cannot appeal the propriety of a remittitur order to which he has agreed." Donovan v. Penn Shipping Co., 429 U.S. 648, 649, 97 S.Ct. 835, 836, 51 L.Ed.2d 112 (1977) (citations omitted). [38] Doc. No. 136 is a combined motion for new trial and renewed motion for judgment as a matter of law. To the extent it is a motion for new trial, it is conditionally granted. To the extent it is a motion for judgment as a matter of law, it is denied.

Farmer confidence higher for next year A new survey by the NFU has revealed an increase in farmer confidence in the dairy and livestock sectors over the last year, but confidence has fallen in the horticulture and poultry sectors. The NFU says there are serious concerns about labour shortages in the future and increase of the National Living Wage. Members told the NFU, as part of its seventh annual farmer confidence survey, they anticipated positive effects on their business from the consumption levels of British produce (58%) and output prices (46%). However, farmers feel that input prices will have the most widespread negative impact for the coming year (74% negative), followed by regulation and legislation (53% negative). Mr Raymond commented: “The NFU has made it clear that for farming to have a profitable and productive future we need reassurance on key issues resulting from Brexit; such as access to a competent and reliable workforce and the best possible access to the Single Market. “British farming is the bedrock of the UK’s largest manufacturing sector – food and drink. The sector is worth £108 billion to the nation’s economy and employs some 3.9 million people. We urge Government, retailers and the public to back British farming so we can continue to produce high quality produce for the nation.”

Santorum: Keep fighting Obamacare SAN DIEGO – Some say it’s time for the benefits industry to accept Obamacare — passed by Congress, signed by President Obama, upheld by the Supreme Court — as law. Rick Santorum is not one of those people. “I read this morning that someone here was saying, ‘Give up on Obamacare, you can’t do anything to repeal it,’” said Santorum, a keynote speaker at the Benefits Selling Expo Tuesday. “Baloney. Since when do we say, ‘Well, it’s going to happen, might as well give up’?" Santorum, a former Pennsylvania senator and a GOP presidential candidate in the 2012 election, pointed to Obamacare as a transformative event for the country. The law will fundamentally change Americans’ relationship with their government, he said, and not for the better. “People are going to now rely on the government in some way for their health insurance,” he said. “And once government has its hand on you, it’s not a matter of you being dependent. It’s a matter of the government having control over you.” And despite the government intervention, Obamacare will do little to actually improve health care and its costs, Santorum predicted. Giving everyone an insurance card doesn’t mean they’ll be able to afford all the care they need — or, given the nation’s looming primary care doctor shortage, even find it. “There’s something about an insurance card that makes people feel comfortable, whether it means you can get care or not,” he said. So, according to Santorum, it’s time for Americans, especially those in industries most affected by Obamacare, to fight back. “As an industry, to sit back and let the government do this to you, I have three words for you: Shame on you,” he said. “Who’s going to fight for your clients if you don’t? What are you afraid of? You’re going to lose your job anyway if this thing goes into fruition. Go down swinging.” Santorum asked audience members how many came from a state where the governor or legislature had refused to implement Obamacare. Several dozen hands went up. But when he asked how many of those people had talked to their lawmakers about the decision, most of the hands went back down. That’s the problem, Santorum said. “They need to hear from you — your congressmen, your legislators,” he said. “If you support what they’re doing, tell them. Because I can guarantee they’re already hearing from the people who don’t.” Will Santorum be one of those elected leaders again anytime soon? When asked whether he would run for president again, Santorum said only that he was considering his options. “It’s hard,” he said. “It’s really hard on the family, and that’s the biggest nut for me. When someone asks me if I’m running, my answer is that I’m walking. I’m just walking the right path to see what I can do that’s best for my family and my country.”

Q: Unit-testing a controller method or a template method While implementing an operation in a method, I try to break it down into smaller focused methods. Knowingly or not, I usually end-up with one or more controller-like or template-like methods. Consider the following example. Let's assume that the whole 'A' operation as in performA(), including substeps within, is one responsibility, belonging in ONE class. public class OperationAPerformer{ public void performA(A a){ E1 e1 = performSubstep_b(a.getB1() ) performSubstep_e(e1, a.getE2() ) } protected E1 performSubstep_b(B1 b1){ performSubstep_c(b1.getC1(), b1.getC2() ) performSubstep_d(b1.getD1() ) ..... return e1; } protected void performSubstep_c(C1 c1, C2 c2) {...//simple stuff, no more method invocations} protected void performSubstep_d(D1 d1) {...//simple stuff, no more method invocations} protected void performSubstep_e(E1 e1, E2 e2) {...//simple stuff, no more method invocations} } It is fairly straightforward to test methods like performSubstep_c, performSubstep_d, performSubstep_e by creating text fixures of C1, C2, D1, E1, and E2. However, testing controller kind of methods like performA or performSubstep_b gets relatively complicated resulting in cluttered and duplicated code. For instance, to test a method like performA, I will have to create a test fixture that satisfies the entire call hierarchy i.e. I need to mock/stub/fake the instances of A1, B1, C1, C2, D1, E2, what not, and set the object graph. As I move up the hierarchy of a method chain with in the same class, unit-testing gets exponentially cluttered, tedious, and no-fun. I'm just wondering whether the design itself is not testable? Could you please shed some light on how to test certain scenarios involving controller methods. Should I revisit the design or test it differently? A: If each of these protected methods contains a significant amount of logic, the class being tested probably has too many responsibilities (see Single Responsibility Principle). You can extract the behaviour of each significant method into its own class, or even extract all the methods into a single class. These classes can then be injected into the class under test and mocked to allow you just to test the functionality of performA in isolation. As an additional bonus you can then simply test the newly extracted classes in isolation from each other too. This would lead to a much more object oriented and testable design.

9 So.3d 614 (2009) BERRY v. STATE. No. SC09-523. Supreme Court of Florida. April 21, 2009. Decision without published opinion. Mandamus dismissed.

Robots on hand to greet Japanese coronavirus patients in hotels A Pepper humanoid robot, manufactured by SoftBank Group Corp. and cleaning robot Whiz are seen during a press preview at a hotel of APA Group that has been designated to accommodate asymptomatic people and those with light symptoms of the coronavirus disease (COVID-19) to free up hospital beds and alleviate work by nurses and staff members, in Tokyo, Japan May 1, 2020. REUTERS A Pepper humanoid robot, manufactured by SoftBank Group Corp. and cleaning robot Whiz are seen during a press preview at a hotel of APA Group that has been designated to accommodate asymptomatic people and those with light symptoms of the coronavirus disease (COVID-19) to free up hospital beds and alleviate work by nurses and staff members, in Tokyo, Japan May 1, 2020. REUTERS Coronavirus patients with light symptoms arriving to stay at several Tokyo hotels are likely to get a lift from a pleasant surprise - a robot greeter in the lobby. Japan is now using hotels to house patients who have tested positive for the coronavirus but whose symptoms are too light to need hospitalisation, and several in the capital of Tokyo just opened on Friday feature robots to help lighten the burden on nurses. "Please, wear a mask inside," it said in a perky voice. "I hope you recover as quickly as possible." Other messages include "I pray the spread of the disease is contained as soon as possible" and "Let's join our hearts and get through this together." Pepper is not the only robot at work in the hotel in the Ryogoku area of Tokyo. A cleaning robot with the latest in Artifial Intelligence has been deployed to clean several parts of the hotel, including riskier "red zone" areas where staff access is limited. A Pepper humanoid robot, manufactured by SoftBank Group Corp. and cleaning robot Whiz are seen during a press preview at a hotel of APA Group that has been designated to accommodate asymptomatic people and those with light symptoms of the coronavirus disease (COVID-19) to free up hospital beds and alleviate work by nurses and staff members, in Tokyo, Japan May 1, 2020. REUTERS In an effort to reduce the burden on the medical system, Japan has secured more than 10,000 hotel rooms around the nation to put up patients with lighter symptoms, according to the Health Ministry. The Ryogoku hotel, where patients will start checking in later on Friday, can accommodate about 300 people. Two nurses will be on hand around the clock, while a doctor will also be present during the day. The number of coronavirus cases in Japan is now over 14,000 with 448 deaths as of Thursday, according to a Reuters tally.

Neighbors Give a Boy His Dream Home Driving her daughter to school every morning for four years, Pam Machulsky would pass a heartbreaking scene: JoAnne Stratton, 35, struggling to get her son Dominic, who uses a wheelchair, onto the school bus as impatient drivers honked. “I thought about the challenges she faced,” says Machulsky, 45. “I needed to do something.” At first she left gifts in front of their house. But finally Machulsky worked up the courage to introduce herself-and learned the true hardships the family faced. Having moved from a nearby town to Mt. Laurel for the school services available to Dominic-born prematurely with cerebral palsy-Dave, 43, a warehouse manager, and JoAnne could afford only a 600-sq.-ft. home that was originally a henhouse. It was so cramped that Dominic, 8, slept in a crib and could barely maneuver. Touched by their plight, Machulsky, an administrative assistant, e-mailed hundreds of friends and banded together with three other moms to launch the Dominic’s House fund (dominicshouse.com) in November 2009. A year later, through bake sales and donations, they’d raised more than $100,000-enough to level the old house and, with free services from contractor John Canuso Sr., build a wheelchair-accessible, 1,784-sq.-ft. Cape Cod-style house. “It’s like a fairy tale,” JoAnne says of the home, which has two ramps, a camera to monitor Dominic from other parts of the house and a fully equipped physical therapy room. “Dominic can grow up here. He’s doing laps in the hallways. How can I ever thank all these people?”

Schedule an appointment online 331 [email protected] – 11. May 2016 By Subscribe* to search order * Note: To ensure that the search order meets your requirements, select your filter criteria in the vehicle list (please note the "Filter (0)" display - there should be 1 or more), click Subscribe to search order again and fill out the form. Submit Your reliable partner when purchasing a car, since 1967: As one of the largest independent direct importers nationwide, Garage Auto Kunz AG offers an impressive range of new and used cars by all car manufacturers – at the lowest prices in Switzerland! QUICK LINKS Bought a car last week from Auto Kunz, with Arber as the salesman. Excellent selection of cars with great prices and very good customer service. Would highly recommend. Anders Tveteraas 06:08 20 Jan 20 Managed to purchase a car while living abroad and could pick it up soon after arrival to Switzerland. I can feel unsettling to transfer larger funds and doing business with people you haven't met in a country you don't know yet, but Dario Nikolic was very helpful and guided me through every step in the process. He kept every promise he made and the final step to pick up the car was smooth and hassle free Reto Wiederkehr 11:01 16 Dec 19 Great place to get your muscle car......does he delivers to australia 😊🤪 Bruno Giuliano 14:59 30 Nov 19 Top garage for American cars G C 07:42 22 Aug 19 Just another garage? We didn't think so. After looking at several garages where the service was questionable at best. We went here and met Kevin. Amazing service and when we had questions or problems he had answers and solutions. The garage had an amazing stock of cars ( some dream cars) and we could not find the right one on site until we went through their books. They had the perfect car coming in 5 days before we needed it. They got it turned around (full service and deep clean) over weekend and National holiday. The car was spotless and process was so easy. We completed conversations in English and the documentation was explained at every step. So no surprises.Thank you so much for your hard work. G C 07:42 22 Aug 19 Just another garage? We didn't think so. After looking at several garages where the service was questionable at best. We went here and met Kevin. Amazing service and when we had questions or problems he had answers and solutions. The garage had an amazing stock of cars ( some dream cars) and we could not find the right one on site until we went through their books. They had the perfect car coming in 5 days before we needed it. They got it turned around (full service and deep clean) over weekend and National holiday. The car was spotless and process was so easy. We completed conversations in English and the documentation was explained at every step. So no surprises.Thank you so much for your hard work. Reka Soti 19:17 09 Mar 19 We purchased a car at Auto Kunz a week ago. The staff were very helpful and fast working, they kindly answered every question that we asked and replied to all the e-mails that we had written to them. They arranged everything for us, we should only need to pick up the vechile. We are very satisfied and overall happy with the deal that we have managed to arrange with Auto Kunz. Special thanks for Mr. Kutly Islek, who has done an excellent job. We recommend it to all new customers! Tom Mulders 15:42 21 Feb 19 Bought two new cars via Damiano Marra from Auto Kunz. I recently moved to Switzerland, and needed guidance on registration, financing, and insurance. Damiano did an excellent job, and mediated between bank and insurance company. It was a smooth process, and I'd highly recommend Auto Kunz. Tom Mulders 15:42 21 Feb 19 Bought two new cars via Damiano Marra from Auto Kunz. I recently moved to Switzerland, and needed guidance on registration, financing, and insurance. Damiano did an excellent job, and mediated between bank and insurance company. It was a smooth process, and I'd highly recommend Auto Kunz.

Maternal prenatal omega-3 fatty acid supplementation attenuates hyperoxia-induced apoptosis in the developing rat brain. Supraphysiologic amounts of oxygen negatively influences brain maturation and development. The aim of the present study was to evaluate whether maternal ω-3 long-chain polyunsaturated fatty acid (ω-3 FA) supplementation during pregnancy protects the developing brain against hyperoxic injury. Thirty-six rat pups from six different dams were divided into six groups according to the diet modifications and hyperoxia exposure. The groups were: a control group (standard diet+room air), a hyperoxia group (standard diet+80% O₂ exposure), a hyperoxia+high-dose ω-3 FA-supplemented group, a hyperoxia+low-dose ω-3 FA-supplemented group, a room air+low-dose ω-3 FA-supplemented+group, and a room air+high dose ω-3 FA-supplemented group. The ω-3 FA's were supplemented as a mixture of docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) from the second day of pregnancy until birth. Rat pups in the hyperoxic groups were exposed to 80% oxygen from birth until postnatal day 5 (P5). At P5, all animals were sacrificed. Neuronal cell death and apoptosis were evaluated by cell count, TUNEL, and active Caspase-3 immunohistochemistry. Histopathological examination showed that maternally ω-3 FA deficient diet and postnatal hyperoxia exposure were associated with significantly lower neuronal counts and significantly higher apoptotic cell death in the selected brain regions. Ω-3 FA treatment significantly diminished apoptosis, in the selected brain regions, in a dose dependent manner. Our results suggest that the maternal ω-3 FA supply may protect the developing brain against hyperoxic injury.

Ordered states with helical arrangement of the magnetic moments are described by a chiral order parameter $\vec C=\vec S_1 \times \vec S_2$, which yields the left- or right-handed rotation of neighboring spins along the pitch of the helix. Examples for compounds of that sort are rare-earth metals like Ho [@plakhty_01]. Spins on a frustrated lattice form another class of systems, where simultaneous ordering of chiral and spin parameters can be found. For example, in the triangular lattice with antiferromagnetic nearest neighbor interaction, the classical ground-state is given by a non-collinear arrangement with the spin vectors forming a 120$^\circ$ structure. In this case, the ground state is highly degenerate as a continuous rotation of the spins in the hexagonal plane leaves the energy of the system unchanged. In addition, it is possible to obtain two equivalent ground states which differ only by the sense of rotation (left or right) of the magnetic moments from sub-lattice to sub-lattice, hence yielding an example of chiral degeneracy. As a consequence of the chiral symmetry of the order parameter, a new universality class results that is characterized by novel critical exponents as calculated by Monte-Carlo simulations [@kawamura_88] and measured by neutron scattering [@mason_89] in the $XY$-antiferromagnet CsMnBr$_3$. An interesting but still unresolved problem is the characterization of chiral spin fluctuations that have been suggested to play an important role e.g. in the doped high-$T_c$ superconductors [@sulewski]. The measurement of chiral fluctuations is, however, a difficult task and can usually only be performed by projecting the magnetic fluctuations on a field-induced magnetization [@maleyev95; @plakhty99]. In this Letter, we show that chiral fluctuations can be directly observed in non-centrosymmetric crystals without disturbing the sample by a magnetic field. We present results of polarized inelastic neutron scattering experiments performed in the paramagnetic phase of the itinerant ferromagnet MnSi that confirm the chiral character of the spin fluctuations due to spin-orbit coupling and discuss the experimental results in the framework of self-consistent renormalisation theory of spin-fluctuations in itinerant magnets [@moriya85]. Being a prototype of a weak itinerant ferromagnet, the magnetic fluctuations in MnSi have been investigated in the past in detail by means of unpolarized and polarized neutron scattering. The results demonstrate the itinerant nature of the spin fluctuations [@ishikawa77; @ishikawa82; @ishikawa85] as well as the occurrence of spiral correlations [@shirane83] and strong longitudinal fluctuations [@tixier97]. MnSi has a cubic space group P2$_1$3 with a lattice constant $a = 4.558$ Å that lacks a center of symmetry leading to a ferromagnetic spiral along the \[1 1 1\] direction with a period of approximately 180 Å[@bloch75]. The Curie temperature is $T_C = 29.5$ K. The spontaneous magnetic moment of Mn $\mu_s \simeq 0.4 \mu_B$ is strongly reduced from its free ion value $\mu_f = 2.5\mu_B$. As shown in the inset of Fig. \[Fig1\] the four Mn and Si atoms are placed at the positions $(x,x,x)$, $({1\over2}+x,{1\over2}-x,-x)$, $({1\over2}-x,-x,{1\over2}+x)$, and $(-x,{1\over2}+x,{1\over2}-x)$ with $x_{Mn} = 0.138$ and $x_{Si}=0.845$, resepctively. We investigated the paramagnetic fluctuations in a large single crystal of MnSi (mosaic $\eta = 1.5^0$) of about 10 cm$^3$ on the triple-axis spectrometer TASP at the neutron spallation source SINQ using a polarized neutron beam. The single crystal was mounted in a $^4$He refrigerator of ILL-type and aligned with the \[0 0 1\] and \[1 1 0\] crystallographic directions in the scattering plane. Most constant energy-scans were performed around the (0 1 1) Bragg peak and in the paramagnetic phase in order to relax the problem of depolarization of the neutron beam in the ordered phase. The spectrometer was operated in the constant final energy mode with a neutron wave vector $\vec k_f$=1.97 $\AA^{-1}$. In order to suppress contamination by higher order neutrons a pyrolytic graphite filter was installed in the scattered beam. The incident neutrons were polarized by means of a remanent [@remanent] FeCoV/TiN-type bender that was inserted after the monochromator [@semadeni01]. The polarization of the neutron beam at the sample position was maintained by a guide field $B_g = 10$ G that defines also the polarization of the neutrons $\vec P_i$ with respect to the scattering vector $\vec Q = \vec k_i - \vec k_f$ at the sample position. In contrast to previous experiments, where the polarization $\vec P_f$ of the scattered neutrons was also measured in order to distinguish between longitudinal and transverse fluctuations [@tixier97], we did not analyze $\vec P_f$, as our goal was to detect a polarization dependent scattering that is proportional to $\sigma_p \propto (\hat{\vec Q} \cdot \vec P_i)$ as discussed below. A typical constant-energy scan with $\hbar \omega = 0.5$ meV measured in the paramagnetic phase at $T = 31$ K is shown in Fig. \[Fig1\] for the polarization of the incident neutrons $\vec P_i$ parallel and anti-parallel to the scattering vector $\vec Q$. It is clearly seen that the peak positions depend on $\vec P_i$ and appear at the incommensurate positions $\vec Q = \vec \tau \pm \vec\delta$ with respect to the reciprocal lattice vector $\vec\tau_{011}$ of the nuclear unit cell. Obviously, this shift of the peaks with respect to (0 1 1) would be hardly visible with unpolarized neutrons and could not observed in previous inelastic neutron works. In order to discuss our results we start with the general expression for the cross-section of magnetic scattering with polarized neutrons[@izyumov] $$\begin{aligned} {d^2\sigma\over{d\Omega d\omega}} &\sim& \sum_{\alpha, \beta}(\delta_{\alpha, \beta}- \hat Q_\alpha \hat Q_\beta) A^{\alpha \beta} (\vec Q, \omega) \nonumber \\ &+& \sum_{\alpha, \beta} (\hat {\vec Q} \cdot \vec P_i)\sum_{\gamma}\epsilon_{\alpha, \beta, \gamma} \hat Q^\gamma B^{\alpha \beta}(\vec Q, \omega) \label{ncs}\end{aligned}$$ where $(\vec Q, \omega)$ are the momentum and energy-transfers from the neutron to the sample, $\hat {\vec Q} = \vec Q/|\hat Q|$, and $\alpha, \beta, \gamma$ indicate Cartesian coordinates. The first term in Eq. \[ncs\] is independent of the polarization of the incident neutrons, while the second is polarization dependent through the factor $(\hat{\vec Q} \cdot \vec P_i)$. $\vec P_i$ denotes the direction of the neutron polarization and its scalar is equal to 1 when the beam is fully polarized. $A^{\alpha \beta}$ and $B^{\alpha \beta}$ are the symmetric and antisymmetric parts of the scattering function $S^{\alpha \beta}$, that is $A^{\alpha \beta}={1\over 2} (S^{\alpha \beta} + S^{ \beta \alpha})$ and $B^{\alpha \beta}={1\over 2} (S^{\alpha \beta} - S^{\beta \alpha})$. $S^{\alpha \beta}$ are the Fourier transforms of the spin correlation function $<s^\alpha_l s^\beta_{l'}>$, $S^{\alpha \beta}(\vec Q, \omega)={1\over{2\pi N}}\int_{-\infty}^\infty{dt e^{-i\omega t} \sum_{ll'}{e^{i\vec Q (\vec X_l-\vec X_{l'}) }}<s^\alpha_l s^\beta_{l'}(t)> }$. The vectors $\vec X_l$ designate the positions of the scattering centers in the lattice. The correlation function is related to the dynamical susceptibility through the fluctuation-dissipation theorem $S(\vec Q,\omega)=2\hbar/(1-\exp(-\hbar\omega/kT))\Im \chi(\vec Q,\omega)$. Following Ref. [@lovesey] we define now an axial vector $\vec B$ by $\sum_{\alpha \beta}\epsilon_{\alpha \beta \gamma}B^{\alpha \beta} = B^\gamma (\vec Q, \omega)$, that represents the antisymmetric part of the susceptibility which, hence, depends on the neutron polarization as follows $$(\hat {\vec Q }\cdot \vec P_i)(\hat {\vec Q} \cdot \vec B) \label{axial}$$ and vanishes for centro-symmetric systems or when there is no long-range order. In the absence of symmetry breaking fields like external magnetic fields, pressure etc., similar scans with polarized neutrons would yield a peak of diffuse scattering at the zone center and no scattering that depends on the polarization of the neutrons. However, an intrinsic anisotropy of the spin Hamiltonian in a system that lacks lattice inversion symmetry may provide an axial interaction leading to a polarization dependent cross section. The polarization dependent scattering obtained in the present experiments is therefore an indication of fluctuations in the chiral order parameter and points towards the existence of an axial vector $\vec B$ that is not necessarily commensurate with the lattice. Hence, according to Eq. \[axial\] the neutron scattering function in MnSi contains a non-vanishing antisymmetric part. Because the crystal structure of MnSi is non-centrosymmetric and the magnetic ground-state forms a helix with spins perpendicular to the \[1 1 1\] crystallographic direction, it is reasonable to interpret the polarization-dependent transverse part of the dynamical susceptibility in terms of the Dzyaloshinskii-Moriya (DM) interaction [@dzyal58; @moriya60] similarly as it was done in other non-centrosymmetric systems that show incommensurate ordering [@zheludev; @roessli]. Usually the DM-interaction is written as the cross product of interacting spins $H_{DM}=\sum_{l,m}\vec D_{l,m}\cdot (\vec s_l \times \vec s_m)$, where the direction of the DM-vector $\vec D$ is determined by bond symmetry and its scalar by the strength of the spin-orbit coupling [@moriya60]. Although the DM-interaction was originally introduced on microscopic grounds for ionic crystals, it was shown that antisymmetric spin interactions are also present in metals with non-centrosymmetric crystal symmetry [@kataoka_84]. In a similar way as for insulators with localized spin densities, the antisymmetric interaction originates from the spin-orbit coupling in the absence of an inversion center and a finite contribution to the the antisymmetric part of the wave-vector dependent dynamical susceptibility is obtained. For the case of a uniform DM-interaction, the neutron cross-section depends on the polarization of the neutron beam [@aristov_00] as follows $$\begin{aligned} \biggl({{d^2\sigma}\over{d\Omega d\omega}}\biggr)_{np} & \sim & \Im{{(\chi^\perp(\vec q-\vec\delta,\omega)+\chi^\perp (\vec q+\vec\delta,\omega))} }, \nonumber \\ \biggl({{d^2\sigma}\over{d\Omega d\omega}}\biggr)_{p} & \sim & (\hat{\vec D} \cdot \hat{\vec Q})(\hat{\vec Q}\cdot \vec P_i) \nonumber \\ & \times & \Im{{(\chi^\perp(\vec q-\vec\delta,\omega)-\chi^\perp (\vec q+\vec\delta,\omega))} }. \label{pa}\end{aligned}$$ Here, $\vec q$ designates the reduced momentum transfer with respect to the nearest magnetic Bragg peak at $\vec \tau \pm \vec \delta$. The first line of Eq. \[pa\] describes inelastic scattering with a non-polarized neutron beam. The second part describes inelastic scattering that depends on $\vec P_i$ as well as on $\vec D$. Eq. \[pa\] shows that the cross section for $\vec P_i \perp \vec Q$ is indeed independent of $P_i$ as observed in Fig. \[Fig2\]. By subtracting the inelastic spectra taken with $\vec P_i$ parallel and anti-parallel to $\vec Q$, the polarization dependent part of the cross-section can be isolated, as demonstrated in Fig. \[Fig3\] for two temperatures $T = 31$ K and $T = 40$ K. Close to $T_C$, the intensity is rather high and the crossing at $Q =$ (0 1 1) is sharp. At 40 K the intensity becomes small and the transition at (0 1 1) is rather smooth, which mirrors the decreases of the correlation length with increasing temperature. We have measured $({{d^2\sigma}/({d\Omega d\omega}}))_{p}$ in the vicinity of the (0 1 1) Bragg peak at $T = 35$ K. The result shown as a contour plot in Fig. \[Fig4\] indicates that the DM-interaction vector in MnSi has a component along the \[0 1 1\] crystallographic direction which induces paramagnetic fluctuations centered at positions incommensurate with the chemical lattice. In order to proceed further with the analysis we assume for the transverse susceptibilities in Eq. \[pa\] the expression for itinerant magnets as given by self-consistent re-normalization theory (SCR) [@moriya85] $$\chi^\perp (\vec q \pm \vec \delta, \omega) = \chi^\perp (\vec q \pm \vec \delta)/(1-i\omega/\Gamma_{\vec q \pm \vec \delta}). \label{src}$$ $\vec \delta$ is the ordering wave-vector, $\chi^\perp (\vec q \pm \vec \delta)=\chi^\perp(\vec \mp \delta)/(1+q^2/\kappa^2_\delta)$ the static susceptibility, and $\kappa_\delta$ the inverse correlation length. For itinerant ferromagnets the damping of the spin fluctuations is given by $ \Gamma_{\vec q \pm \vec \delta} = uq (q^2+\kappa^2_\delta)$ with $u = u(\vec \delta)$ reflecting the damping of the spin fluctuations. Experimentally, it has been found from previous inelastic neutron scattering measurements that the damping of the low-energy fluctuations in MnSi is adequately described using the results of the SCR-theory rather than the $q^z$ ($z = 2.5$) wave-vector dependence expected for a Heisenberg magnet [@ishikawa82]. The solid lines of Figs. \[Fig1\] to \[Fig3\] show fits of $({{d^2\sigma}/({d\Omega d\omega}}))_{p}$ to the polarized beam data. It is seen that the cross section for itinerant magnets reproduces the data well if the incommensurability is properly taken into account. Using Eqs. \[pa\] and \[src\] and taking into account the resolution function of the spectrometer, we extract values $\kappa_0 = 0.12$ Å$^{-1}$ and $u = 27$ meVÅ$^3$ in reasonable agreement with the analysis given in Ref. [@ishikawa85]. The smaller value for $u$ when compared with $u = 50$ meVÅ$^3$ from Ref. [@ishikawa82] indicates that the incommensurability $\vec \delta = (0.02,0.02,0.02)$ was neglected in the analysis of the non-polarized neutron data. At $T = 40$ K, the chiral fluctuations are broad (Fig. \[Fig3\]) due to the increase of $\kappa_\delta$ with increasing $T$, i.e. $\kappa_\delta(T) = \kappa_0 (1-T_C/T)^\nu$. We note that the mean-field-like value $\nu = 0.5$ obtained here is close to the expected exponent $\nu = 0.53$ for chiral symmetry [@kawamura_88]. This suggests that a chiral-ordering transition also occurs in MnSi in a similar way to the rare-earth compound Ho, pointing toward the existence of a universality class in the magnetic ordering of helimagnets [@plakhty_01]. In conclusion, we have shown that chiral fluctuations can be measured by means of polarized inelastic neutron scattering in zero field, when the antisymmetric part of the dynamical susceptibility has a finite value. We have shown that this is the case in metallic MnSi that has a non-centrosymmetric crystal symmetry. For this compound the axial interaction leading to the polarized part of the neutron cross-section has been identified as originating from the DM-interaction. Similar investigations can be performed in a large class of other physical systems. They will yield direct evidence for the presence of antisymmetric interactions in forming the magnetic ground-state in magnetic insulators with DM-interactions, high-T$_c$ superconductors (e.g. La$_2$CuO$_4$ [@berger]), nickelates [@koshibae], quasi-one dimensional antiferromagnets [@tsukada] or metallic compounds like FeGe[@lebech]. V.P. Plakhty et al., Phys. Rev. B [**64**]{}, 100402(R), 2001. H. Kawamura, Phys. Rev. B [**38**]{} 4916 (1988). T.E. Mason et al., Phys. Rev. B [**39**]{} 586 (1989). P.E. Sulewski et al., Phys. Rev. Lett. [**67**]{}, 3864 (1991). S. V. Maleyev, Phys. Rev. Lett. [**75**]{}, 4682 (1995). V. P. Plakhty et al., Europhys. Lett. [**48**]{}, 215 (1999). T. Moriya, in *Spin Fluctuations in Itinerant Electron Magnetism* **56**, Springer-Verlag, Berlin Heidelberg New-York Tokyo, 1985. Y. Ishikawa et al., Phys. Rev. B **16**, 4956 (1977). Y. Ishikawa et al., Phys. Rev. B **25**, 254 (1982). Y. Ishikawa et al., Phys. Rev. B **31**, 5884 (1985). G. Shirane et al., Phys. Rev. B **28**, 6251 (1983). e.g. Yu A. Izyumov, Sov. Phys. Usp. **27**, 845 (1984). S. Tixier et al., Physica B [**241-243**]{}, 613, (1998). Y. Ishikawa et al., Solid. State. Commun. [**19**]{}, 525 (1976). No spin flipping devices are necessary due to the remanent magnetization of the supermirror coatings of the benders. For details see: [P. Böni et al., Physica B **267-268**, (1999) 320.]{} F. Semadeni, B.Roessli, and P. Böni, Physica B **297**, 152 (2001). S.W. Lovesey and E. Balcar, Physica B [**267-268**]{}, 221 (1999). A. Zheludev et al., Phys. Rev. Lett. **78**, (1997) 4857. B. Roessli et al., Phys. Rev. Lett. **86** (2001) 1885. L. Dzyaloshinskii, J. Phys. Chem. Solids [**4**]{}, 241 (1958). T. Moriya, Phys. Rev. [**120**]{}, 91 (1960). M. Kataoka et al., J. Phys. Soc. Japan [**53**]{}, 3624 (1984). D.N. Aristov and S.V. Maleyev Phys. Rev. B **62** [(2000)]{} R751. J. Berger and A. Aharony, Phys. Rev. B **46**, 6477 (1992). W. Koshibae, Y. Ohta and S. Maekawa, Phys. Rev. B **50**, 3767 (1994). I. Tsukada et al., Phys. Rev. Lett.**87**, 127203 (2001). B. Lebech, J. Bernhard, and T. Freltoft, J. Phys.: Condens. Matter **1**, 6105 (1989).

Event Views Navigation Events for Thursday, December 21, 2017 Day Navigation 6:00 pm On Thursday nights in December holiday lights, horse drawn carriages, vintage fire truck rides, visits from Santa and the famed “Paw Patrol”, and live music will take center stage in Flemington. “Thursday Night Holiday Lights,” a program sponsored by Flemington Community Partnership (FCP) with help from dozens of community volunteers and organizations, will make the […] On Thursday nights in December holiday lights, horse drawn carriages, vintage fire truck rides, visits from Santa and the famed “Paw Patrol”, and live music will take center stage in Flemington. “Thursday Night Holiday Lights,” a program sponsored by Flemington Community Partnership (FCP) with help from dozens of community volunteers and organizations, will make the […]

The Role of Liver Biopsy to Assess Alcoholic Liver Disease. Liver biopsy due to the limitations is not recommended for all patients with suspected Alcoholic Liver Disease (ALD) but useful for establishing the stage and severity of ALD, in case of aggressive forms or severe steatohepatitis requiring specific therapies, for distinguishing comorbid liver pathology. Procedure is invasive and that's why associated with some potential adverse effects and complications which may be minor (pain or vagal reactions, transient hypotension) or major such as visceral perforation, bile peritonitis or significant bleeding. The typical histological features in patients with ALD include steatosis, hepatocellular damage (ballooning and/or Mallory-Denk bodies), lobular inflammation with basically polymorphonuclear cells infiltration, with a variable degree of fibrosis and lobular distortion that may progress to cirrhosis which confers a high risk of complications (ascites, variceal bleeding, hepatic encephalopathy, renal failure and bacterial infections).

MobyRanks are listed below. You can read here for more information about MobyRank. 92 Game Boy ColorNintendo Land The overall quality of the games is a lot higher than it was in the first game, and the modern versions feature even more inventive twists on the original's gameplay. The modern versions of Chef and Helmet, for example, are like completely new little games in their own right, and are both great fun to play. Plus, the hidden secrets, such as a sound test, or even an extra game, that can only be obtained by getting enough high scores add a large incentive to keep playing. Overall, this is a very well-balanced selection of great little games that offer addicitve, short bursts of simple fun. If you liked the original (and you have every reason to do so), you'll adore this. If you've got a nice long attention span and an open mind, the nostalgia bug will bite your neck, swim through your blood and lay eggs in your heart. If not, you might want to avoid this title. All in all, this game more than does the original Game and Watch games justice. A great game for playing on the road. Overall, I am satisfied with Game & Watch Gallery 2. I grew up playing the original Game & Watches, and have several original Nintendo Game & Watch games still in my collection. For me, playing Game & Watch Gallery 2 was a trip down memory lane, but for a whole new generation of games, it represents a returning to the simplicity of past games. There's no need to sit for that extra five or ten minutes to finish a level, or to reach that difficult to find save point. Gamers can turn off their Game Boys when they want it, making this title ideal for short trips, or for people who simply want to be entertained and not feel like they are locked into the game for a certain period of time. Don't dismiss this as a retro game. Each of the classic titles has an updated version that is better than the original. The games are simple, but they can be as captivating as much more complex platform or puzzle games. I'm not a big fan of speed-up and catch-'em games, but these are well done.

Manuscripts of The Canterbury Tales which show clear signs of scribal interference have long been dismissed by editors as ‘bad texts.’ Now, however, these same manuscripts are being revalued by reception historians for the evidence they provide regarding the earliest reception of Chaucer’s work1 To be sure, most extant manuscripts of the Tales offer some sort of evidence regarding its fifteenth-century reception, in the form of illustrations, rubrics, marginal notes or doodles; however, it may be argued that striking scribal alterations of the text itself offer the best evidence of how Chaucer’s near contemporaries responded to his work. Those interested in the reception of the Wife of Bath are particularly fortunate in that her Prologue is by far the most altered piece in the Tales. I think the primary reason for this is that her Prologue is both contentious and ambiguous: contentious in its discussion of marriage and ambiguous in its representation of the Wife’s sexual morality. As a result, scribal interference with this text is not only frequent and striking, but often contradictory, leading me to hypothesize two different scribal receptions of the Wife’s Prologue: one informed by clerical asceticism, misogyny and misogamy and the other by a more popular and positive attitude towards sex, women and the institution of marriage. Medieval Warfare Read about the sieges of Constantinople in the latest issue of Medieval Warfare. Click here to order the magazine. Advertisement Our Videos Advertisement Related Content Medieval Warfare Magazine Starting around 500 AD, Medieval Warfare examines European history during the Dark Ages, Middle Ages, and the beginning of the Renaissance (the magazine generally leaves off around 1500). With a host of different nations and cultures competing for dominance during this period, topics in the magazine are extremely varied and diverse. While popular topics such as the Crusades and Anglo-French wars are given regular coverage, Medieval Warfare also tackles more complex and obscure topics, such as the myriad wars between the Italian city-states and the frequent conflicts between Eastern Europe and the Ottoman Empire. Edited by Peter Konieczny Bi-monthly 60 pages, full-colour Price: €39.95 for a normal one year subscription, €9.50 for a digital subscription, renewed every six months.

J.A. Bayona (A Monster Calls) is directing the next installment in the studio's hit franchise. Jurassic World earned $1.67 billion worldwide in 2015 and is the fourth-highest-grossing film in history. Stars Chris Pratt and Bryce Dallas Howard are returning for the sequel, which also stars Justice Smith, James Cromwell and Toby Jones. Colin Trevorrow, who directed Jurassic World, wrote the script for the follow-up with Derek Connolly. The film is slated for release on June 22, 2018. Producers Frank Marshall and Pat Crowley once again join executive producers Steven Spielberg and Trevorrow in the next chapter of the franchise. Belén Atienza is also producing. Universal vp production Sara Scott is overseeing production on behalf of the studio. Goldblum will reprise his role as Dr. Ian Malcolm, the know-it-all mathematician who came to the park as an insurance consultant — and somehow survived both the original film and the sequel. Goldblum will next be seen in Disney and Marvel’s Thor: Ragnarok, set to hit theaters Nov. 3. His other recent credits include Independence Day: Resurgence and The Grand Budapest Hotel. He also is reuniting with director Wes Anderson on the upcoming film Isle of Dogs. Goldblum is repped by ICM, Industry Entertainment and Hansen, Jacobson.

Q: Multidimensional array with different lengths I am trying to make an array with different lengths in a second dimension e.g.: A = 1 3 5 6 9 2 3 2 2 5 8 9 Is this possible? I've spent a fair amount of time looking but cannot find out either way. A: Yes and no. First the no: Proper arrays in Fortran, such as those declared like this: integer, dimension(3,3,4) :: an_array or like this integer, dimension(:,:,:,:), allocatable :: an_array are regular; for each dimension there is only one extent. But, if you want to define your own type for a ragged array you can, and it's relatively easy: type :: vector integer, dimension(:), allocatable :: elements end type vector type :: ragged_array type(vector), dimension(:), allocatable :: vectors end type ragged_array With this sort of approach you can allocate the elements of each of the vectors to a different size. For example: type(ragged_array) :: ragarr ... allocate(ragarr%vectors(5)) ... allocate(ragarr%vectors(1)%elements(3)) allocate(ragarr%vectors(2)%elements(4)) allocate(ragarr%vectors(3)%elements(6)) A: looking at the first answer, it seems there is no need to create the derived type vector which is really just an allocatable integer array: type ragged_array integer,allocatable::v(:) end type ragged_array type(ragged_array),allocatable::r(:) allocate(r(3)) allocate(r(1)%v(5)) allocate(r(2)%v(10)) allocate(r(3)%v(15)) this makes the notation a little less cumbersome..

Q: Can Resharper 9 perform pattern search and replace on HTML markup? I am in the process of restructuring large amounts of MVC code to use Bootstrap. The process is very tedious and error prone because it's easy to clobber the markup. The majority of the code, however, is structurally identical and it could be at least partially automated. If I could somehow search the HTML structure, <div class="header"> <div class="content"> <h1 class="big">@Model.Foo </h1> </div> </div> with <div class="panel panel-default"> <div class="panel-body"> @Model.Foo; </div> </div> I understand Resharper 9 has structural search and replace, but I couldn't find any documentation for it. I would guess that this feature would work for HTML, since Resharper can detect errors in the markup based on nesting. EDIT: I found some documentation on "Search with Pattern", but upon trying it, I couldn't get it to work at all following the examples. In particular, putting any value "CSS Selector" field ignored it. A: It should work. In the search pattern dialog, make sure HTML is selected as the target language, and then just type the first HTML block in as the search pattern. You don't mention if the first block is an example, or exactly the code you want to search for. If it's an example, you'll need to add placeholders for other attributes and elements. Then put the second block in the replace field. Again, if it's verbatim HTML, just copy it in. Otherwise, you can use the placeholders from the search pattern to fill the captured values in.

Baleshwar District Balasore district Balasore District, also known as Baleswar District or Baleshwar District, is an administrative district of Orissa state in eastern India. The lingua franca is Oriya. The coastal district is known for its beautiful mountains and famous temples. Balasore is a place of scenic beauty and a major tourist attraction, also because of its historical monuments and temples. There are a few hill ranges in the region too. It is now a launch station for sounding rockets on the east coast of India in Orissa state at 21°18' N and 86°36' E. Balasore has been in use since 1989, but unlike Sriharikota, it is not used for launching satellites. The rocket launching site at Balasore is situated in a place called Chandipur located on the Bay of Bengal. The Interim Test Range in Chandipur, Balasore is responsible for carrying out tests for various missiles such as Agni, Prithvi, Trishul etc. Balasore Railway Station falls en route on the main line connecting Chennai to Kolkata. Road connectivity wise, National Highway-5 runs through Balasore. It is 212 km north-east of Bhubaneswar by road. Chandipur-on-sea is a sea resort famous for its mile long shallow beaches. Chandipur on sea is one of the shallowest sea beaches in the world. It is a unique beach, the tide comes to the shore only four times a day, at determined intervals. Among other tourist attractions is the 18th century kshirochora-gopinath temple, famous for its mythological story, how the temple was built there. Birth place of linguist and novelist Fakir Mohan Senapati,considered to be the saviour of modern oriya language and an eminent freedom fighter. Also birth place of famous oriya poet Kabibar Radhanath Roy. History Balasore district was a part of the ancient Kalinga and later became a territory of Toshala or Utkal, till the death of Mukunda Dev. It was annexed by Moghuls in 1568 and remained as a part of their suzerainty up to 1750-51. Subsequently, the Marahattas of Nagpur occupied this part of Orissa and it came under the dominion of the Marahatta Rajas. In 1803, this part was ceded to The British East India Company through the Treaty of Deogaon and it became a part of Bengal Presidency until 1912. But the first English Settlement came into existence in Balasore region in 1634 while Shah Jahan was the emperor at Delhi. The region was an early trading port for British, French and Dutch ships in the early age of Enlightenment and became a colonial part of first Danish India and later British India. The first of English factories was established in this region in 1640. During this period Dutch and Danish settlements were also found in this region. Balasore as a separate district was created in October 1828 while it was in the Bengal Presidency. With the creation of Bihar province, Orissa was diverted along with Balasore district from Bengal to Bihar. With the creation of Orissa as a separate State on 1st April 1936, Balasore became an integral part of Orissa State. The national movement of independence surged ahead with the visit of Mahatma Gandhi in 1921. Inchudi Salt Revolution (Lavana Satyagrah) and Srijang Satyagrah for non-payment of Revenue Tax are famous as part of the struggle for freedom movement. Praja Andolan was initiated against the ruler of Nilagiri State. In January 1948, the state of Nilagiri was merged with the state of Orissa and became a part of Balasore district. On 3rd April 1993, Bhadrak Sub-division became a separate district. In the early 17th century, Balasore was an important trading destination in the eastern coastline of India. Inhabitants of the place sailed to distant ports in south-east asia, especially to Lacadive and Maldives islands for trade and culture. Copper coins excavated from Bhograi and statues of Lord Buddha unearthed from places like Avana, Kupari, Basta & Ajodhya signify the existence of Buddhism in Balasore which was popular during the rule of Bhoumakar dynasty. The statues of Lord Mahavira found at Jaleswar, Balasore & Avana date back to the 10-11th century and show the existence of Jainism in the region. Broadly the district can be divided into three geographical regions, namely, the Coastal belt, the inner alluvial plain and the North-Western hills. The coastal belt is about 81 km wide and shaped like a strip. In this region, sand dunes are noticed along the coast with some ridges. This region is mostly flooded with brackish water of estuarine rivers which is unsuitable for cultivation. Presently this area is utilized for coconut and betel cultivation. Shrimp culture and salt manufacturing units are also developing in this area recently. The second contiguous geographical region is deltaic alluvial plain. It is a wide stretch of highly fertile and irrigated land. This area is highly populous and devoid of any jungle. The third region, north-western hilly region covers most of Nilgiri Sub-division. It is mostly hilly terrain and vegetated with tropical semi-ever green forests. The Hills of Nilgiri has the highest peak of 543 metre above the sea level. The scheduled tribes of the district are mostly seen in this region of valuable forest resources and stone quarries. Balasore, the coastal district of Orissa is crisscrossed with perennial and estuarine rivers because of its proximity to the sea. Two important rivers of Orissa, namely :- Budhabalanga and Subarnarekha pass through this district from west to east before surging into the Bay of Bengal. The irrigation system in Balasore district is very much widespread. The soil of Balasore district is mostly alluvial laterite. The soil of Central region is mostly clay, clay loam and sandy loam which is very fertile for paddy and other farm produces. Nilgiri Sub-division is mostly gravelly and lateritic soil, which is less fertile. A small strip of saline soil is also seen along the extreme coastal part of the district. Economy The district has four major revenue sources. Industries, Agriculture, fishing and Tourism. Tourism A Coastal district on the North Eastern Sea board Balasore has destination of having been called the " scenarios of Orissa " with heritages of green paddy fields, a network of rivers, blue hills, extensive meadows and extraordinary beach. The religious centers at Remuna, Chandaneswar, Panchalingeswar, Sajanagarh, Ayodya, Maninageswar Temple at Bardhanpur are popular among the devotees and form major attraction for the tourists. The district also hosts as a paradise for nature lovers to explore the rich diversity availed by the hills, sea and forests. The beaches of Chandipur, Kashapal, Chaumukh, Kharasahapur and Talsari are some of the most peaceful beaches which provide quite a distinct experience from the spoils of civilization. The Similapal Forest reserve and Nilgiri reserves provide nature lovers a natural abode for vacations. The fort of Raibania and the deshuan pokhari are among locations which are historically significant. Divisions Balasore is the district headquarters. The district is further divided into 2 subdivisions, 12 blocks for undertaking developmental works in the rural areas, 7 tehsils for revenue and administrative purposes and 289 (257 old + 32 new) Gram Panchayats . Besides there are 4 towns consisting of 1 municipality and 3 NACs(Notified Area Councils). These local bodies look into civic aspects of urban areas. Also, there are 2971 villages, out of which 2602 are inhabited. The district has 1 Loksabhaconstituency and 7 vidhan sabha constituencies. Blocks The names of the various blocks are given below. Balasore subdivison Bahanaga Balasore Baliapal Basta Bhograi Jaleswar Khaira Remuna Simulia Soro Nilgiri subdivison Nilgiri Oupada Tehsils Tehsils Balasore Baliapal Basta Jaleswar Nilgiri Simulia Soro Demographics As of 2001 India census, Baleshwar had a population of 20,23,000. Males constitute 52% of the population and females 48%. Baleshwar has an average literacy rate of 86%, higher than the national average of 59.5%. 11% of the population is under 6 years of age.

1. Field of the Invention The present disclosure relates to a mobile terminal capable of capturing an external environment using a camera. 2. Description of the Related Art Mobile terminals may include all types of devices configured to have a battery and a display unit, and display information on the display unit using power supplied from the battery, and formed to allow a user to hand-carry it. The mobile terminal may include a device configured to record and play a video and a device configured to display a graphic user interface (GUI), and may include a laptop computer, a portable phone, glasses, a watch, a game machine, and the like capable of displaying screen information. As it becomes multifunctional, a mobile terminal can be allowed to capture still images or moving images, play music or video files, play games, receive broadcast and the like, so as to be implemented as an integrated multimedia player. Moreover, efforts are ongoing to support and increase the functionality of mobile terminals. Such efforts include software and hardware improvements, as well as changes and improvements in the structural components. In recent years, as functions associated with cameras become more diversified due to the enhanced performance of cameras, a user has experienced inconvenience in carrying out a complicated process of setting or executing his or her desired functions. Furthermore, in order to edit an image or control a specific function using the image, it has a disadvantage in that the process of capturing an image should be first carried out.

Q: C# type conversion inconsistent? In C#, I cannot implicitly convert a long to an int. long l = 5; int i = l; // CS0266: Cannot implicitly convert type 'long' to 'int'. An explicit conversion exists (are you missing a cast?) This produces said error. And rightly so; if I do that, I am at risk of breaking my data, due to erroneous truncation. If I decide that I know what I am doing, then I can always do an explicit cast, and tell the compiler that it's okay to truncate, I know best. int i = (int)l; // OK However, the same mechanism does not seem to apply when using a foreach loop. IList<long> myList = new List<long>(); foreach (int i in myList) { } The compiler does not even generate a warning here, even though it is essentially the same thing: an unchecked truncation of a long to an int, which might very well break my data. So my question is simply: Why does this foreach not create the same error as the variable assignment does? A: UPDATE: This question was the subject of my blog in July of 2013. Thanks for the great question! Why does this foreach not create the same error as the variable assignment does? "Why" questions are difficult to answer because I don't know the "real" question you're asking. So instead of answering that question I'll answer some different questions. What section of the specification justifies this behaviour? As Michael Liu's answer correctly points out, it is section 8.8.4. The whole point of an explicit conversion is that the conversion must be explicit in the code; that's why we have the cast operator; it's waving a big flag that says "there's an explicit conversion right here". This is one of the few times in C# where an explicit conversion is not extant in the code. What factors motivated the design team to invisibly insert an "explicit" conversion? The foreach loop was designed before generics. ArrayList myList = new ArrayList(); myList.Add("abc"); myList.Add("def"); myList.Add("ghi"); You don't want to have to say: foreach(object item in myList) { string current = (string)item; In a world without generics you have to know ahead of time what types are in a list, and you almost always do have that knowledge. But this information is not captured in the type system. Therefore, you have to tell the compiler somehow, and you do that by saying foreach(string item in myList) This is your assertion to the compiler that the list is full of strings, just like a cast is an assertion that a particular item is a string. You are completely correct that this is a misfeature in a world with generics. Since it would be breaking to change it now, we're stuck with it. The feature is quite confusing; when I first started programming C# I assumed that it had the semantics of something like: while(enumerator.MoveNext()) { if (!(enumerator.Current is string) continue; string item = (string)enumerator.Current; That is, "for each object of type string in this list, do the following", when it really is "for each object in this list assert that the item is a string and do the following..." (If the former is what you actually want then use the OfType<T>() extension method.) The moral of the story is: languages end up with weird "legacy" features when you massively change the type system in version 2. Should the compiler produce a warning for this case in modern code, where generics are being used? I considered it. Our research showed that foreach(Giraffe in listOfMammals) is so common that most of the time we'd be giving a warning for correct code. That creates trouble for everyone who compiles with "warnings as errors" turned on, and it's generally speaking badness to have a warning on code that is yes maybe a bit smelly but actually correct. We decided to not pursue the warning. Are there other situations where the C# compiler invisibly inserts explicit conversions? Yes. In fact someone asked a question about that just a few hours after this one: Compiler replaces explicit cast to my own type with explicit cast to .NET type? There are some extremely obscure interop scenarios where explicit conversions are inserted as well. A: As defined in §8.8.4 of the C# 4.0 specification, a foreach statement of the form foreach (V v in x) embedded-statement is expanded to { E e = ((C)(x)).GetEnumerator(); try { V v; while (e.MoveNext()) { v = (V)(T)e.Current; // <-- note the explicit cast to V embedded-statement } } finally { … // Dispose e } } where C is the "collection type" and T is the "element type" inferred from x. The cast to V (int in your case) is what allows your example to compile. The likely reason for the cast to V: in C# 1.0, before generics was added to the language, an explicit cast was usually needed anyway when enumerating through a collection like ArrayList, because the compiler could not automatically figure out the type of values in the collection. A: The simple answer is foreach does an explicit cast behind the scenes. Another example: public class Parent { } public class Child : Parent { } IList<Parent> parents = new List<Parent>() { new Parent() }; foreach (Child child in parents) { } This will also not generate a compiler error, but will throw an InvalidCastException at runtime.

A parasitic assassination technique that Sakon and Ukon can use with their level 2 cursed seal active, and their unique kekkei genkai. With the power of chakra, he disassembles his body down to a cellular, and even to a proteinic level, and enters the enemy's flesh. This cruel technique gradually corrodes the inner bodily cells of those he merges with, and death ensues. Though any injuries the host body receives are also suffered by the user, leaving them susceptible to any of the host's suicidal attempts. Trivia Until Kiba's unhesitating attempt to commit suicide to take Ukon with him, Ukon claimed that this technique's greatest strength is that none of his previous victims dared attack due to fear of harming their own bodies.

1903 New Zealand1903 Pictorial Letter Card to London, then redirected on arrival, franked with a 1d cancelled by a WELLINGTON AUG 8 1903 roller canceller. Stapled to the inside are six pictures, including 'Mountaineering Scene', 'The Maori', 'Gold Prospectors' etc. An interesting item.£45.00Reference: K3195 Send to a friend.Name: E-mail address: 1941 New Zealand1941 censored air mail envelope to Philadelphia, USA, endorsed at the top 'Pacific Airmail via Clipper', franked with a 4/- cancelled with an AUCKLAND 21 MCH 1941 slogan canceller. New Zealand censor tape is on the left that has been tied by a violet 'Passed by Censor N.Z.' handstamp. A scarce usage of the 4/- stamp.£55.00Reference: K3191 1904 New Zealand1904 envelope sent registered to Hobart, Tasmania (Tattersall's) bearing a pair of 2d cancelled CARTERTON 18 NO 04. A large violet 'Registered at / Carterton N.Z.' with the number '746' inserted by hand is at the lower left of the cover., on the back are Travelling P.O. / Inwards / Wellington – Napier 18 NO 04, Dunedin 19 NO and Hobart NO 24 04 transit and arrival cancels. Usual Tattersall's spike hole! £95.00Reference: K3147 Send to a friend.Name: E-mail address: 1912 New Zealand1912 registered envelope to Germany bearing a strip of six and a single ½d and a 1d paying the 4½d rate, cancelled by MARUA JE 19 12 datestamps. A Poessneck 28.7.12. arrival cancels on the back. An unusual franking.£100.00Reference: K3143 Send to a friend.Name: E-mail address: 1896 New Zealand1896 envelope to India bearing a 2d and ½d, cancelled WAITARA 11 NO 96. On the back are Auckland 14 NO, Colombo DE 8, Tuticorin 10 DE and Experimental P.O. DE 12 96 datestamps. An unusual item. £190.00Reference: K3142 Send to a friend.Name: E-mail address: 1871 New Zealand1871 envelope to Christchurch bearing a 2d, correctly paying the local rate, tied by a barred '16' oblitorator with a KAIAPOI MY 9 71 datestamp on the back. A Christchurch arrival canceller of the same date is also on the back of the cover. On the front is a very fine strike of the scarce 'TOO LATE' handstamp of Kaiapoi. The reason for this handstamp is that although it arrived in Christchurch the same day it was posted, it had missed the first delivery. Kaiapoi is about ten miles north of Christchurch. A very fine and scarce cover.£550.00Reference: K3125 Send to a friend.Name: E-mail address: 1871 New Zealand1871 envelope to Birsay, Orkney, Scotland, bearing two 2d's (the left stamp being a worn plate pale blue) and a 6d red-brown, tied by DUNEDIN MY 18 71 duplex cancellers. On the back are Thurso JY 16 and Stromness JY 17 71 transit datestamps. A great destination, Birsay being at the north west corner of the Orkney Main Island.£275.00Reference: G2772 Send to a friend.Name: E-mail address: 1900 Boer War1900 New Zealand Contingent envelope to Wellington endorsed 'On Active Service 4th Cont. N. Z. R. R.' with a Field Post Office DE 7 00 datestamp. The cover was taxed and a New Zealand 1d postage due affixed and tied. The sender, John Ross, 1032, has signed the cover at the lower left and the officer commanding has also signed alongside. A Wellington arrival cancel is on the back of the cover. Private John Ross was from Clutha and was in the 4th Contingent that sailed for South Africa on the 'Monowai' on 20th March 1900. He served for 1 year and 123 days in South Africa before being shipped back to New Zealand. He re-enlisted with the 10th Contingent this time as a Sergeant on April 14 1902 and served 87 days in South Africa. He was awarded the Queen’s S.A. Medal and Clasps “Cape Colony”, “Transvaal”, “Rhodesia”, “South Africa 1901” and “South Africa 1902” medals. £325.00Reference: K2780 Send to a friend.Name: E-mail address: 1869 New Zealand1869 Army and Navy Hotel, Queen Street, envelope to Melbourne, Victoria, franked with a pair of 3d cancelled by AUCKLAND MR 23 69 duplex cancellers. A Melbourne AP 17 69 arrival c.d.s. is on the back of the cover. An early hotel advertising cover.£180.00Reference: Send to a friend.Name: E-mail address: 1907 New Zealand1907 registered cover to Melbourne, Australia, with a 4d cancelled MASTERTON 7 MY 07. A registration handstamp is at the upper left of the cover, on the back is a Melbourne 16. 5. 07. arrival cancel.£20.00Reference: K2698 Send to a friend.Name: E-mail address: 1904 New Zealand1904 registered envelope to Dunedin franked with a 1d and two 1½d's, paying the 4d rate, cancelled WELLINGTON 8 FE 04. A Dunedin 10 FE arrival c.d.s. is on the back. £48.00Reference: K2690 Send to a friend.Name: E-mail address: 1912 New Zealand1912 envelope to Denmark franked with a ½d and a pair of 1d's cancelled OTAUTAU 30 DE 12. A Copenhagen 3.2.13. arrival c.d.s. is on the back. Fine. £38.00Reference: K2443 Send to a friend.Name: E-mail address: 1944 New Zealand1944 censored airmail envelope to Scotland franked with a 3/- and a 6d cancelled by a WANGANUI 30 JN 1944 slogan canceller. £50.00Reference: K2166 Send to a friend.Name: E-mail address: 1910 New Zealand1910 advertising envelope for the New Zealand Express Co. to London, unfranked but has a pink DUNEDIN PAID 3 AP 10 datestamp as well as a Dunedin roller cancel of the same date.£90.00Reference: K1943 Send to a friend.Name: E-mail address: 1901 Boer War1901 envelope, from a member of the New Zealand Contingent, endorsed 'No stamps available, on active service, 3668'. An ARMY POST OFFICE, NATAL FIELD FORCE STANDERTON MAY 30 1901 octagonal datestamp is on the front of the cover along with a Wellington 14 JUL 01 arrival cancel. Written by Private Alan Bruce Saunders to his father, Private Saunders No 3668 of the 19th Company sailed to South Africa on the S. S. Cornwall on January 30 1901. This was in the 6th Contingent that went there. An interesting item. £375.00Reference: G2474 Send to a friend.Name: E-mail address: 1900 Boer War1900 envelope, from a member of the New Zealand Contingent, Trooper T Gaudin, endorsed 'Tom on active service / No. 85 N.Z.M.R.' bearing a Transvaal 2d and ½d which have Army Post Office cancels. On the reverse are Wellington DEC 12 and Auckland DEC 14 1900 transit and arrival cancels. Trooper No 85, Thomas Joseph Holte Gaudin was in the first detachment of 214 New Zealand troops that was sent to South Africa, which left Wellington on the S S Waiwera on 21 October 1899, 11 days after war was declared. A scarce item from a trooper in this first contingent of New Zealand Mounted Rifles. £400.00Reference: G2470 Send to a friend.Name: E-mail address: 1900 Boer War - New Zealand Contingent1900 envelope endorsed 'On Active Service, No Stamps Available' to Wellington, New Zealand, with a Plymouth 21 AP 00 cancellation. The cover has been signed at the lower left by J.W.Wingfield. On the back is a Wellington JUN 7 1900 arrival cancel. It would appear as though this was posted on a troopship taking New Zealand soldiers to South Africa. £390.00Reference: G2429

Evan Mathis of the Philadelphia Eagles Pees (or Fake Pees) on the IRS The offensive lineman posted the above photo to Instagram yesterday with the message “Audit this.” It’s not clear from the photo whether Mathis was actually peeing (there is no evident stream of urine) or just pretending. Either way, he is now the front-runner for the 2016 GOP presidentialnomination.

For nearly 20 years, Antone Johnson has served as lawyer, advisor, executive and advocate for emerging growth technology/digital media ventures, founders and investors in a diverse range of business and intellectual property matters. Raised in Menlo Park and Palo Alto, California, suffused with Silicon Valley's unique culture of innovation, he came of age professionally during the Internet explosion of the late 1990s, an entrepreneurial crucible of unprecedented wealth and job creation, reinvention of countless industries, and related venture capital and Wall Street dealmaking. Antone was fortunate to have a ringside seat at major Los Angeles and Silicon Valley law firms,... Barry Melton is a Lake County, California, attorney admitted to practice law before all the courts of the State of California since 1982; and he is admitted to practice before California's Central, Eastern and Southern U.S. District Courts. He is also qualified to practice before the U.S. Court of Appeals for the Ninth Circuit. Barry has been admitted to the bar of the United States Supreme Court for more than 20 years. In addition to a broad range of general legal practice experience, Barry Melton is an attorney certified as a specialist in criminal law by the Board of Legal... Sean's law practice is focused primarily on technology ventures, such as software, wireless telecommunications, and Internet-related companies, as well as firms in the visual effects, concept art and emerging media space. Sean's seventeen years of diverse legal experience make him well-suited to act as a "virtual general counsel" to his venture clients, guiding such enterprises through the complex legal and regulatory environment of the United States and abroad--and in all stages of growth, from founding to IPO. Having closed countless complex technology transactions with numerous Fortune 100 companies worldwide, Sean has become the consummate deal lawyer, bringing to the table an... Ted Parker is a business trial lawyer with extensive experience in a broad range of industries: securities, IP and e-commerce, construction, products liability, agriculture and food products, film and publishing. After graduation from Cornell Law School, he began practice in business law at Brobeck, Phleger & Harrison in San Francisco. He was the first corporate counsel at ITEL Corporation. More recently, he has practiced as a large-firm partner (K&L Gates) and a small-firm partner (Berg & Parker), and now operates a "virtual" law firm, collaborating with colleagues electronically. He has handled major litigation nationally and internationally,... Ashley is founder of Talbot Law Firm. As an attorney in the firm’s emerging business practice, Ashley counsels startups with incorporation, early stage financing, employment issues, intellectual property protection, technology licensing, commercial partnerships and various other corporate transactions. Ashley believes that understanding a company’s vision and priorities is important to devising strategies to solve legal problems so companies can focus on their goals. Ashley has nearly 3 years in-house experience representing entrepreneurs in a wide range of corporate, commercial and intellectual property matters. Ashley received a J.D. from University of San Francisco School of Law and a B.A. in... As the founder of the Pacific Workers’ Compensation Law Center, Oakland attorney Eric Farber represents injured workers across many industries. Mr. Farber has been working as an attorney for over two decades. Before entering the legal field, Mr. Farber worked at the United Talent Agency and Sony Pictures-associated production company Signature Films. On several occasions, he has been selected for inclusion in the list of Northern California Super Lawyers®. He is a graduate of the Golden Gate University School of Law. For a case evaluation, contact the firm today. My goal is always to achieve the best possible outcome for the client. My current practice focuses on live musical and theatrical entertainment, and general civil litigation in federal and state courts. Other practice areas include alternative dispute resolution, copyright and trademark consultation, licensing and protection of intellectual property rights, employment issues, internet law, and appellate work. I also have substantial prior business experience in internet, alcoholic beverage distribution and entertainment industries. I am fluent in Hebrew. Mark A. Pearson is a founding partner at ARC Law Group (www.arclg.com), a law firm focused on counseling Creative, Talented and Entrepreneurial clients. His primary practice areas involve forming business entities, counseling on trademark & copyright issues, and drafting contracts for music, film & new media clients. His list of interesting and eclectic clients include entertainment industry tech firms, social media outlets, online content providers, film, radio & television producers, live entertainment companies, publishers and video game developers. Mark and his partner, Anne Yarovoy, have also been known to associate with various theater producers, musicians, industry execs,... Spiller Law is a business, estate planning and entertainment law firm located in San Francisco, California. Business: We serve small to medium-sized businesses in the areas of contracts, business planning, mergers and acquisitions, partnership agreements, corporate formation and dispute resolution. We have advised businesses in involved in aviation, finance, health care, insurance, manufacturing, real estate, music, film, and television. Estate Planning: We work with individuals and couples to create simple to sophisticated estate plans, depending on their needs. Entertainment Law: We advise film/TV, new media, and music clients as to business planning, business formation, contract negotiation, and licensing Gemma L. Mondala's practice is broad but focuses primarily on business litigation, employment law and complex litigation matters. Gemma's experience includes the defense of insureds against claims related to automobile accidents, premises liability, products liability, slip/trip and falls, dog bites, toxic torts and construction defects. She has also represented business clients in enforcing and defending against breach of contract and business tort claims (i.e. intentional interference with contract and business advantage, breach of the covenant of good faith and fair dealing, fraud and misrepresentation) as well as claims involving breaches of fiduciary duties. Gemma also advises Cities, Counties and... Amy Laughlin has been achieving exceptional results for clients since 1992. After graduating with honors from The University of Michigan Law School, Amy joined the San Francisco office of Orrick, Herrington & Sutcliffe, LLP. While there, she counseled individuals and corporations in a wide range of complex financial matters. In 2013, Amy opened her own practice where she focuses primarily on divorce, business and entertainment law. The Justia Lawyer Directory is a listing of lawyers, legal aid organizations, and pro bono legal service organizations. Whether you were injured, are accused of a crime, or are merely engaging in everyday affairs that affect your legal rights or property, an attorney can help you resolve problems or prevent new ones from arising. Here are just a few situations where you might want to seek the advice of an attorney: You were injured in a car or truck accident You have been arrested and charged with a crime, such as DUI or shoplifting You are considering separating from your spouse You have been subjected to harassment or other discrimination at work Use Justia to research and compare Elverta attorneys so that you can make an informed decision when you hire your counsel. It is important to research an attorney before hiring him or her. Be sure to evaluate an attorney's experience (types of cases handled, prior results obtained, etc.). Although prior results are not indicative of the likelihood of success in your case, they can help you make an informed decision. Also worth serious consideration is the attorney's location, particularly if you will be traveling to visit him or her for consultations. Finally, research an attorney to see whether he or she has ever been subject to discipline. Although disciplinary actions do not necessarily impact the attorney's competence to handle your case, they may affect your decision whether to hire.

There is comp, when everything looks/works fine. But when try to nest this "horse" comp into another or try to render it, file and preview remains empty (no image, black, nothing). But, when I try to "Save frame as" - image is there. Your layers are all guide layers -- meaning they are visible in the viewer for the comp they are in, but they will not render on output or when precomposed. This is a great feature when you use it intentionally to bring some kind of reference into a comp, but it can be quite confusing if you've set them accidentally! To fix your issue, select your horse layers, then from the Layer menu, toggle "Guide Layer." They will now render normally.

search : DNR Nongame work also aids other wildlife SOCIAL CIRCLE, Ga. (Jan. 3, 2008) -- Jason Wisniewski hopes to spend 40 days hunting deer and other game this season. In late November, however, the wildlife biologist with the Wildlife Resources Division's Nongame Conservation Section was hunting for endangered mussels on Florida's Apalachicola River, part of a federal survey spurred by drought and dropping lake levels upstream in Georgia. Wisniewski, a specialist in freshwater mussels, sees no disconnect between his favored recreation and his beloved occupation. Mussels, which filter water and provide food for other species, are part of a foundation of life encompassing all creatures and habitats. "They're all really linked together," he said. The linkage is evident in Georgia, where projects led by the Nongame Conservation Section, which is charged with conserving nongame species as diverse as bald eagles and pitcherplants, also benefit game animals, their habitats and the sportsmen who pursue them. The section receives no general revenues from the state, depending instead on donations, grants and fund-raisers such as wildlife license plate sales. But ripples from the work spread wide. Consider that: Money from the Nongame Wildlife Conservation Fund and grants obtained by nongame staff have helped the Georgia Department of Natural Resources acquire more than 34,000 acres since 2002, all open to hunting and, where applicable, fishing. Another $2 million-plus is earmarked as partial payment for 3,900 acres of the Silver Lake Tract at Lake Seminole Wildlife Management Area and the 4,162-acre Fort Barrington Tract at Townsend WMA in McIntosh County. A 20,000-acre, $35 million Georgia Land Conservation Program package announced by Gov. Sonny Perdue in December bundled those tracts with a 6,900-acre addition to Paulding Forest WMA. Six regional education centers teach some 50,000 Georgia children a year about wildlife, natural habitats and stewardship, topics that cross game-nongame boundaries. Cash raised for the Nongame Wildlife Conservation Fund is only part of the picture. Nongame Conservation Chief Mike Harris said employees also pull down an impressive amount of competitive grants and other funds. The long list of projects funded includes land acquisition, longleaf pine restoration on state property and work involving Alabama shad, an important forage for some gamefish. "Over the last five years, every $1 of Nongame Conservation money spent for conservation was matched with $1.90 from federal grants and other sources," Harris said. Benefits flow both ways, with Game Management and Fisheries sections' projects also boosting some nongame species. And underlying all is an understanding that sizing up wildlife management and conservation is best done with a wide-angle lens. Many sportsmen appreciate the contribution of nongame wildlife to their enjoyment of the outdoors, Harris said. For example, coastal anglers seeking king mackerel, redfish and tarpon rely on feeding brown pelicans and royal terns to find schools of pogies, or Atlantic menhaden, a popular baitfish. "The presence of nongame wildlife enriches the experience for everyone," Harris said. Wisniewski would agree. His deer-stand highlights this season include seeing the biggest buck of his life and spotting his first fisher, a rare member of the weasel family making a comeback in Pennsylvania, where Wisniewski was hunting. Jason Wisniewski hopes to spend 40 days hunting deer and other game this season. In late November, however, the wildlife biologist with the Wildlife Resources Division's Nongame Conservation Section was hunting for endangered mussels on Florida's Apalachicola River, part of a federal survey spurred by drought and dropping lake levels upstream in Georgia. workflow_wrd: Approved You Might Also Be Interested In: Try to imagine the landscape of much of Georgia 200 years ago - it was vastly different from today. Early travelers and naturalists described scenes of extensive open forests, savannas and even rolling prairies maintained by frequent fires either ignited by lightning strikes or set by American Indians over much of the coastal plain and into parts of the piedmont. This open, grassy countryside with a low density of longleaf pines or other fire-adapted trees supported a very different range of birds than the species typically seen in most of the region today. The Zahnd Natural Area in Walker County covers some 1,380 acres of the Cumberland Plateau physiographic region. Zahnd sits on the eastern edge of Lookout Mountain and across McLemore Cove from Pigeon Mountain. Kristina Summers, a senior public relations and information specialist with the Georgia Wildlife Resources Division, attended much of the fourth annual Teacher Conservation Workshop held June 23-27 at Charlie Elliott Wildlife Center in Mansfield. Here is her in-the-field glimpse of the workshop and participants adventures around the state. Much has been written of the longleaf pinelands of South Georgia and the fact that most have disappeared through conversion to pine plantations, development, cropland and other overall changes in land use. Yet an even scarcer habitat than a longleaf pine forest is a seepage bog with acres and acres of pitcherplants. Doerun Pitcherplant Bog Natural Area has both – intact longleaf-wiregrass uplands and acres and acres of pitcherplants!

Mutagenesis and modelling of the alpha(1b)-adrenergic receptor highlight the role of the helix 3/helix 6 interface in receptor activation. Computer simulations on a new model of the alpha1b-adrenergic receptor based on the crystal structure of rhodopsin have been combined with experimental mutagenesis to investigate the role of residues in the cytosolic half of helix 6 in receptor activation. Our results support the hypothesis that a salt bridge between the highly conserved arginine (R143(3.50)) of the E/DRY motif of helix 3 and a conserved glutamate (E289(6.30)) on helix 6 constrains the alpha1b-AR in the inactive state. In fact, mutations of E289(6.30) that weakened the R143(3.50)-E289(6.30) interaction constitutively activated the receptor. The functional effect of mutating other amino acids on helix 6 (F286(6.27), A292(6.33), L296(6.37), V299(6.40,) V300(6.41), and F303(6.44)) correlates with the extent of their interaction with helix 3 and in particular with R143(3.50) of the E/DRY sequence.

Gynecologic imaging: current and emerging applications. Common diagnostic challenges in gynecology and the role of imaging in their evaluation are reviewed. Etiologies of abnormal uterine bleeding identified on pelvic sonography and sonohysterography are presented. An algorithmic approach for characterizing an incidentally detected adnexal mass and use of magnetic resonance imaging for definitive diagnosis are discussed. Finally, the role of F18-fluorodeoxyglucose positron emission tomography in the management of gynecological malignancies, and pitfalls associated with their use are examined.

D3 dopamine receptor mRNA is elevated in T cells of schizophrenic patients whereas D4 dopamine receptor mRNA is reduced in CD4+ -T cells. The expression of dopamine receptors was examined in purified human neutrophils, monocytes, B cells, natural killer cells and CD4+ - and CD8+ -T lymphocytes by RT-PCR. In healthy subjects, D1 and D2 receptors were not expressed in leukocytes. Real Time PCR for dopamine receptors D3 and D4 disclosed that D3 receptors are expressed in T cells and natural killer cells and D4 receptors in CD4+ -T cells. The comparison of schizophrenic patients with sex- and age-matched controls revealed a significantly higher expression of D3 receptor mRNA in T cells of schizophrenic patients, whereas D4 receptor mRNA in CD4+ -T cells was downregulated.

Aaron Pinkston is a freelance writer and professional coordinator living in Chicago, Illinois. He graduated from the University of Illinois with a degree in Cinema Studies in 2007 and is currently a member of the Online Film Critics Society. His love of film spawned from over-night horror film parties as a teenager growing up in a small town. What it's about: Tom is a young girl who lives with her father Will deep in the woods of a public park outside of Portland, Oregon. They keep their lives simple, only going into the city when they need to, and they don't stay in one place for long. When Tom is spotting by a jogger, their lives are turned upside down. They are forced into society, given a place to stay in exchange for Will's work on a tree farm. Possibly for the first time in her life, Tom has a place in a community with other people her age. But will her father be able to handle following society's rules or will his instinct to run affect his daughter once again? Unorganized thoughts: Where films fit in with the year tends to change over the course of the year but at this moment Debra Granik's Leave No Trace is my favorite film of 2018 so far. It is glorious, devastating drama that is also strangely life affirming. The long-awaited narrative follow-up to Granik's Winter's Bone, Leave No Trace shares a similar environment and stakes, but is a much richer and diverse emotional experience. The film didn't immediately strike me as a coming-of-age drama, though it technically fits in the genre, with Tom's journey of coming into society. Tom is at an interesting age given her strange circumstances. She's starting to become an independent person, able to question her father and find her own interests. She is still completely loyal and trusting in his decisions, but that is starting to change. Thomasin McKenzie's performance probably won't be on my end-of-year lists but she is quite good and is able to stand across from the venerable character actor Ben Foster. Their chemistry is great, especially in non-verbal moments. Even without an incredible amount of plot, there isn't much explicit backstory given to the characters -- it is all there, though nothing you learn about Tom or Will comes out unnaturally. Really, how they came to this situation isn't as important as spending time with them and seeing where they are going. When Will decides to leave the farm house there is a mix of emotions. In a way, it is heartbreaking because they could have led a good life there and Tom clearly was interested in the socialization. But, of course, Will's pain and perspective is completely understood. It is an interesting plot turn that it is only when they actively decide to leave a more comfortable life when things begin to fall apart. The natural response from everyone they meet is that they are running from something or are in some kind of trouble. It would probably be easier to understand, a more digestible story. It probably would have been easier for the film to make that the case, as well. It could offer some inherent stakes or character motivates, even making the film more like a thriller. Leave No Trace doesn't need it though to be compelling. In a very strange way, Leave No Trace is really life affirming. It returns constantly to the idea of kindness of strangers, even toward a man who can't trust others. There are no villains in Leave No Trace despite a slew of potential ones -- no one takes advantage of their struggle, attempts to break them apart. Honestly, there is hard to think of anyone in their situation being treated so fairly. Toward the end of the film there is a pretty clear metaphor of a bee colony that could have soured the emotional complexity. It works, however, because Tom understands the metaphor and can use it to help her father understand the world a little better, too. Some potential spoilers on the ending ahead. The ending moments are really challenging on an emotional and character level. I don't know if the characters make the right moral decisions and I don't know how much I can judge them. It is such a pivotal developmental moment for Tom, one of the first times she makes a completely independent decision and so there is something beautiful about it. It could have been a tragic ending and in some ways it is. Tom and Will are no doubt better together. It isn't "happily ever after." But it makes so much sense within the context of their story. I desperately want Granik and Kelly Reichardt to collaborate, maybe make a film with two parts that connect in some thematic or narrative way. They have clear common interests of struggle and nature and they draw their characters so beautiful. While Leave No Trace seems very similar to films like Wendy and Lucy and Old Joy, they aren't the same filmmaker. I think Reichardt works more in the effect of a harsh nature on people where Granik focuses a bit more on how people work with each other in a harsh nature. It would be fascinating to see their approaches coming together. But I'm also cool if they both just continue to make more of their beautiful films.

The Service I received from the Orders and Customer Service Team was very professional. Their responses were very quick and actioned on immediately. Mr Gueorgui TzvetanovSenior ManagerERGO Austria International AG The Research and Markets’ customer support team provided me with timely and immediate responses and delivered exactly the information that I was looking for – great job. Thank you very much. I would recommend them to anybody who is looking for market research data. Great customer service and super responsive. I was having issues with my payment method but Claire in customer service was super responsive to help several times until the issue was entirely resolved. Great job Mr Detlef RethagePresidentNitto Avecia Inc The reports ordered are of good quality and are relevant to our business needs. Mr Etienne AdriansenSenior Director Business EvaluationLEO Pharma Thank you for all of your help! I think your service is excellent. It is an easy platform to order interesting reports. Mr Tomi AmberlaConsultantPöyry Management Consulting The team at Research and Markets are first rate. Their market intelligence is relevant and accurate and the customer service fast, responsive and dependable. I always benefit from knowledge gained from their comprehensive studies and will continue to utilize their services. Ms Liz DickinsonCEOPhysical Enterprises Inc I have bought reports from other sources but the report that I bought from Research and Markets was the most detailed of the lot. Their customer service was excellent and I was able to get the report without any fuss. Mr Naveed KamalAsst Manager: Business DevelopmentRangs Group Ltd Celebrating 15 years in business by partnering with UNICEF for education FEATURED COMPANIES “Stringency of vehicle safety legislations and increasing demand for connected car devices and services to fuel the demand for over-the-air (OTA) updates market for automotive”The global over-the-air (OTA) updates market for automotive is projected to grow at a CAGR of 18.2% from 2017 to 2022, to reach USD 3.89 billion by 2022. The major factors driving the growth of the market include the increased production of electric vehicles, rising demand for connected car devices, government regulations regarding safety and cyber security of the vehicle, and increasing demand for advanced applications such as telematics and infotainment. Also, the new vehicle safety norms are encouraging the automakers to protect vehicle data from remote hacking and malfunctioning, which in turn is increasing the demand for OTA updates for automotive. On the other hand, the non-availability of supporting infrastructure in developing countries may pose a challenge to the growth of the automotive OTA updates market. “Increasing number of telematics applications would drive the OTA updates market for telematics control unit (TCU) across the globe”The telematics control unit (TCU) is estimated to account for the largest share of the global OTA updates market for automotive in 2017. The TCU application is projected to dominate the OTA updates market for automotive during the forecast period. The growth of OTA updates market for TCU segment is expected to be driven by the increasing number of telematics applications. Various automotive OEMs, especially in North America and Europe, are offering telematics control unit as a standard device in their vehicles. OEMs such as General Motors (U.S.), Mercedes-Benz (Germany), BMW (Germany), and Volkswagen AG (Germany) offer the telematics control unit in their passenger car models. Furthermore, the TCU will help the automotive companies to analyze the frequently occurring problems within the vehicle, which will then be rectified in the new vehicle models. The updates in TCU applications and real-time data analytics are expected to drive the OTA updates market for TCU application. “Software over-the-air (SOTA) updates –To remain predominant during the forecast period”The software over-the-air (SOTA) updates market is estimated to hold the largest share of the global OTA updates market for automotive in 2017. The segment is estimated to grow at a significant CAGR and is expected to remain the largest market during the forecast period. The growth of automotive SOTA updates segment is driven by the increasing infotainment applications such as live traffic updates, park assist, e-mail applications, and social media apps. The study contains insights of various industry experts, ranging from component suppliers to Tier 1 companies and OEMs. The break-up of the primaries is as follows: Research Coverage:The report segments the OTA updates market for automotive and forecasts its size, by volume and value, on the basis of region (Asia-Pacific, Europe, North America, and RoW), technology type (firmware over-the-air (FOTA) and software over-the-air (SOTA)), application type (telematics control unit, electronic control unit, infotainment, safety and security, and others), vehicle type (passenger cars and commercial vehicle), and electric vehicle type (BEV, HEV, and PHEV). The qualitative analysis of advanced features is also provided. Reasons to Buy the Report: This report contains various levels of analysis, including industry analysis (industry trends, Porter’s Five Forces, and competitive leadership mapping), and company profiles, which together comprise and discuss the basic views on the emerging and high growth segments of the OTA updates market for automotive, competitive landscape matrix, high-growth regions and countries, government initiatives, and market dynamics such as drivers, restraints, opportunities, and challenges. The report enables new entrants and smaller firms as well as established firms to understand the market better to help them to acquire a larger market share. Firms purchasing the report could use any one or a combination of the below-mentioned four strategies (market development, product development/innovation, market diversification, and competitive assessment) to strengthen their position in the market. The report provides insights into the following points: Market Penetration: The report offers comprehensive information about the OTA updates market for automotive and the top 12 players in the market. Product Development/Innovation: The report provides detailed insights into upcoming technologies, R&D activities, and new product launches in the OTA updates market for automotive. FEATURED COMPANIES The automotive industry is witnessing the development of disruptive technologies and innovations. Various advanced features such as infotainment, telematics systems, and autonomous driving have become an integral part of high-end automobiles. Most of these technologies use real-time data and require regular updates such as live traffic updates and map updates. The connected vehicle platforms are increasingly enabled to receive over-the-air (OTA) updates that communicate operational and diagnostic data from onboard systems and connected devices. Also, automakers seek to use OTA updates to enhance customer satisfaction by increasing operational efficiency, vehicle performance, and feature advancement. At the same time, OTA updates can improve the response time and reduce vehicle recalls and expenses. Over-The-Air (OTA) updates is a process of transmitting diagnostic and operational data from a remote server to onboard systems and components of the vehicle to upgrade various applications of the vehicle such as ECU algorithms and infotainment. These eliminate the need to visit a workshop, dealer garage, or vendor site. OTA updates can be categorized into Firmware over-the-air (FOTA) and Software over-the-air (SOTA) updates. FOTA updates refer to the upgradation or replacement of firmware program stored in ECU, memory, or connected devices. On the other hand, Software over-the-air (SOTA) updates require downloading of software components to update or replace software components such as maps, graphics, fonts, audio, and video multimedia of the device. The global OTA updates market for automotive is projected to reach USD 3.89 Billion by 2022, at a CAGR of 18.2% from 2017 to 2022. Some of the key market drivers are increasing number of connected car devices in vehicles, increasing application of infotainment, and government norms regarding vehicle safety and security. The global OTA updates market for automotive is segmented by technology type, application, vehicle type, electric vehicle type, and region. The SOTA updates market accounts for the largest share of the global OTA updates market. However, in terms of growth, the FOTA updates market is projected to grow at the highest CAGR during the forecast period. The SOTA updates segment is projected to remain the largest market during the forecast period. The growth of automotive SOTA updates segment is expected to be driven by increasing infotainment applications such as live traffic updates, park assist, e-mail applications, and social media apps. Also, to understand the application areas, the report discusses the market for automotive OTA updates under five distinctive applications, namely, telematics control unit (TCU), electronic control unit (ECU), infotainment, safety and security, and others. Further, to understand the application of OTA updates in different vehicle segments, the market is segmented into passenger cars and commercial vehicles. By electric vehicle type, the market is segmented into battery electric vehicle (BEV), hybrid electric vehicle (HEV), and plug-in hybrid electric vehicle (PHEV). The study also segments the global OTA updates market for automotive into four key regions, namely, Asia-Pacific, Europe, North America, and the Rest of the World (RoW). The telematics control unit (TCU) is estimated to account for the largest share of the global OTA updates market for automotive in 2017. The infotainment application is estimated to be the second largest segment of the OTA updates market, followed by electronic control unit (ECU), safety and security, and others. The others segment includes user interface program and applications. The growth of the OTA updates market for TCU segment can be attributed to the increasing number of telematics applications. Various automotive OEMs, especially in North America and Europe, are offering telematics control unit as a standard device in their vehicles. OEMs such as General Motors (U.S.), Mercedes-Benz (Germany), BMW (Germany), and Volkswagen AG (Germany) provide the telematics control unit in their passenger car models. Furthermore, the TCU will help the automotive companies to analyze the frequently occurring problems within the vehicle, which will then be rectified in the new products. The updates in TCU applications and real-time data analytics are expected to drive the OTA updates market for TCU application. North America is estimated to account for the largest market share followed by Europe, Asia-Pacific, and Rest of the World (RoW), respectively. North America is projected to be the largest market during the forecast period due to various factors such as increasing connected car devices in vehicles, ramping up of electric vehicle production, infotainment and telematics services updates, and increasing safety updates. In terms of growth, the Asia-Pacific OTA updates market is estimated to grow at the highest CAGR during the forecast period. The market growth in Asia-Pacific is expected to be driven by increasing number of connected car devices in vehicles and growing communication and information technology infrastructure. Some of the major restraints for the global OTA updates market for automotive are lack of supporting infrastructure and low awareness in developing countries. As of 2017, there is a low penetration of connected car devices in developing countries due to lack of supporting infrastructure for data communication. These factors may pose a challenge to the growth of the OTA updates market for automotive. The major players in the global OTA updates market for automotive are Robert Bosch GmbH, Continental AG, Verizon Communications, Harman International, Garmin Ltd., Airbiquity, Movimento, and Delphi Automotive PLC. The last chapter of this report covers a comprehensive study of the key vendors operating in the OTA updates market for automotive. The competitive landscape matrix is divided into four distinct categories, namely, dynamic differentiators, visionary leaders, emerging companies, and innovators. The evaluation of market players is done by taking various factors into account such as new product development, R&D expenditure, business strategies, product revenue, and organic and inorganic growth.

All relevant data are within the paper and its Supporting Information files. Introduction {#sec001} ============ The term "crossed laterality" is employed to refer to people whose hand, eye, foot, or ear dominance are not uniformly right- or left-sided. The idea that crossed laterality is linked to academic performance is becoming increasingly popular in the area of school education. A simple search in Google of the terms \"Crossed + laterality + right + hand + left + eye + exercises\" returns around 33.000 entries, most of them containing links to articles, fora and specialised centres focused on this issue. The majority of these sites establish a direct association between crossed laterality and learning difficulties and offer information about different programmes aimed at remediating these disabilities by restoring unilateral dominance in children. For instance, The Institute for Neuro-Physiological Psychology (INPP), founded in the UK and now established in more than 20 countries, offers remedial training for children who show crossed laterality, with the aim of improving their educational outcome. It also offers licenses to use the INPP method as an independent practitioner. Similarly, The Brain Balance Achievement Centres, with around 100 subsidiaries in United States, offer a specific training called The Brain Balance Program, aimed at restoring natural dominance in children with a mixed-dominance profile. Finally, The Superior Institute of Psychological Studies offers assessments and interventions for crossed laterality in more than 15 centres in Spain. These programs may cost up to €350 \[[@pone.0183618.ref001]\]. Since Orton \[[@pone.0183618.ref002]\] suggested that an ill-established cerebral dominance was the cause of several disabilities, a number of interventions, such as the ones mentioned above, have been created to ameliorate learning disabilities by performing specific physical exercises that are assumed to restore or consolidate laterality. For instance, a popular method known as patterning \[[@pone.0183618.ref003]\] is aimed at imposing cerebral dominance through a series of physical exercises which consist of manipulating the child's head and/or extremities in patterns intended to imitate prenatal and postnatal movements. The method lacks any supporting evidence and has been the object of severe criticism \[[@pone.0183618.ref004],[@pone.0183618.ref005]\]. However, it remains popular in several countries \[[@pone.0183618.ref006]\]. Another intervention based to some extent on Orton's theory is Brain Gym^®^, an educational program originally created by Paul E. Dennison and Gail Dennison in 1980. Brain Gym^®^ prescribes a number of simple movements intended to improve the integration of specific brain functions with body movements. According to its authors, lateral dominance is essential for reading, writing, listening, speaking, and the ability to move and think at the same time \[[@pone.0183618.ref007]\]. In spite of its popularity in schools all over the world, this intervention has been widely proven as ineffective \[[@pone.0183618.ref008]\]. Several studies have reported that crossed lateral people are at special risk of suffering learning disabilities, while others have reported the opposite result \[[@pone.0183618.ref009]--[@pone.0183618.ref018]\]. According to these mixed results, crossed laterality might or might not be a risk factor for learning disabilities and poor academic performance. In the same vein, studies addressing the relationship between handedness (regardless of lateral dominance in other parts of the body) and intelligence have yielded mixed and inconsistent results, although recent meta-analyses point to a slight cognitive advantage of right-handers \[[@pone.0183618.ref019]\] and a higher prevalence of atypical-handedness among intellectually disabled individuals \[[@pone.0183618.ref020]\]. In any case, to the best of our knowledge, the effectiveness of existing interventions aimed at addressing crossed laterality has never been put to the test in rigorous studies. The use of interventions with dubious or null evidence in the classroom or other educational contexts can be harmful in different ways. For instance, educational professionals and families must often devote much energy and emotion during the implementation of the interventions \[[@pone.0183618.ref021]\]. Many of these practices involve all the actors spending a great deal of time and enormous sums of money in individual counselling sessions for children, formative sessions for teachers and families or acquisition of reference materials by schools. This waste of time and money involves an opportunity cost, because these resources are taken away from effective treatments \[[@pone.0183618.ref022]\]. Even worse, the replacement of evidence-based practices by non-evidence based practices can harm children \[[@pone.0183618.ref023],[@pone.0183618.ref024]\]. The fact that interventions aimed at addressing crossed laterality have not been properly tested does not necessarily mean that some of their basic tenets regarding the relationship between crossed laterality, intelligence and academic performance have not been explored. In fact, as previously mentioned, since the 1960's a number of studies have tried to measure the impact of lateral dominance on these variables with mixed results \[[@pone.0183618.ref013],[@pone.0183618.ref025]\]. The goal of the present study is to conduct a systematic review of all the available evidence to assess the impact of crossed laterality on academic achievement and intelligence among students, from kindergarten to high school. If a link between them exists, it would be imperative to design studies that tackle the effectiveness of the interventions utilized in school settings. By contrast, if no link is found, it would be reasonable to divert the available resources into testing the effectiveness of scientifically grounded interventions. Materials and methods {#sec002} ===================== Search procedures {#sec003} ----------------- The present systematic review follows the recommendations of the PRISMA (see [S1 Table](#pone.0183618.s001){ref-type="supplementary-material"} and \[[@pone.0183618.ref026]\]). On August 15th 2016 the first author (MF) conducted an electronic search on the *Web of Science* entering the terms "\[(preference OR dominance) AND (hand OR eye OR ear OR foot OR manual OR ocular OR lateral OR cerebral)\] OR \[(cross\*) AND (lateral\* OR dominance OR preference)\] OR \[(mix\*) AND (preference OR dominance)\] OR \[(hemispheric) AND (indecision OR specialization)\] OR asymmetry OR bilateral OR laterality OR lateralization OR eyeness OR handedness OR hand skill" into the Title field. The search was limited to (a) English-language articles (b) published between 1900 and 2015 (c) with categories restricted to "behavioural sciences", \"neuroscience\", \"psychology\", \"psychology applied\", \"psychology biological\", \"psychology developmental\", \"psychology experimental\", \"psychology multidisciplinary\" and \"psychology social\", and (d) research areas restricted to "behavioural sciences", "education/educational research", "neurosciences/neurology", and "psychology". Unpublished dissertations, reviews and meta-analysis were excluded at this stage. After removing 503 duplicates this initial search yielded a sample of 10,540 studies. Titles and abstracts of these studies were screened by MF using the inclusion criteria C1-C4 explained below. This resulted in 36 full-text articles assessed for eligibility. Authors MF and MAV independently read the full texts of these 36 articles to check whether they fulfilled the inclusion criteria. Among the initial set of 36 articles assessed for eligibility, eight articles complied with the inclusion criteria. Thereupon, descendancy searches of articles citing or cited by these eight papers were conducted to identify additional studies. This resulted in 21 full-text articles which were also read independently by MF and MAV. Among them, a total of 14 studies were selected by the inclusion criteria. A second round of descendancy searches was conducted for articles citing or cited by each of these 14 papers, which led to 21 extra articles assessed for eligibility. Among this set, 4 additional studies were selected. Therefore, the final sample of articles reviewed for inclusion comprised 26 articles (8 + 14 + 4). These articles \[[@pone.0183618.ref011],[@pone.0183618.ref012],[@pone.0183618.ref015],[@pone.0183618.ref018],[@pone.0183618.ref027]--[@pone.0183618.ref048]\] are shown in [Table 1](#pone.0183618.t001){ref-type="table"}. A PRISMA flowchart summarizing the literature search process is depicted in [Fig 1](#pone.0183618.g001){ref-type="fig"}. Two of the studies selected were based on data that had already been collected and analysed in other articles, also included in our selection \[[@pone.0183618.ref028],[@pone.0183618.ref029],[@pone.0183618.ref040],[@pone.0183618.ref041]\]. Across all the full-text articles read for inclusion, initial inter-rater agreement was 93.58%. Disagreements were resolved by discussion and consensus between the two researchers until there was 100% agreement. {#pone.0183618.g001} 10.1371/journal.pone.0183618.t001 ###### Articles that met inclusion and quality criteria. {#pone.0183618.t001g} ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Author;\ N Gender Age \ \ Laterality \ Intelligence year Selection criteria Setting Academic achievement\ ------------------------------------------------------------- ------------------ ---------------- ----------------------------------- ------------------------------- ---------------------------------------------------------------- -------------------------------------------------------------------------------------------------- ----------------------------------------------------------------------------------------- -------------------------------------- -------------------------------------- -------------------------------------- -------------------------------------------------- ----------------------------------------------- \ 224 120F\ 60--132 months school population city nursery school and infant and junior schools Hand, eye^1^, foot non-standardised [(^8^)](#t001fn009){ref-type="table-fn"} n.s. **\_\_** **\_\_** The Peabody Picture Vocabulary Test The maze test of the Wechsler\ Annet & Turner, 1974 \[[@pone.0183618.ref027]\] \[A\]\ 104M Scale Balow, 1963 \[[@pone.0183618.ref028]\] \[A\] 302 151F, 151M 84 months school population n.s. hand, eye[^1^](#t001fn002){ref-type="table-fn"} Test Harris [(^8^)](#t001fn009){ref-type="table-fn"} The Gates Reading Readiness Tests\ **\_\_** **\_\_** **\_\_** Lorge-Thorndike Intelligence Test Gates Primary\ Reading Tests\ PPR-Paragraph Reading Balow & Barlow 1964 \[[@pone.0183618.ref029]\] \[A\] 250 n.s. 96 months school population n.s. hand, eye[^1^](#t001fn002){ref-type="table-fn"} Test Harris [(^8^)](#t001fn009){ref-type="table-fn"} The Gates Reading Readiness Tests\ **\_\_** **\_\_** **\_\_** Lorge-Thorndike Intelligence Test Gates Primary\ Reading Tests\ PPR-Paragraph Reading \ 147 n.s. 102 months school population rural general practice hand, eye[^2^](#t001fn003){ref-type="table-fn"} non-standardised [(^8^)](#t001fn009){ref-type="table-fn"} Neale Reading Ability Test **\_\_** **\_\_** **\_\_** Wechsler Scale for Children-R Bishop et al. 1979 \[[@pone.0183618.ref030]\] \[A\]\ \ 54,51,52 (A,N,D) n.s. 132 months school population parochial school hand, eye[^1^](#t001fn002){ref-type="table-fn"} non-standardised and the hole-in-the- card test[(^8^)](#t001fn009){ref-type="table-fn"} \ **\_\_** **\_\_** **\_\_** \_\_ Brod & Hamilton, 1971 \[[@pone.0183618.ref031]\] \[AB\]\ Reading of passages \ 234 n.s. 84 months (GR2)\ school population n.s. hand, ear[^5^](#t001fn006){ref-type="table-fn"} non-standardised [(^8^)](#t001fn009){ref-type="table-fn"} The Gates-MacGinitie Reading Test **\_\_** **\_\_** **\_\_** The Otis Quick-Scoring Mental Ability Test Bryden, 1970 \[[@pone.0183618.ref011]\] \[B\]\ 108 months (GR4)\ 132 months (GR6) \ 890 n.s. 84 months all born in the same hospital n.s. hand, eye^1^, foot^4^ Test Harris [(^8^)](#t001fn009){ref-type="table-fn"} \_\_ **\_\_** **\_\_** The Dunedin Articulation Check\ Wechsler Scale for Children-R Clymer & Silva, 1985 \[[@pone.0183618.ref032]\] \[A\]\ The Illinois Test of Psycho-linguistic Abilities \ 121 7F, 28M (N)\ \ reading disabilities n.s. hand, eye[^1^](#t001fn002){ref-type="table-fn"}, foot Test Harris [(^8^)](#t001fn009){ref-type="table-fn"} \_\_ **\_\_** **\_\_** **\_\_** \_\_ Coleman & Deutsch, 1964 \[[@pone.0183618.ref033]\] \[A\]\ 56M (D)\ 108.5--144.3 months (D)\ 26M, 4F\ 120.3--144 months (N)\ (D) \ 91 29F, 62M 84--141 months learning disabilities private elementary school for learning\ hand, eye[^1^](#t001fn002){ref-type="table-fn"}, foot Test Harris [(^8^)](#t001fn009){ref-type="table-fn"} n.s. **\_\_** n.s. **\_\_** \_\_ Conolly, 1983 \[[@pone.0183618.ref034]\] \[AB\]\ disabled children Dunlop et al., 1973 \[[@pone.0183618.ref012]\] \[A\] 30\ n.s. 103.3 months (N)\ reading disabilities local district primary schools hand, eye[^2^](#t001fn003){ref-type="table-fn"} non-standardised [(^8^)](#t001fn009){ref-type="table-fn"} Neale Reading Ability Test **\_\_** **\_\_** \_\_ \ (15N, 15D) 118.7 months (D) \_\_ Fagard et al., 2008 \[[@pone.0183618.ref015]\] \[A\] 42\ 10F, 8M (GR1)\ 72 months (GR1)\ school population regular public school hand, eye[^1^](#t001fn002){ref-type="table-fn"} non-standardised [(^9^)](#t001fn010){ref-type="table-fn"} Alouette standardized reading test **\_\_** **\_\_** **\_\_** **\_\_** (18GR1, 24GR5) 11F, 14M\ 120.4 months (GR5)\ (GR5) \ 129\ n.s. 103.32 months reading disabilities n.s. hand, eye[^1^](#t001fn002){ref-type="table-fn"} non-standardised [(^8^)](#t001fn009){ref-type="table-fn"} Gates Reading Diagnostic Test **\_\_** **\_\_** Tests of word pronunciation **\_\_** Gates & Bond, 1936 \[[@pone.0183618.ref035]\] \[A\]\ (64N, 65D) Harris, 1957 \[[@pone.0183618.ref036]\] \[A\] 561\ 42F,274M (D),\ 120 months reading disabilities n.s. hand, eye[^1^](#t001fn002){ref-type="table-fn"} Test Harris [(^8^)](#t001fn009){ref-type="table-fn"} n.s. **\_\_** **\_\_** **\_\_** \_\_ (245D, 316N) n.s (N) Hillerich, 1964 \[[@pone.0183618.ref037]\] \[A\] 400 n.s. 60 months\ school population kindergarten schools hand, eye[^1^](#t001fn002){ref-type="table-fn"} non-standardised [(^8^)](#t001fn009){ref-type="table-fn"} California Achievement Test **\_\_** **\_\_** **\_\_** California Short-Form Test of Mental Maturity 90 months at follow-up assessment Kirk, 1934 \[[@pone.0183618.ref038]\] \[B\] 61 30F, 31M high school intellectual disability state-funded institution for developmentally-disabled children hand, eye[^1^](#t001fn002){ref-type="table-fn"} non-standardised and Miles V-scope [(^8^)](#t001fn009){ref-type="table-fn"} Gray Oral Reading Tests \_\_ \_\_ \_\_ \_\_ Mahone et al., 2006 \[[@pone.0183618.ref039]\] \[AB\]\ 99 53F, 46M 36--70 months school population local preschools and day care centers hand, eye[^1^](#t001fn002){ref-type="table-fn"} non-standardised [(^9^)](#t001fn010){ref-type="table-fn"} \_\_ \_\_ \_\_ Peabody Picture Vocabulary Test \_\_ Muehl, 1963 \[[@pone.0183618.ref040]\] \[B\] 62\ n.s. 48.7 months (Y)\ school population cooperative preschools hand, eye[^1^](#t001fn002){ref-type="table-fn"} non-standardised and Miles V-scope [(^8^)](#t001fn009){ref-type="table-fn"} non-standardised **\_\_** **\_\_** **\_\_** **\_\_** (23Y, 39O) 58.2 months (O)\ \ 40 21F, 19M 60--72 months school population cooperative preschools hand, eye[^1^](#t001fn002){ref-type="table-fn"} non-standardised and Miles V-scope [(^8^)](#t001fn009){ref-type="table-fn"} Metropolitan, Achievement Test **\_\_** Metropolitan, Achievement Test **\_\_** \_\_ Muehl & Fry, 1966 \[[@pone.0183618.ref041]\] \[B\]\ \ 58 29F, 29M 111 months school population catholic elementary school hand, eye[^1^](#t001fn002){ref-type="table-fn"}, foot, ear[^6^](#t001fn007){ref-type="table-fn"} DKSLD [(^8^)](#t001fn009){ref-type="table-fn"} Educational Development Series **\_\_** Educational Development Series **\_\_** Otis-Lennon Test Roszkowski et al., 1987 \[[@pone.0183618.ref042]\] \[B\]\ Shaywitz et al. 1984 \[[@pone.0183618.ref018]\] \[AB\] 104\ 104M 132 months intelligence\ public school hand, eye[^7^](#t001fn008){ref-type="table-fn"}, foot[^7^](#t001fn008){ref-type="table-fn"} non-standardised [(^8^)](#t001fn009){ref-type="table-fn"} Woodcock-Johnson achievement battery Woodcock-Johnson achievement battery Woodcock-Johnson achievement battery \_\_ Wechsler Scale for Children-R (32N, 37G, 35D) learning disabilities Smith, 1950\ 100 100M 120 months reading disabilities parochial and public schools hand, eye[^1^](#t001fn002){ref-type="table-fn"} non-standardised [(^8^)](#t001fn009){ref-type="table-fn"} n.s. **\_\_** **\_\_** **\_\_** **\_\_** \[[@pone.0183618.ref043]\] \[AB\] \ 89 45F,44M first grades school population elementary\ hand, eye[^1^](#t001fn002){ref-type="table-fn"} non-standardised [(^8^)](#t001fn009){ref-type="table-fn"} Metropolitan Reading Readiness\ **\_\_** **\_\_** **\_\_** California Test of Mental Maturity Stephens et al., 1967 \[[@pone.0183618.ref044]\] \[B\]\ schools Test \ 120 (60N, 60D) n.s. 84.93 months (N)\ reading disabilities primary schools hand, eye[^1^](#t001fn002){ref-type="table-fn"}, foot, ear[^6^](#t001fn007){ref-type="table-fn"} non-standardised [(^8^)](#t001fn009){ref-type="table-fn"} Schonell Reading Test **\_\_** **\_\_** **\_\_** \_\_ Thomson, 1975 \[[@pone.0183618.ref045]\] \[A\]\ 84.82 months (D) \ 75 36F,39M first and second grades school population public elementary schools hand, eye[^1^](#t001fn002){ref-type="table-fn"} non-standardised [(^8^)](#t001fn009){ref-type="table-fn"} Metropolitan Achievement Test \_\_ \_\_ \_\_ \_\_ Trussell, 1969 \[[@pone.0183618.ref046]\] \[A\]\ Ullman, 1977 \[[@pone.0183618.ref047]\]\ 648 325F, 323M 66--149 months school population public schools hand, eye[^1^](#t001fn002){ref-type="table-fn"}, foot[^3^](#t001fn004){ref-type="table-fn"} non-standardised [(^8^)](#t001fn009){ref-type="table-fn"} Wide Range Achievement Test-Revised Wide Range Achievement Test-Revised Wide Range Achievement Test-Revised \_\_ Lorge-Thorndike Intelligence Test \[B\] \ 200 (100N,100D) 34F, 66M (N)\ 120.4 months (N)\ reading disabilities public schools hand, eye[^1^](#t001fn002){ref-type="table-fn"} non-standardised [(^8^)](#t001fn009){ref-type="table-fn"} Metropolitan Achievement Test **\_\_** **\_\_** **\_\_** **\_\_** Witty & Kopel., 1936 \[[@pone.0183618.ref048]\] \[A\]\[B\]\ 34F, 66M (D) 108.2 (D) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Note: \[A\] Absolute crossed laterality. \[B\] Relative crossed laterality. \[AB\] Absolute or relative crossed laterality. (A) Advanced group. (N) Normal group. (D) Disabled group. (GR1) First grade. (GR5) Fifth grade. (Y) Young group. (O) Old group. (G) Gifted group. (n.s.) Not specified. (F) Female. (M) Male. ^(1)^ Sighting task. ^(2)^ Sighting task and binocular task combined. ^(3)^Bilateral task. ^(4)^Bilateral and unilateral task combined. ^(5)^ Dichotic listening task. ^(6)^ Unilateral listening task. ^(7)^ Not specified. (^8^) Behavioural tasks. (^9^) Behavioural tasks and questionnaire. Selection criteria {#sec004} ------------------ Studies were selected for inclusion in this review if they met the following criteria: (C1) They used one or more lateral preference tasks for at least two of the following parts of the body: hand, eye, foot, or ear; (C2) they included a measure of crossed laterality according to the *absolute* or *relative* operative definitions described below; (C3) they measured the impact of crossed laterality on academic achievement or intelligence; and (C4) they included participants between 3 and 17 years old. Definition of crossed laterality {#sec005} -------------------------------- Throughout this article, we adopted the term "crossed laterality" because it was the most frequent in the literature reviewed. However, it should be noted that some researchers employ different terms to refer to the same phenomenon, such as "confused laterality" \[[@pone.0183618.ref049]\], "mixed preference" \[[@pone.0183618.ref047]\], "mixed hand-eye" \[[@pone.0183618.ref040]\] or "mixed dominance" \[[@pone.0183618.ref018]\]. In this regard, it is worth mentioning that nowadays the term "mixed dominance" usually refers to the lack of preference with respect to the same type of limb or organ, not to the combination of preferences of two different types of limbs or organs (i.e., "mixed handedness" refers to an unclear preference of the right or left hand). There is little consensus on the operative definition of crossed laterality through the reviewed literature. To address this problem, we established two operative definitions. *Absolute* crossed laterality refers to always using the same opposite sides of the body while performing different tasks with any combination of hand, eye, foot, or ear. In contrast, *relative* crossed laterality refers to the marked (but not exclusive) preference for using the same opposite sides of the body while performing different tasks. For example, a child whose dominant eye is the right in 80% of the observations and whose dominant hand is the left in 80% of them would not be considered crossed-lateral according to the first operative definition, but would be considered crossed-lateral according to the second one. *Absolute* and *relative* crossed laterality differ from *mixed* laterality in that the latter refers to an undistinguishable or equivocally determined preference for using either side of the body while performing different tasks \[[@pone.0183618.ref037]\]. To continue the example above, a child whose dominant eye is the right in 50% of the observations and whose dominant hand is the left in 50% of the observations would be considered mixed lateral according to our definitions and consequently would not comply with the inclusion criteria of this review. Studies that only measured mixed laterality or that conflated mixed and crossed laterality in their analyses were not included in this review. For instance, studies that considered laterality as a continuous variable, from totally right to totally left, were not included \[[@pone.0183618.ref010],[@pone.0183618.ref025],[@pone.0183618.ref050]--[@pone.0183618.ref055]\]. Similarly, studies where mixed and crossed laterality were merged were also excluded \[[@pone.0183618.ref009],[@pone.0183618.ref049],[@pone.0183618.ref056]--[@pone.0183618.ref060]\]. In either case, intermediate scores could refer either to genuine crossed laterality or to mixed laterality. In addition, studies that failed to report any measure of crossed laterality \[[@pone.0183618.ref013],[@pone.0183618.ref061]--[@pone.0183618.ref074]\] or that failed to explain how they categorized crossed lateral participants were excluded \[[@pone.0183618.ref075]--[@pone.0183618.ref078]\]. Data extraction and coding {#sec006} -------------------------- The 26 studies included were summarized in terms of characteristics of participants and setting (e.g., public school, catholic school), measures of crossed laterality, academic achievement, and intelligence (see [Table 1](#pone.0183618.t001){ref-type="table"}). Results {#sec007} ======= Participant characteristics {#sec008} --------------------------- The number of participants included in each study ranged from 30 to 890 (mean = 201.3; *SD* = 204.8). The age of participants ranged from 53 to 132 months (mean = 104.4; *SD* = 24.4). Ten studies did not report the gender of participants and one study only provided the gender of one of the groups compared (see [Table 1](#pone.0183618.t001){ref-type="table"}). Among the remaining 16 studies, 984 participants were female (38.2%) and 1590 were male (61.7%). The majority of participants (54%) were selected solely on the basis of being enrolled in a specific school, 23.5% were selected based on the presence or not of reading difficulties, 5.4% were selected based on the presence or not of learning difficulties or low intelligence, and 17% were selected based on being born in a specific hospital. In addition, 37% of participants came from public schools, 6.9% from private schools and 5% from religious schools. In the case of the remaining 49% of participants, the type of school was not specified. Methods used to measure laterality {#sec009} ---------------------------------- The final sample of studies included in this review used a wide variety of questionnaires and behavioural tasks to measure laterality, independently of the definition of crossed laterality adopted (i.e., absolute or relative). It is worth mentioning that not all the tests employed to assess laterality were equally valid and reliable. They differed substantially in terms of the quantity of tasks included as well as in terms of the availability of normative data. The studies included in this review also focused on different combinations of hand, eye, foot or ear to assess crossed laterality (see [Table 1](#pone.0183618.t001){ref-type="table"}). It is worth underlining that the measure of each part of the body comprises specific peculiarities and that the type of test employed may sharply constrain the results. The study performed by \[[@pone.0183618.ref079]\] offers a comprehensive analysis of the measurement of lateral preference and an extensive analysis of the prevalence and interrelationship of lateral preferences among the general population. Detailed information about each type of test that appeared in the present study is offered in the Supporting Information. Qualitative analysis {#sec010} -------------------- ### Crossed laterality and reading skill {#sec011} As can be seen in [Table 1](#pone.0183618.t001){ref-type="table"}, 23 studies measured the association between crossed laterality and reading performance. Only four of them \[[@pone.0183618.ref011],[@pone.0183618.ref012],[@pone.0183618.ref031],[@pone.0183618.ref041]\] detected a significant positive association between crossed laterality and reading performance (i.e., children with crossed hand-eye laterality performing significantly worse than children without crossed laterality). Furthermore, two studies obtained significant results in the opposite direction: Shaywitz et al. \[[@pone.0183618.ref018]\] found that crossed lateral children showed fewer serious problems in reading than uncrossed lateral children, while Stephens et al. \[[@pone.0183618.ref044]\] found that children with crossed hand-eye laterality performed better in reading than children without crossed laterality. ### Crossed laterality and spelling {#sec012} Two studies measured the association between crossed laterality and spelling performance (see [Table 1](#pone.0183618.t001){ref-type="table"}). None of them found a statistically significant association. ### Crossed laterality and arithmetic skills {#sec013} Four studies analyzed the effects of crossed laterality in arithmetic performance (see [Table 1](#pone.0183618.t001){ref-type="table"}). Only Muehl and Fry \[[@pone.0183618.ref041]\] reported a significant contribution of crossed dominance to arithmetic achievement. Specifically, children with consistent right preference in hand and eye obtained better results than children with right hand and left eye preference. ### Crossed laterality and language {#sec014} Four studies measured the association between crossed laterality and language in terms of vocabulary or articulation (see [Table 1](#pone.0183618.t001){ref-type="table"}). None of them found a significant relationship between crossed laterality and language performance. ### Crossed laterality and intelligence {#sec015} Eleven studies analyzed the relationship between laterality and intelligence (see [Table 1](#pone.0183618.t001){ref-type="table"}). Only one of these studies found a relationship between crossed laterality and intelligence. Specifically, Bishop et al. \[[@pone.0183618.ref030]\] found a significant association between crossed laterality and intelligence in a small subgroup of children classified as predominantly uncrossed or predominantly crossed according to reference eye. ### Other results {#sec016} Together with the outcomes described above, one of the studies included in this review \[[@pone.0183618.ref039]\] explored the association between crossed laterality and visual attention. The results showed no relationship between these variables. In addition, Conolly \[[@pone.0183618.ref034]\] explored the association between crossed laterality and learning disabilities. The results showed that crossed laterality was more prevalent in learning disabled children than in normal children. Quantitative meta-analysis {#sec017} -------------------------- The 26 studies selected for the present systematic review rely on a wide range of methods to assess crossed laterality, academic achievement, and intelligence. Consequently, any quantitative synthesis of these studies must be taken with caution. However, to avoid relying exclusively on a vote-counting approach we conducted a meta-analysis of the effect sizes reported in these studies. Unfortunately, about half of them failed to report sufficient information to compute a valid effect size estimate. The remaining studies provided enough information to compute an effect size in the Cohen's *d* scale or reported contingency tables that could be used to compute an odds ratio, which we converted to a Cohen's *d* effect size using the equations provided by \[[@pone.0183618.ref080]\]. All the effect sizes we computed focused on the comparison of crossed lateral and uncrossed lateral participants, which means that some of the comparisons covered in the previous qualitative review, which focused in specific sub-groups of crossed-lateral or preferentially crossed lateral children, were not included in the meta-analysis. Although we could only extract a single effect size from most studies, some of them contained sufficient information to compute several effect sizes. For instance, Bishop et al. \[[@pone.0183618.ref030]\], measured crossed laterality using two different measures of eyeness (sighting eye and reference eye) and they also measured two outcome measures, reading and intelligence. Furthermore, they reported results in a way that allowed crossed laterality to be conceptualized according to both our absolute and relative definitions. Accordingly, we were able to extract six equally valid effect sizes from this study. Six other studies also contributed with several effect sizes to our meta-analysis. More information about the procedure followed to compute each effect size can be found at the Open Science Framework, <https://osf.io/akg3h/>. Given that some studies contributed several effect sizes, while others were represented by a single effect size, these studies cannot be integrated using a simple univariate meta-analysis, because this would give extra weight to studies reporting several effect sizes. To overcome this problem, we fitted a three-level random effects models, clustering effect sizes at the study level. All the statistical analyses were conducted with the metafor R package \[[@pone.0183618.ref081]\]. All the effect sizes included in the general meta-analysis, with their corresponding 95% confidence interval, are depicted in [Fig 2](#pone.0183618.g002){ref-type="fig"}. Negative effect sizes denote a relative disadvantage of crossed lateral children over children without crossed laterality. As can be seen, only a handful of studies yield effect sizes that depart noticeably from zero, in either direction. The meta-analytic effect size for all studies, shown at the bottom, is *d* = -0.03, 95% CI \[-0.10, 0.04\], which is not significantly different from zero, *z* = -0.73, *p* = .46. Furthermore, the amount of heterogeneity across studies failed to reach statistical significance, *Q*(26) = 31.50, *p* = .21, suggesting that in principle the variation observed across studies can be attributed to chance alone. [Fig 2](#pone.0183618.g002){ref-type="fig"} also presents the meta-analytic average for two subsets of studies that focused on the impact of crossed laterality on reading and intelligence. The meta-analytic estimates were *d* = -0.03 \[-0.13, 0.06\] and -0.04 \[-0.17, 0.08\], respectively, and in both cases failed to reach statistical significance, *z* = -0.67 and *z* = -0.69. {#pone.0183618.g002} A funnel plot, with all the effect sizes plotted against their standard errors, is offered in [Fig 3](#pone.0183618.g003){ref-type="fig"}. All the effect sizes falling within the grey contour would be statistically non-significant in a two-tailed test. As can be seen, only studies with low precision (high standard errors) yield effect sizes that depart noticeably from zero, while studies comprising more participants tend to yield effect sizes consistently close to zero. Furthermore, the funnel plot shows that the distribution of effect sizes is clearly symmetrical, suggesting that the results of the meta-analysis are unlikely to be affected by publication bias. {#pone.0183618.g003} Discussion {#sec018} ========== The majority of the studies included in this review failed to find any relationship between the preference for different sides of the body when performing tasks that involved any combination of hand, eye, foot, or ear and performance in reading, spelling, arithmetic, language or intelligence tests. As explained in the qualitative analysis, some studies showed that crossed laterality was associated with lower scores in reading \[[@pone.0183618.ref011],[@pone.0183618.ref012],[@pone.0183618.ref031],[@pone.0183618.ref041]\], arithmetic \[[@pone.0183618.ref041],[@pone.0183618.ref042],[@pone.0183618.ref047]\], intelligence \[[@pone.0183618.ref030]\] or other variables \[[@pone.0183618.ref034]\]. However, these results were not consistently replicated in other studies and sometimes they even failed to be replicated within the same study with different selection criteria or different dependent variables. Furthermore, the quantitative meta-analysis shows that among those studies reporting sufficient information to compute an effect size the average effect size was not significantly different from zero. For instance, in the study of Dunlop et al. \[[@pone.0183618.ref012]\] the lower performance of children with crossed laterality was only observed when measuring eye dominance with the criterion of the controlling eye but not with the criterion of the sighting eye, which is the most widely used in the literature (see the [S1 File](#pone.0183618.s002){ref-type="supplementary-material"} and \[[@pone.0183618.ref082]\]). In addition, they measured the preferred hand, using a unique writing task, which has questionable validity for being frequently culturally biased \[[@pone.0183618.ref083]\]. It is also worth noting that the sample size of the study conducted by Dunlop et al. \[[@pone.0183618.ref012]\] is only 30 participants (the smallest sample in [Table 1](#pone.0183618.t001){ref-type="table"}) and that the two groups of children (dyslexics and controls) came from very different educational and social backgrounds, without any attempt to match them in terms of age or other variables. In a study specifically designed as a replication of Dunlop et al., \[[@pone.0183618.ref012]\] Bishop et al. \[[@pone.0183618.ref030]\] failed to replicate these results with a much larger sample (*N* = 147), although as discussed below she did detect lower intelligence in a small subset of crossed lateral children. Similar problems apply to the other three studies reporting a positive relationship between crossed laterality and reading problems. In the study by Bryden \[[@pone.0183618.ref011]\] the relationship between crossed laterality and lower reading performance was confined to boys with an intermediate or low reading achievement in relation to their IQ. In the case of girls, no relationship between crossed laterality and reading disabilities was observed under any assumption. In a study with only 40 participants (the second smallest study in [Table 1](#pone.0183618.t001){ref-type="table"}, after \[[@pone.0183618.ref012]\]), Muehl and Fry \[[@pone.0183618.ref041]\] found that uncrossed lateral children (right-hand and right-eye) performed better in a reading task than crossed lateral children (right-hand and left-eye) and left-eyed children. However, due to the reduced number of children with left-hand and right-eye laterality and left-hand and left-eye laterality, the authors could not determine whether crossed laterality or eyeness was the outcome associated to lower reading achievement. The same problem applies to the study conducted by Brod and Hamilton \[[@pone.0183618.ref031]\], who actually concluded that the poor performance of crossed lateral children was not due to crossed laterality itself but to the fact that most children in this sample were left-eye dominant. Furthermore, two studies reported better reading skills in crossed-lateral children than in control participants. Specifically, Shaywitz et al. \[[@pone.0183618.ref018]\] found that children with crossed laterality showed fewer problems of a severe nature in reading. Similarly, Stephens et al. \[[@pone.0183618.ref044]\] found that children with crossed laterality had a tendency to perform better in reading than those with an uncrossed laterality pattern, although this trend failed to reach full statistical significance. As in other studies finding a significant relationship between crossed laterality and reading performance, these two studies relied on relatively small samples of only 104 and 89 participants, respectively. Overall, the collective weight of this evidence does not support the conclusion that there is a reliable association between crossed laterality and reading performance. Significant (either positive or negative) associations between both variables were observed predominantly among the smallest studies and only in some of the dependent variables or in small subgroups of participants. The majority of studies, including those with the largest sample sizes, found no relationship between crossed laterality and reading skills. This conclusion is further supported by the results of the meta-analytic synthesis, as can be seen in [Fig 3](#pone.0183618.g003){ref-type="fig"}. A small number of studies reported positive correlations between crossed laterality and other variables related to academic achievement or intelligence. Muehl and Fry \[[@pone.0183618.ref041]\] detected that uncrossed lateral children (right hand and right eye) obtained better results in arithmetic tasks than crossed lateral children (right hand and left eye). However, as explained above, the authors could not establish whether crossed laterality or eyeness was the outcome related to poorer performance. Additionally, the small sample size of this study raises suspicions about the reliability of this finding, bearing in mind that the other three studies exploring this association failed to detect a significant result. One study detected a significant association between crossed laterality and intelligence \[[@pone.0183618.ref030]\]. Interestingly, in this study there were no significant differences in intelligence between uncrossed- and crossed-lateral children. Rather, the significant differences found by Bishop et al. \[[@pone.0183618.ref030]\] were entirely due to the poor performance of a small group of children (*N* = 31) with 'predominantly uncrossed reference' or 'predominantly crossed reference', that is to say, children meeting our relative definition of crossed laterality. Far from concluding that there is a reliable association between crossed laterality and intelligence, the author herself concluded that 'this study finds no evidence that "crossed reference" \[i.e., laterality\] has any particular significance.' (p. 665). Furthermore, this trend fails to reach statistical significance when all participants are considered, as confirmed by the confidence intervals reported in [Fig 2](#pone.0183618.g002){ref-type="fig"}. Likewise, one study found that the proportion of children with crossed laterality was higher among learning disabled than among normal subjects \[[@pone.0183618.ref034]\]. However, the author did not specify the tools employed to classify children as learning disabled. In addition, she did not use a control group, but simply compared her results with the pattern observed in two earlier studies with completely different and unmatched samples \[[@pone.0183618.ref084]\]. Finally, no study detected an association between crossed laterality and spelling or language. Overall, the fact that the majority of studies failed to observe significant differences and that the few studies with significant findings yielded inconsistent results suggests that the significant effects obtained in children with crossed laterality are likely to be unreliable. This conclusion is consistent with the results of similar studies that were excluded from this review because they failed to provide an operative definition of crossed laterality or because they treated crossed and mixed laterality indistinctly (e.g., \[[@pone.0183618.ref016],[@pone.0183618.ref056],[@pone.0183618.ref057],[@pone.0183618.ref059],[@pone.0183618.ref060],[@pone.0183618.ref085]\], but see \[[@pone.0183618.ref013]\]). Similarly, these results are also consistent with previous non-systematic reviews done in the field of laterality \[[@pone.0183618.ref086],[@pone.0183618.ref087]\]. This review also highlights the substantial degree of heterogeneity that characterises studies of crossed laterality. In particular, there is little or no consensus on the operative definition of crossed laterality. While some studies establish strict criteria to define this phenomenon, other studies are quite flexible and vague or do not provide any operative definition of the concept at all (e.g., \[[@pone.0183618.ref060]\]). Furthermore, the tools employed to measure laterality are quite miscellaneous (see the [Supporting Information](#sec019){ref-type="sec"}) and, in many cases, the authors do not report indices of reliability and validity for their measures \[[@pone.0183618.ref012],[@pone.0183618.ref015],[@pone.0183618.ref039],[@pone.0183618.ref045]\]. Finally, there is great diversity among the characteristics of the samples and the outcomes measured. Taken together, these limitations hinder any progress in this area of research. The results of this study have important implications for education. The lack of strong evidence in favour of a relationship between crossed laterality and academic achievement calls into question the fact that educational psychologists spend time measuring crossed laterality and, even more, that crossed laterality should be the object of direct intervention to ameliorate learning disabilities. These results, in turn, echo the voices that have been raised previously against evaluations and interventions of this kind \[[@pone.0183618.ref049],[@pone.0183618.ref086],[@pone.0183618.ref088]\]. At present, there is no solid evidence that justifies the adoption of interventions addressed at treating laterality by education practitioners, let alone the use of them as a replacement for evidence-based interventions directly aimed at the target difficulties. Supporting information {#sec019} ====================== ###### PRISMA checklist. (DOC) ###### Click here for additional data file. ###### (DOCX) ###### Click here for additional data file. MF was supported by Grant AYD-000-235 from bizkaia:talent, Diputación Foral de Bizkaia, and by Programa Posdoctoral de Perfeccionamiento de Personal Investigador Doctor, Gobierno Vasco. MAV was supported by Grant 2016-T1/SOC-1395 from madri+d Science Foundation. [^1]: **Competing Interests:**The authors have declared that no competing interests exist.

<test-metadata> <benchmark-version>1.2</benchmark-version> <category>weakrand</category> <test-number>01799</test-number> <vulnerability>false</vulnerability> <cwe>330</cwe> </test-metadata>

Q: Protected left turn traffic signal data I wonder if there is a dataset of protected left turn (a left-oriented arrow) traffic signal? For example, a GIS dataset of the location of traffic lights that have this signal. I thought this information should be essential and easy to be found. However, after I've looked up many detailed traffic signal datasets (data.gov, OpenStreetMaps, and GIS open data websites), none of them seems to have protected left turn signal information. If there is no such dataset, what would be the rationale of lacking such data? US data preferred. A: OSM has this data, you can search for tags here. You can read more here: Mapping Turning Lanes in OpenStreetMap, and view key turn's documentation here. OpenStreetMap's Forum is essentially Stack Exchange for OSM, as well as OSM Slack

Topic not covered? Presentations with VideoScribe instead of PowerPoint E Emil Glownia Started a topic Mon, 30 Mar, 2015 at 11:30 AM Hi I like VideoScribe so much that I would like to use it instead of PowerPoint :) Below are a number of ideas that I would like to propose: 1) In preview mode would it be possible to add a tick box "Presentation mode" where the preview will stop after each animation and I can use mouse click to move on to the next one? This would allow me to talk during a webinar/session/presentation and not worry about timing. I believe this simple change would make things a lot easier. 2) Could you allow "playlists" where I can add existing presentations (scribe files) and move from one to another one easily? This is similar to powerpoint slides on left side but I prefer "playlist" because I have some shared slides likes Q&As and having a "link" to scribe files means that I need to update it only once and all future webinars will use the same updated scribe file. 3) I realize point 2 might take some time so I would like to offer an alternative approach which is ability to open scribe file directly from my PC folder, this would allow me to create a folder with shortcuts and get most of point 2 functionality, except moving fluidly to next presentation. The problem I have is that I can open scribe file using your program but it asked me to log in and loads the presentations which is not ideal for a webinar. Ideally when I open the file and go directly to preview mode (ideally with point one implemented). This option also means I don't have to export scribe file to wmv which takes a bit of time especially important for minor refinements/fixes. Thank you for considering my suggestions. Take care Emil 2 people like this idea D Daniel Port-Louis On Thu, 21 May, 2015 at 7:52 AM Yes, Emil, you're right. Sometimes my participants would ask questions or clarifications during a presentation and if I cannot "pause" the presentation and clarify for them, it will seem very awkward to move on to the next topic. If we have "manual" control over the playback of the presentation would be fantastic. Cheers Daniel Daniel McCormack On Thu, 21 May, 2015 at 10:27 AM Hi Emil and Daniel, Thanks for your suggestions/feedback! Having some kind of manual control over your presentation is an idea that has come up before and is on our list of things to look into.Also, regarding having a playlist, this would be difficult to do in the app itself as each scribe would have to load before it would play, but you could render your scribes as video files and put them together in a play list. D Dave Millman On Fri, 22 May, 2015 at 1:49 AM Powerpoint (or Keynote on Mac) has rich capabilities for live presentations. This would be time consuming and expensive for Sparkol to duplicate in VideoScribe. Here's a flexible way to do what you need: Divide your topic into sub-topics, with the intent that you can pause for questions/discussion after each sub-topic. Create a Scribe for each sub-topic. Design a standard transition between sub-topics. I start each sub-topic with a blank screen, and end each sub-topic with the most recent scribed content static on-screen, for reference during questions. In PowerPoint, each sub-topic gets its own slide. Match the slide background to the Scribe background so viewers see no difference between Scribe content and PowerPoint content. There are many advantages to this approach. It is easier to edit sub-topics than a long video. It is MUCH easier to insert new content into the middle of a longer presentation when you merely need to create one or more new sub-topics, than to edit a previous Scribe to insert new material in the middle. If you create multiple presentations around the same topic, you will find yourself reusing some of your sub-topics like building blocks. You can insert any PowerPoint content in between sub-topics. When you start to think about VideoScribe as creating clips for use in other apps, or in conjunction with clips created in other apps, it becomes even more useful. Most of my videos are made of 2-10 Scribes stitched together using another application, sometimes serially, sometimes in layers. A Alan Kmiecik On Sun, 18 Sep, 2016 at 3:58 PM Dave said "Powerpoint (or Keynote on Mac) has rich capabilities for live presentations. This would be time consuming and expensive for Sparkol to duplicate in VideoScribe" Don't think we're asking for a bunch of "rich capabilities" just the ability to pause...with one finger. Currently you can import into Powerpoint and use Alt-P to alternate between play/pause but, during a presentation that get pretty awkward. (Hey developers, can you mimick the alt-P so that, in powerpoint mode, while in screen show, left or right click = alt-P, just an idea). Also, it would be nice to be able to handout, on one sheet, the canvas. Personally, I would do that after the pitch. T Tony Heap On Mon, 8 May, 2017 at 9:04 PM I'd also really appreciate the ability to manually control my scribes, so I can use them while I present to the audience. I prefer the idea of building the whole presentation as a single scribe which pauses between "scenes" (a bit like Prezi) - rather than having lots of mini scribe clips. It could then also double up as a video with a voice-over (without the pauses, of course). Any sign of this feature appearing any time soon? I'd love to use it for a conference I'm presenting at in September. M Mike Metcalf On Tue, 9 May, 2017 at 12:06 AM related information about pausing: 1) in youtube pressing the K key on your keyboard will pause/unpause your video2) in Youtube clicking your video will pause/unpause your video3) in youtube pressing the spacebar will pause/unpause your video unless your browser is set up to use spacebar to scroll, in which case it may scroll your youtube page instead of pausing/unpausing the video.4) in powerpoint, clicking the video will pause/unpause5) in powerpoint you can use bookmarks to make your video pause at intervals decided by you, and resume with a click6) some video players will pause/unpause when you press the spacebar. -Mike (videoscribe user) Matthew Cook On Tue, 9 May, 2017 at 8:00 AM Admin Yes, you can use VideoScribe within Powerpoint and combine the best of both worlds. The engaging animation style of VideoScribe with the control of Powerpoint. You can add multiple scribe videos to a single Powerpoint file by creating separate scribes, rendering them as videos and importing into separate Powerpoint slides. As Mike said, you can pause videos within Powerpoint by either clicking or using bookmarks.

Women Make Up Less Than A Third Of Guests Brought On To Discuss Economy Only 28 Percent Of Guests In Segments About The Economy Are Women. From April 1, 2013, to March 31, 2014, women accounted for only 28 percent of guest appearances in segments primarily focused on the economy during evening programming on CNN, Fox News, and MSNBC. Gender Disparity In Segments About Economy Worst On Fox News. Of the three networks examined, Fox News hosted the smallest percentage of female guests in segments on the economy, with women only representing 26 percent of total guest appearances. CNN and MSNBC both provided proportionally more female guest appearances than Fox News, performing better than the average across all networks. Female Economists Almost Entirely Absent From Discussion Only 9.6 Percent Of Economists Were Female. Female economists accounted for roughly 9.6 percent of total economist appearances throughout the year. The lack of women economists on news programs belies the fact that in 2012, almost 32 percent of new economics doctorate recipients were women. Methodology Media Matters conducted a Nexis search of transcripts of evening (defined as 5 p.m. through 11 p.m.) programs on CNN, Fox News, MSNBC from March 31, 2013 through April 1, 2014. We identified and reviewed all segments that included any of the following keywords: econom!, jobs, growth, debt, and deficit. When transcripts were incomplete, we reviewed video. The following programs were included in the data: Crossfire, The Situation Room, Erin Burnett OutFront, Anderson Cooper 360, Piers Morgan Live, The Five, Special Report with Bret Baier, The O'Reilly Factor, Hannity, On the Record with Greta Van Susteren,The Kelly File, Hardball with Chris Matthews, Politics Nation with Al Sharpton,The Ed Show, All In with Chris Hayes, The Rachel Maddow Show,andThe Last Word with Lawrence O'Donnell. Media Matters only included segments that had substantial discussion of policy implications on the macroeconomy. We defined an economist as someone who either holds an advanced degree in economics, has worked in the economics profession, or has served as an economics professor at the college or university level.

By The U.S. Education Department announced Friday that Matteo Fontana, a career employee with responsibility for overseeing lenders, has been placed on administrative leave. In addition, the department announced that Margaret Spellings, the secretary of education, has asked for the resignation of Lawrence W. Burt from the Advisory Committee on Student Financial Assistance. Burt is director of financial aid at the University of Texas at Austin. Both Burt and Fontana owned stock in a lending company -- and the revelations about that ownership already have led Texas to suspend Burt and for some Congressional leaders to criticize the department's oversight of loan programs. The Milwaukee Journal Sentinel reported, meanwhile on the director of financial aid at the University of Wisconsin at Milwaukee serving on an advisory board for Student Loan Xpress, the lending company at the center of the controversy. Don Imus, the radio host, on Friday apologized for calling members of the Rutgers University women's basketball team "nappy-headed hos." In statements posted on the MSNBC Web site, Imus said that the "characterization was thoughtless and stupid, and we are sorry," and the network said that it does not share the views of Imus and that "we regret that his remarks were aired on MSNBC." A joint statement from Richard L. McCormick, president of Rutgers, and Myles Brand, president of the National Collegiate Athletic Association, said: "The NCAA and Rutgers University are offended by the insults on MSNBC's Don Imus program toward the 10 young women on the Rutgers basketball team. It is unconscionable that anyone would use the airways to utter such disregard for the dignity of human beings who have accomplished much and deserve great credit." Two top deans at Harvard University sent an e-mail message to professors last week urging them to take steps to cut students' textbook costs, The Boston Globe reported. Professors were urged to use more online materials or to decide earlier which books they will require, to give students more options to obtain less expensive copies. The deans didn't impose any new requirements, as the University of North Carolina System recently did. The scandal over Justice Department firings of prosecutors has drawn attention to a group that the Bush administration very much wants in government service: Regent University law school alumni, The Boston Globe reported. The university was founded by Pat Robertson, and the Globe article details the way graduates are highly sought by the Justice Department. Northwestern University is finalizing a deal to open a journalism and communications school in Qatar, the Associated Press reported. Northwestern would join a number of other American universities -- including Cornell, Georgetown and Texas A&M Universities -- that offer full degree programs in Qatar, usually in one academic area (Cornell in medicine, Georgetown in foreign service education and so forth). Several other American institutions, including Boston University, were seeking the contract for the communications program. Oakland University has announced plans to open a new medical school. While Oakland is a public institution in Michigan, only private funds are planned for the new school. The University of Minnesota football team has suspended three football players who have been jailed on charges of raping a woman who is not a student, The Minneapolis Star-Tribune reported.

Q: Using Saxon's DocumentBuilder with JAXB emits a warning about validation I have an application that uses JAXB (Moxy) and Saxon for running XPath expressions. Everything works as expected, but Saxon's DocumentBuilder emits this warning: XML Parser does not recognize the feature http://xml.org/sax/features/validation Code: Processor proc = new Processor(false); DocumentBuilder builder = proc.newDocumentBuilder(); XdmNode doc = builder.build(new JAXBSource(jaxbContext, jaxbObject));//The warning occurs here ... I think what's going on is JAXB is using a StaX parser and Saxon uses SAX. So when Saxon attempts to set the above property on the StaX parser, it fails. Is there a way to prevent Saxon from setting that property when building the document or, at the very least, suppress that warning? I've tried setting a bunch of different properties on the Processor, but none of them worked. I don't need validation anyway since the document has already been validated and read into a JAXB object. EDIT: I've been trying to override the errorListener on the Processor, DocumentBuilder, and the JAXBSource, but that message is not going through any of them. A: I'll look into this a bit more closely, but the first thing to say is that JAXBSource extends SAXSource, and Saxon treats it exactly like it treats any other SAXSource. The warning in the JAXB documentation "Thus in general applications are strongly discouraged from accessing methods defined on SAXSource" is vacuous - applications (like Saxon) when they are defined to accept an object of class X, don't in general take any notice of advice given in the specifications of a subclass of X that they have never heard of. The status of the property "http://xml.org/sax/features/validation" is a little unclear. IIRC the SAX specifications don't say that every XMLReader must recognize this property, but they do define it as the only way of requesting DTD expansion, and an XSLT processor needs DTD expansion to take place; if the XMLReader doesn't do DTD expansion then the transformation may fail in unpredictable ways, so a warning is justified. The cleanest way of suppressing the warning is probably to supply an XMLReader that does recognise this property, and delegate from there to an XMLReader that doesn't recognise it.

Using Google+ for Video and Podcasting There are many ways of using Google+ to create great unique and useful content for web. Being able to create content that engages users is paramount to achieving good positioning in the SERPS. You can start a great debate and write an opinion piece on it, quote all the important people who contribute, syndicate through social media channels whilst tagging those people and watch the traffic roll. All great for SEO and squeaky clean and penalty free, pandering to the latest Google update (read more about how the Google Panda update changed SEO). Use Google+ Hangouts to create great video content Here’s a way of using Google+ for content and SEO you may not have thought of yet. Use Google+ for SEO by using Hangouts to create video content. We know that Google loves video. Now, using Google+ they have created a way of getting people together to have a good debate called Hangouts. Record a great Hangout and hey presto you have a great video. It is important, however to make clear to the contributors that the debate is for public viewing, otherwise you could get yourself into trouble. Many companies have creative or strategic people in-house that could be put together using a Hangout. Alternatively, there maybe a group of experts in your niche that would be happy to join your Hangout for a bit of mutual publicity. First you would need to create a private Hangout with your chosen cast ready to join at a certain time. Currently Google+ allows up to ten people, but two would be enough if all you want is an interview. Then you need to record Hangout on your screen. Camtasia is a good paid for option, Jing is free. The possibilities are endless, great interviews, debates, opinion pieces, comedy. You can be as creative as you like, choosing strange locations, weirdly entertaining contributors. It’s easy, fun and you’ll be creating what Google loves (as long as it’s not rubbish), great content that people want to use and share and popular video content. Simples Here is a brilliant example: And here is one on how to do it: We have updated our SEO course to make sure that we offer the best advice for SEO after the latest updates, and are constantly refining the course in include anything and everything we learn along the way.

Monastic Tradition Credit: Scott McKown (Marvel 1602 #4 cover, 2004) Way of the Blind Devil Monks of the Way of the Blind Devil sacrifice their sight for other gifts and abilities. They sharpen their hearing and perceptions of touch to experience the world, preparing for both battle and uncovering hidden information in the world. Alternative Perception In order to chose this tradition at the 3rd level, you must be blind. You trained your other senses to partially compensate for your disability, and to use your ki to extend these senses to super-human levels. You gain the following abilities: As long as you can hear, you have blindsight to a range equal to your Unarmored Movement bonus, beginning with 10 ft. As a bonus action, you can spend 1 ki point to extend this range to 40 ft. for one minute. This range increases with your level, matching your Unarmored Movement speed. This increased blindsight requires your concentration, and as such you cannot also concentrate on a spell during this minute. You can spend additional ki points to increase this radius, equal to one half your movement speed per ki point spent. You cannot be tricked by visual illusions. (Auditory or tactile illusions function as normal.) While you automatically fail Perception (Wisdom) or Investigation (Intelligence) checks which rely on sight, you have advantage on these checks using your other senses. You gain resistance to radiant damage. Your superior hearing also makes you vulnerable to thunder damage. If you take thunder damage, you must make a Constitution saving throw, DC equal to the half of the damage taken, or be stunned for one round. Truth Seeker At 6th level, you have learned the subtle clues and tells that others give off when acting duplicitous. You gain proficiency in Insight (Wisdom); if you are already proficient, you can add double your proficiency bonus to checks you make with it. If the creature whose motive or honesty you are trying to detect is a Humanoid, you have advantage on Insight (Wisdom) checks against them. As an action, you can spend 1 ki point to force a Deception (Charisma) check made against you to have disadvantage. As a bonus action, you use your ki to find your opponent's weaknesses. You can spend 1 ki point and if your next attack hits, your opponent is vulnerable to the damage of that attack. Battlefield Awareness At 11th level, your awareness of the positions of threats against you has become more accute. You have advantage on melee attacks against opponents who are within 5 ft. of you at the start of your turn. Ranged attacks against you which originate within 60 ft. are made at disadvantage. You can spend a ki point to use your Deflect Missles reaction even if you have already used your reaction for the round. Radar Sense At 17th level, you have learned to process the sensory input around you to an incredible degree. You can now add double your proficiency bonus to any Perception (Wisdom) and Investigation (Intelligence) checks relying on hearing, touch, or smell. You can listen to any audible conversation, even through walls or other non-magical obstructions, at the following ranges: Whispered: 30 ft. Normal volume: 60 ft. Shouted: 120 ft. You can use an action to spend ki points to increase these ranges for 1 hour, 30 ft. per ki point spent. While you can hear all conversations within this range, you can only actively listen to one at a time. You can use an action to spend 5 ki points to discern the location of any creature you have met before within 1 mile, as long as they are not silenced or hidden by magic.

Running Node.js on a Rooted Android Phone - Straubiz http://www.readwriteweb.com/hack/2011/03/running-nodejs-on-a-rooted-android-phone.php ====== bergie WebOS actually ships with Node.js: [http://developer.palm.com/index.php?id=2109&option=com_c...](http://developer.palm.com/index.php?id=2109&option=com_content&view=article#javascript_services) Would be cool if Google did the same ------ pmjordan Since the V8 JavaScript engine runs on ARM, is there something about the Android environment that prevents running node.js directly? ------ yardie Or you could run node.js on a phone that doesn't need to be rooted /webos ~~~ fungi i dont see japan on this list <http://www.palm.com/intl/> but then again i do see australia but i have never seen a modern palm device here. ~~~ yardie They made some pretty bad decisions early on by not having a good international network. The pre plus and pre2 are available locked and unlocked on different GSM carriers so I don't see why it wouldn't be available in Australia or Japan.

Share this: Twitter Facebook WhatsApp LinkedIn Email Telegram New York, February 27, 2012—A Syrian videographer who documented unrest in the besieged city of Homs was killed in a mortar attack on Friday, according to news reports. Anas al-Tarsha is the fourth media fatality in Syria in the past week. Homs has been shelled daily for three weeks, with hundreds killed and thousands injured, according to news reports. Al-Tarsha, 17, was filming the bombardment in Qarabees, a district in Homs under heavy attack, when a mortar shell fell and killed him instantly, news reports said. Al-Tarsha regularly filmed clashes and military movements, and posted the videos on YouTube, news reports said. The videographer, also known as “Anas al-Homsi,” had been interviewed by Arabic broadcasters for information about fatalities and attacks on the city. His footage also appeared on the sites of citizen news organizations, according to news reports. “At extraordinary risk, Syrians such as Anas al-Tarsha have picked up their cameras to document for the rest of the world the devastation caused by the government’s ongoing attacks,” said Mohamed Abdel Dayem, CPJ’s Middle East and North Africa program coordinator. “Syrian authorities have done everything they can to shut down news coverage of their actions. Anas al-Tarsha and other local videographers have given their lives to ensure that the Syrian government would not succeed.” After the Syrian uprisings began last year, the government sought to impose a blackout on news coverage by controlling local media and expelling or denying entry to international journalists, CPJ research shows. International media have begun to rely heavily on footage shot by citizen journalists such as al-Tarsha. In all, eight journalists have been killed in Syria in the last four months, CPJ research shows. On Wednesday, two international journalists, Marie Colvin and Rémi Ochlik, were killed in the Baba Amr neighborhood of Homs. A day earlier, another Syrian videographer, Rami al-Sayed, was killed in the same area.

1. Field of the Invention The present invention relates to a variable gain amplifier having a low NF (noise figure), used for a front-end of a receiving apparatus. 2. Description of the Related Art A configuration of a conventional variable gain amplifier is shown in FIG. 9. A variable gain amplifier 110 is provided with a plurality of variable gain amplifier circuits called a first variable gain amplifier circuit 102, a second variable gain amplifier circuit 104, and a third variable gain amplifier circuit 106, a plurality of attenuation circuits called a first attenuation circuit 103 and a second attenuation circuit 105, and a gain control section 108. An input of the first variable gain amplifier circuit 102 is connected to an RF input terminal 1 and an output thereof is connected to an RF output terminal 6. An input of the second variable gain amplifier circuit 104 is connected to the RF input terminal 1 through the first attenuation circuit 103 and an output thereof is connected to the RF output terminal 6. An input of the third variable gain amplifier circuit 106 is connected to the input of the second variable gain amplifier circuit 104 through the second attenuation circuit 105 and an output thereof is connected to the RF output terminal 6. The gain control section 108 varies a gain of the first variable gain amplifier circuit 102, a gain of the second variable gain amplifier circuit 104, and a gain of the third variable gain amplifier circuit 106 according to a gain control voltage inputted into a gain control voltage input terminal 7. In order to vary the gain of the variable gain amplifier circuit, means for varying a bias current of the variable gain amplifier circuit is often used. Next, an operation of the variable gain amplifier 110 will be described using FIG. 10. FIG. 10 shows the gain of each signal path within the variable gain amplifier 110 versus the gain control voltage. Symbol G1 indicates the gain of the signal path in which the RF signal inputted into the RF input terminal 1 is amplified by the first variable gain amplifier circuit 102 and is subsequently outputted to the RF output terminal 6. Symbol G2 indicates the gain of the signal path in which the RF signal inputted into the RF input terminal 1 is attenuated by the first attenuation circuit 103 and is further amplified by the second variable gain amplifier circuit 104, and is subsequently outputted to the RF signal output terminal 6. Symbol G3 indicates the gain of the signal path in which the RF signal inputted into the RF input terminal 1 is attenuated by the first attenuation circuit 103, is further attenuated by the second attenuation circuit 105, and is further amplified by the third variable gain amplifier circuit 106, and is subsequently outputted to the RF signal output terminal 6. Symbol G4 indicates the gain of the variable gain amplifier 110. When the gain of the variable gain amplifier 110 becomes the maximum, the gain control section 108 operates so that the gain of the first variable gain amplifier circuit 102 may become the maximum, the gain of the second variable gain amplifier circuit 104 may become the minimum, and the gain of the third variable gain amplifier circuit 106 may become the minimum. When the gain control voltage changes so that the gain of the variable gain amplifier 110 may be reduced, the gain control section 108 operates so that the gain of the first variable gain amplifier circuit 102 may be reduced first and the gain of the second variable gain amplifier circuit 104 may be increased. When the gain control voltage changes so that the gain of the variable gain amplifier 110 may be further reduced, the gain control section 108 operates so that the gain of the first variable gain amplifier circuit 102 may be further reduced, the gain of the second variable gain amplifier circuit 104 may change to be reduced after increasing to the maximum, and the gain of the third variable gain amplifier circuit 106 may be increased. When the gain of the variable gain amplifier 110 becomes the minimum, the gain of the first variable gain amplifier circuit 102 becomes the minimum, the gain of the second variable gain amplifier circuit 104 becomes the minimum, and the gain of the third variable gain amplifier circuit 106 becomes the maximum. As the conventional variable gain amplifier, there has been a variable gain amplifier described in Japanese Unexamined Patent Publication (Kokai) No. 2003-60457. FIG. 11 shows a variable gain amplifier 117 described in the above-mentioned Japanese Unexamined Patent Publication (Kokai) No. 2003-60457. In FIG. 11, the same symbol is given to the same configuration as that shown in FIG. 9, and description there of will be omitted. The variable gain amplifier 117 is provided with a plurality of variable gain amplifier circuits called a variable gain amplifier circuit 111, a variable gain amplifier circuit 112, and a variable gain amplifier circuit 113, whose maximum gains are different form each other. Respective variable gain amplifier circuits are inserted in parallel between the RF input terminal 1 and the RF output terminal 6. A gain of the variable gain amplifier circuit 111 is varied by a gain control voltage and a bias current set in a current control circuit 116 according to the gain control voltage. A gain of the variable gain amplifier circuit 112 is varied by a voltage obtained by shifting the gain control voltage in a voltage shift circuit 114 by a predetermined voltage, and a bias current set by the current control circuit 116 according to the gain control voltage. A gain of the variable gain amplifier circuit 113 is varied by a voltage obtained by further shifting the voltage, which is obtained by shifting the gain control voltage in the voltage shift circuit 114 by the predetermined voltage, in a voltage shift circuit 115 by a predetermined voltage, and a bias current set by the current control circuit 116 according to the gain control voltage. Next, an operation of the variable gain amplifier 117 will be described using FIG. 12. FIG. 12 shows the gain of each signal path within the variable gain amplifier 117 versus the gain control voltage. Symbol G1 indicates the gain of the signal path in which the RF signal inputted into the RF input terminal 1 is amplified by the variable gain amplifier circuit 111, and is subsequently outputted to the RF output terminal 6. Symbol G2 indicates the gain of the signal path in which the RF signal inputted into the RF input terminal 1 is amplified by the variable gain amplifier circuit 112, and is subsequently outputted to the RF output terminal 6. Symbol G3 indicates the gain of the signal path in which the RF signal inputted into the RF input terminal 1 is amplified by the variable gain amplifier circuit 113, and is subsequently outputted to the RF output terminal 6. Symbol G4 indicates the gain of the variable gain amplifier 117. When the gain of the variable gain amplifier 117 becomes the maximum, the current control circuit 116 sets the bias current of the variable gain amplifier circuit 111 to be maximum and the bias currents of the variable gain amplifier circuits 112 and 113 to be minimum so that the gain of the variable gain amplifier circuit 111 may become the maximum, the gain of the variable gain amplifier circuit 112 may become the minimum, and the gain of the variable gain amplifier circuit 113 may become the minimum. When the gain control voltage changes so that the gain of the variable gain amplifier 117 may be reduced, the current control circuit 116 sets the bias current of the variable gain amplifier circuit 111 to be reduced and the bias current of the variable gain amplifier circuit 112 to be increased so that the gain of the variable gain amplifier circuit 111 may be reduced first and the gain of the variable gain amplifier circuit 112 may be increased. Further, when the gain control voltage changes so that the gain of the variable gain amplifier 117 may be reduced, the current control circuit 116 sets the bias current of the variable gain amplifier circuit 111 to be further reduced, the bias current of the variable gain amplifier circuit 112 to be changed to be reduced after increasing to the maximum, and the bias current of the variable gain amplifier circuit 113 to be increased so that the gain of the variable gain amplifier circuit 111 may be further reduced, the gain of the variable gain amplifier circuit 112 may change to be reduced after increasing to the maximum, and the gain of the variable gain amplifier circuit 113 may be increased. Further, when the gain control voltage changes so that the gain of the variable gain amplifier 117 may be reduced, the current control circuit 116 sets the bias current of the variable gain amplifier circuit 111 to be further reduced, the bias current of the variable gain amplifier circuit 112 to be further reduced, and the bias current of the variable gain amplifier circuit 113 to be changed to be reduced after increasing to the maximum so that the gain of the variable gain amplifier circuit 111 may be further reduced, the gain of the variable gain amplifier circuit 112 may be further reduced, and the gain of the variable gain amplifier circuit 113 may be reduced after increasing to the maximum. In the above-mentioned conventional variable gain amplifier 110, however, when a wide gain variable range is intended to be taken, there has been a problem that a circuit scale including the control circuit has been increased when securing an excellent linearity. As described above, respective variable gain amplifier circuits 111 through 113 composing the variable gain amplifier 110 control the gains by controlling the bias currents in many cases, but since the gains of the variable gain amplifier circuits 111 through 113 are reduced, linearities of the variable gain amplifier circuits 111 through 113 deteriorate when reducing the bias currents of the variable gain amplifier circuits. When large attenuation amounts of the first attenuation circuit 103 and the second attenuation circuit 105 are taken in order to take the wide gain variable range of the variable gain amplifier 110, a ratio for the output of the first variable gain amplifier circuit 102 to contribute to the RF output of the variable gain amplifier 110 becomes higher than a ratio for the output of the second variable gain amplifier circuit 104 to contribute to the RF output of the variable gain amplifier 110 or a ratio for the output of the third variable gain amplifier circuit 106 to contribute to the RF output of the variable gain amplifier 110, even in a situation where, for example, the bias current of the first variable gain amplifier circuit 102 is reduced, the gain thereof is decreased, and the linearity is deteriorated, and thus the linearity of the variable gain amplifier 110 will deteriorate. In order to suppress the deterioration of the linearity and to extend the gain variable range of the variable gain amplifier 110, it is necessary to increase the variable gain amplifier circuits in the number of stages, resulting in a large circuit scale. Also in a case of the variable gain amplifier 117, when large maximum gain differences among the variable gain amplifier circuit 111, the variable gain amplifier circuit 112, and the variable gain amplifier circuit 113 are taken in order to take the wide gain variable range of the variable gain amplifier 117, the linearity of the variable gain amplifier 117 will deteriorate. In order to suppress the deterioration of the linearity and to extend the gain variable range of the variable gain amplifier 117, it is necessary to increase the variable gain amplifier circuits in the number of stages, resulting in a large circuit scale

Q: How to deal with a player who says no all the time? I am a fairly new DM. I am playing with a group I have tried to DM and have played with as a PC. There is one person in that group that plays as a PC that says no, AKA he is the opposite of a murder hobo. When faced with a decision or a turning point in the story he will say no to most of the possible outcomes and bring the story to a halt because either the DM is trying to come up with another method to put to the players, the party is arguing about what to do now, or the other players just want to follow his lead and he doesn't want to do anything. He does this to see how frustrated the DM can get before giving up and then complains that we don't play because no one wants to deal with this every single time. I am the DM for the next campaign and I am looking for advice on how to deal with him. The common methods of just killing his character or excluding him aren't acceptable here. I want him and everyone to have fun and be a part of it, but I also don't want to get frustrated with his play style. What can I do to either deal with him as a PC, or can I do anything as a DM to help the story without the mental state of "No I am God you will do what I tell you and that is the story"? A: As ever, there are two approaches: in-game, and out-of-game. Out-of-game: It's a cliché on this stack, but for a reason: talk to this player about what they want. As mentioned above, not biting on plot hooks could be a simple result of not finding those hooks interesting. I recommend trying this first because it is not clear to me that the problem player is necessarily, intentionally forcing the games to stop (a similar-seeming situation could arise from other sources). Explicitly asking this player in advance about what story elements they'd be interested in pursuing might clear the issue up very smoothly. If the player has no stories they're all that interested in pursuing, you can request that they make some decisions anyways-- doing nothing at the table isn't very much fun, and apparently this player complains about no play occurring already, so they might be willing to move the plot forward even if they don't have much personal interest in doing so. If the player is flat-out not willing to stop forcing gameplay to a halt, and you don't want to work around them using an in-game method, then there really aren't a lot of options that don't involve excluding the player altogether. Refusing to play or refusing to allow the game to be played by others is not a playstyle. The situation you describe, as written, suggests that this player is simply toxic to your table, and would be to any table. It's not 100% clear to me that that impression is correct (edits to the question can clarify), but a "player" that refuses to bite at plot hooks, refuses to present any plots that they would pursue, and won't stop forcing the game to a halt is not a person that you can work with to provide a fun game any more than a football team could work with a quarterback who refuses to run or throw the ball. In-game: I've never had a player so resistant as the one described in the question, but when a PC doesn't go for any of your plot hooks a useful strategy is to offer an open choice rather than a list of options: OK, you've got your character built, with backstory and motivations and everything. You're in [location], and you've turned down offers for work from the Adventurer's Guild, the City Council, the Society of Assassins, and a direct appeal for help from the Goddess of Plot Advancement. So your character has some unstructured time ahead of them. What would you like to do? Declining all plot hooks and story prompts can indicate all sorts of things, from a frustrating and intransigent player, to unclear plot hooks, to stories which simply don't interest a given player. Letting players develop their own goals can serve as a sort of reverse story prompt: they tell you what the adventures should be about, and you build content around that. As above, a player who resists all suggested stories and also has nothing they want to do of their own accord isn't demonstrating an unusual "play style", because they aren't quite a player any more-- they're rejecting any interaction with the game. At that point you have a couple of options, and to be clear we're scraping the bottom of the barrel to find them. Trying to force someone to play a game they don't want to play is a bad place to be. These options are, effectively: Railroading. Story events happen to characters, and they are not in a position to accept or reject anything. As an example, being kidnapped and brought to some ritual site where they will be sacrificed means that refusing to play leads directly to PC death Cutting the character out of decisions. If the player's only contribution to in-game, plot-related decision making is to prevent any decisions from being made, but they are still willing to play in other capacities (like participating in a battle), you might consider giving their decisions a weight of zero. This means that the other players at the table are making every plot decision, and this player's character can come along for the ride or not Neither of these options is great, but I cannot emphasize enough that this player has chosen to specifically not play the game, and prevent anyone else from playing it as well. A: You've written that you think your problem player is actually doing this on purpose, "to see how frustrated the DM can get." If that's definitely true and the player is determined to wreck your plot in order to mess with you, the only good solution is to not invite them to your game. But you've also written that your problem player always complains because there's not a game happening, and that makes me think their motivation might be something else. I've had a related problem, which is that sometimes my players reject my plot hooks as being "too risky" — as in the player says something like: The Duke is asking us to rescue this princess from a dragon, but the dragon is too dangerous and the reward won't do us any good if we're dead. Screw this, let's abandon the princess to her fate and head to the next valley and see if there's anything safer we can do. This is a common problem which is actually sort of the DM's fault — it happens when the DM has genuinely failed to provide the group with motivation to go risk their lives on a quest. This problem is so common that I suspect it might be the root cause for what your problem player is doing. The solutions I use for this are: Tell the players their characters are responsible for problems in this area -- as in "you guys are the official adventurers for this town, and in exchange for a salary you've promised to deal with any problems that crop up." Tell the players to build characters that want to do the mission -- as in, "the Duke has put out a request for adventurers, and your adventurer is one of the ones that responded to the request." Make the problem personal for the characters -- as in, "the dragon has captured the princess, and also it kills anyone who tries to leave the valley, and also it eats someone from the village every day, so really there's no way to run from it or ignore it, you have to fight it or it'll eat you." All of these solutions have worked well for me. A: You mention that: When faced with a decision or a turning point in the story he will say no to most of the possible outcomes and brings the story to a halt [...] Also: He does this to see how frustrated the DM can get before giving up and then complains that we don't play because no one wants to deal with this every single time. These sentences show clearly that his actions have a direct negative effect on the rest of the team. However, roleplaying games are team games. Their purpose is for everyone in the group to have fun. How to deal with the player: 1. Discuss this with the rest of the group before talking to him Ask them whether they feel the same. Sometimes, something that bothers us does not necessarily reflect the group's feelings. If your group feels the same: (Several comments suggested that this part may be considered as talking behind one's back, so either dismiss it or proceed very carefully) 2. Consider that he may not be aware of it Sometimes, we do not realize that our behavior is problematic. Maybe, in his mind, he's trying his best to give the group the most efficient solution. Maybe he thinks that this is fun! 3. Talk to him in person and out of game Be friendly and honest. Describe his behavior and let him know that when this happens it affects the group in a negative way (remember to discuss with it your group first). Depending on his reaction it's up to you how to proceed. If he insists on his behavior ask him why he does it. Try to find out whether it is simply an ego thing, i.e., he wants his way to be the way things happen, or whether he has good intentions. After understanding his reasons talk again with your group and collectively decide how to deal with this. If you don't want to confront the player or the team does not share your feelings: Offer alternatives The simplest way of dealing with this is calling for a majority vote. If the group stumbles upon a disagreement, ask the players to suggest one solution and then call a vote. The idea with most votes becomes the way to go. However, be sure to ask for the group's permission before the session starts. How to avoid this in the future These matters are usually resolved during Session 0. Session 0 is an out-of-game session where you discuss with your players what is expected from each one, what is allowed and not allowed, and overall how to make sure that everyone is having fun. You can make it so you discuss during Session 0 how to handle disagreements. (1) (2)

SA Leads The African Region In Start-Up Funding Calling all tech entrepreneurs the good news and the bad news – when it comes to business you are still pretty much on your own in difficult economic times. The good news is there are a few more people to help you. When President Barack Obama visited the Nairobi Tech hub in 2015 there were 200 companies helping the start-up businesses there. Now there is double that number according to a report by an outfit called Village Capital. Brenda Wangari and Simunza Muyangana, Co-Founder of BongoHive join CNBC Africa for more.

Contact Person Name : AL BATINAH MARBLE User Type : Seller Country : Oman Company Address : Sohar , Sohar , 111 Description AL Batinah Marble & Granite ( Al Batinah marble & Granite ) is one of creative and highly growing company in Oman , which depend on Quality and customer Care . ( AL Batinah Marble ) has good relation and very good connect with many Quarries , factories , traders , All over the World and its believe that success is a cooperation , between all participants . since the day of establishment and the company is growing rapidly in very strong steps . The Name of the company the name ( Al Batinah ) is an area in Oman in the north of Muscat the capital of Oman

AGES 18+ ONLY WITH VALID ID NO REFUNDS | ALL SALES FINAL ANY & ALL FREE/RSVP/GUESTLIST/CONTEST WINNERS Tickets cut off at midnight. If you are in line when the clock turns midnight, you will have to purchase a ticket from the box office. Doors open at 10pm and Lines can be long, so we recommend showing up as soon as possible to ensure entry. Limit 2 per person, & or email. Tickets: After completing your purchase on Eventbrite, you will receive an email confirmation with your attached PDF ticket(s). You MUST print and bring your PDF tickets AND VALID PHOTO IDENTIFICATION to be admitted for the event. You may download the Eventbrite app and show your ticket on your mobile device for entry in lieu of printing. NightCulture Ticketing Policy: Tickets can be transferred between patrons at their own risk. If a transferred ticket does not scan, proof of purchase will be required to redeem the ticket. Acceptable Proof forms: Legal, Valid Government ID. NightCulture cannot be held responsible for any issues that arise with a transferred ticket. Ticketing Related Issues can be directed to: [email protected] TICKET REMINDER: To ensure your satisfaction, NightCulture cannot guarantee tickets purchased from un-authorized 3rd party resellers (individuals or brokers). We recommend that you purchase tickets directly through Nightculture.com, eventbrite.com, our authorized partners, and the venue box offices. Questions: [email protected] For more information visit nightculture.com

Common Topics Recent Articles The ongoing war of packet floods and Web defacements between pro-Israeli and pro-Palestinian hacktivists saw a new and famous name enter the fray last week: Ehud Tenebaum, the Israeli hacker known as "The Analyzer," who was fingered by the US government in 1998 as the mastermind of one of the biggest Pentagon hack-attacks in history. The twenty-one year old Tenebaum is serving as CTO of the security firm 2XS. Two weeks ago, according to Tenebaum, he heard from a hacker group he founded in 1996, called the Israeli Internet Underground (IIU). The group asked Tenebaum if his company would provide security solutions for Israeli companies for free. "They claimed they are going to help all the Israeli sites that are under attack, or sites that there is a good reason to believe will be attacked," says Tenebaum. "I liked the idea in general." The result was a partnership between 2XS, Tenebaum's company, and the IIU, now self-described white hat hackers aiming at a defensive role in the mid-East cyberwar. The IIU established a Web site listing the names of companies and organizations in Israel that the group determined were vulnerable to intrusions. Organizations that found themselves on that list could contact 2XS, which provided them with patches, workarounds or advice on how to close the holes. "We agreed to provide a solution to anyone who wants a solution," says Tenebaum. The project ended on Saturday, and Tenebaum pronounces it a success. "I can tell you we had hundreds of companies contacting 2XS." Seven weeks of violence between Israelis and Palestinians has claimed at least 256 lives, according to CNN, which counts the dead as 218 Palestinians, 25 Israeli Jews and 13 Israeli Arabs. Groups supporting both sides of the conflict have brought it on line with denial of service attacks, Web defacements and computer intrusions against their opponents' networks. "It's wrong to take these kinds of things to the Internet, because it involves a lot of companies that did nothing," says Tenebaum. Israeli police searched Tenebaum's home, and detained Tenebaum, in March, 1998, while investigating what then-US Deputy Defence Secretary John Hamre called "the most organized and systematic attack to date" on US military systems. The attacks exploited a well-known vulnerability in the Solaris operating system, for which at that time a patch had been available for months. The raid was the culmination of an investigation code named "Solar Sunrise," involving the FBI, the Air Force Office of Special Investigations, NASA, the Department of Justice, the Defence Information Systems Agency, the NSA, and the CIA. Two California teens were also charged in the case; both later received probation. "This arrest should send a message to would-be computer hackers all over the world that the United States will treat computer intrusions as serious crimes," US Attorney General Janet Reno said at the time. "We will work around the world and in the depths of cyberspace to investigate and prosecute those who attack computer networks." After a brief stint in the military, Tenebaum was indicted under Israeli computer crime laws in February 1999, and pleaded not guilty in September of that year. The case has languished in the courts since then. "I would prefer to have it finished soon," says Tenebaum. "This trial is keeping me from doing a lot of stuff that I need to do in the business world."

This invention relates to an apparatus and method for forming composites, and particularly to forming layers of certain types of carbide coatings. Layers of carbide materials such as titanium carbide (TiC), boron carbide (B.sub.4 C) and silicon carbide (SiC) are often coated on surfaces for various commercial and scientific applications. Such surface coatings can be used in the tool making industry to produce super hard coatings on alloy tools. Such composites find particular utility in producing cutting tools and in providing wear resistant coatings for parts. Various approaches toward forming such coatings are presently known. However, the prior art approaches have limitations in terms of the surface quality of the coating which can be developed, and in the deposition rate of forming the coatings. One previously known approach of providing a titanium carbide coating is through plasma spraying. In plasma spraying, titanium carbide powder is introduced into a plasma jet where it is intensely heated to melting and sprayed to form a coating on the part surface. The thickness of coatings produced by plasma spraying is from tens of microns up to several millimeters. However, the materials produced by this method tend to have a high porosity; more than 10%. For this reason it is recommended to use dispersed powders to reduce the coating porosity, but it is difficult to introduce such agents into the plasma jet. Also know is a process of developing a titanium carbide layer through detonation coating. This process, however tends to produce low quality coatings. Another known process is the use of a direct electron beam evaporation of titanium carbide. Billets for evaporation are produced by a powder metallurgy process. The billets are evaporated from a water-cooled crucible. The maximum titanium carbide deposition rate which can be achieved by this method, however, is on the order of 0.3 .mu.m/min, and thus this process is not promising for industrial applications where relatively thick coatings are often required. Activated reactive evaporation is another known technique for producing a titanium carbide coating. Evaporation is caused by an electron beam. At the same time, a reaction gas such as methane is fed into a chamber at a low pressure. Titanium carbide is formed both in the gas phase, and on the substrate as a result of the reaction between the metal vapor and gas atoms: EQU 2Ti+C.sub.2 H.sub.2 .fwdarw.2TiC+H.sub.2 A charged grid is placed in the working space of the chamber to activate the chemical compound formation. By changing the reagent partial pressure it is possible to change the carbon-titanium ratio. The rate of titanium carbide coating deposition generally does not exceed 2.5 .mu.m/min using this method. Still another method for developing carbide coatings is based on electron beam evaporation of the initial component, e.g. titanium and carbon from separate sources and performing carbide synthesis on the substrate. The ratio of components in the coating can be controlled by changing the ratio of heating power of the materials evaporated from the sources. Low rates of initial component evaporation are the restrictive factor in the utilization of this electron beam process for titanium carbide-based coating deposition. Problems with this method are encountered when attempts are made to raise the deposition rate. Raising the power of heating of the carbon source above a critical value results in a marked increase in the number of graphite fragments in the vapor phase, and, as a result, in the appearance of defects, discontinuities and availability of free carbon in the condensate; resulting in lower quality of the resulting coating. Similarly, when attempts are made to increase the titanium evaporation rate by raising the heating power, intense spattering of the molten metal occurs which again degrades the ultimate surface quality. Advances have been made in terms of enabling the evaporation rate of carbon heated by an electron beam to be increased without encountering solid carbon particles in the vapor. A molten intermediate pool of tungsten can be employed overlying the carbon source which prevents the direct heating of the graphite surface by the electron beam and provides the dissolution of the graphite particles through the formation of a tungsten carbide melt. Since the vapor pressure of carbon is higher than that of tungsten at a given temperature, it is primarily the carbon that evaporates from the melt. This advance, however, does not translate into a higher rate of titanium carbide deposition since the limiting factor remains the rate of titanium evaporation. Consequently, without raising the titanium evaporation rate the coatings produced by this method providing excess carbon results in a coating of titanium carbine and elemental carbon.

package org.json4s package reflect import java.lang.reflect.{AccessibleObject, Type, Constructor, Method} import org.json4s.MappingException /** * This class is intended as a workaround until we are able to use Java 8's java.lang.reflect.Executable class. */ class Executable private (val method: Method, val constructor: Constructor[_], isPrimaryCtor: Boolean) { def this(method: Method) = { this(method, null, false) } def this(constructor: Constructor[_], isPrimaryCtor: Boolean) = { this(null, constructor, isPrimaryCtor) } def defaultValuePattern: Option[String] = if (isPrimaryCtor) Some(ConstructorDefaultValuePattern) else None def getModifiers(): Int = { if (method != null) { method.getModifiers } else constructor.getModifiers } def getGenericParameterTypes(): scala.Array[Type] = { if (method != null) { method.getGenericParameterTypes } else constructor.getGenericParameterTypes } def getParameterTypes(): scala.Array[Class[_]] = { if (method != null) { method.getParameterTypes } else constructor.getParameterTypes } def getDeclaringClass(): Class[_] = { if (method != null) { method.getDeclaringClass } else constructor.getDeclaringClass } def invoke(companion: Option[SingletonDescriptor], args: Seq[Any]) = { if (method != null) { companion match { case Some(cmp) => method.invoke(cmp.instance, args.map(_.asInstanceOf[AnyRef]).toArray: _*) case None => throw new MappingException("Trying to call apply method, but the companion object was not found.") } } else { constructor.newInstance(args.map(_.asInstanceOf[AnyRef]).toArray: _*) } } def getAsAccessibleObject: AccessibleObject = { if (method != null) method else constructor } def getMarkedAsPrimary(): Boolean = { val markedByAnnotation = if (method == null) { constructor.isAnnotationPresent(classOf[PrimaryConstructor]) } else { false } markedByAnnotation || isPrimaryCtor } override def toString = if (method != null) s"Executable(Method($method))" else s"Executable(Constructor($constructor))" }

Hull FC hang on in nail-biting contest against Catalans In what has been the closest and most entertaining Super League contest to date in 2014, Hull FC have hung on in a ripper of a contest against Catalan Dragons, holding off late surge by the French club to win 36-34. There was one simple conversion in it in the end and after fighting back from being 16-12 down at half-time, Hull FC coach Lee Radford was thrilled to get the win and hold on. “They have tried ending my career before it started,” Radford joked. “I’m really pleased with the result but there are obviously some issues to fix up defensively.” One influential player was Australian recruit Jordan Rankin who was involved in two tries and scored one himself, but for Radford, he knows there is work to do for his side. “We didn’t have any football in the first half and I was confident if the penalty count levelled itself up and we got our share of possession, we would cause them problems and we did for the first 20 in the second half,” Radford said. “For whatever reason, we capitulated in that last 20. It gives us something to work on on Monday, that’s for sure. “Any week we’ll take the two points but we want to get some consistency in how we defend. “I thought all the new boys did a real good job. Jordan is a running threat. He likes the football in his hand.” What concerned Catalans coach Laurent Frayssinous, was the way his side capitulated to let Hull FC create mass opportunities to score. “It would have been nice to come back with one point but there are a lot of things to talk about on Monday morning,” Frayssinous said. “I am focused more on the performance than the scoreboard. That’s why I’m disappointed and frustrated. In the second half we went away from the game plan and defensively we made some soft and poor decisions.” To make matters more complicated for the Dragons, forward Olivier Elima will come under scrutiny for a high-tackle and was thus placed on report. Regarding the incident, the coaches said the following: “My eyesight is the worst on the planet but, if he has gone in to roll his ankle, that’s a cowardly act and our boys have every entitlement to run in as they did. The game is tough enough. We don’t need incidents like that,” said Radford.

Millions of Americans registered a protest vote on Tuesday, expressing their fierce opposition to an economic and political system that puts wealthy and corporate interests over their own. I strongly supported Hillary Clinton, campaigned hard on her behalf, and believed she was the right choice on Election Day. But Donald J. Trump won the White House because his campaign rhetoric successfully tapped into a very real and justified anger, an anger that many traditional Democrats feel. I am saddened, but not surprised, by the outcome. It is no shock to me that millions of people who voted for Mr. Trump did so because they are sick and tired of the economic, political and media status quo. Working families watch as politicians get campaign financial support from billionaires and corporate interests — and then ignore the needs of ordinary Americans. Over the last 30 years, too many Americans were sold out by their corporate bosses. They work longer hours for lower wages as they see decent paying jobs go to China, Mexico or some other low-wage country. They are tired of having chief executives make 300 times what they do, while 52 percent of all new income goes to the top 1 percent. Many of their once beautiful rural towns have depopulated, their downtown stores are shuttered, and their kids are leaving home because there are no jobs — all while corporations suck the wealth out of their communities and stuff them into offshore accounts. Working Americans can’t afford decent, quality child care for their children. They can’t send their kids to college, and they have nothing in the bank as they head into retirement. In many parts of the country they can’t find affordable housing, and they find the cost of health insurance much too high. Too many families exist in despair as drugs, alcohol and suicide cut life short for a growing number of people. President-elect Trump is right: The American people want change. But what kind of change will he be offering them? Will he have the courage to stand up to the most powerful people in this country who are responsible for the economic pain that so many working families feel, or will he turn the anger of the majority against minorities, immigrants, the poor and the helpless? Will he have the courage to stand up to Wall Street, work to break up the “too big to fail” financial institutions and demand that big banks invest in small businesses and create jobs in rural America and inner cities? Or, will he appoint another Wall Street banker to run the Treasury Department and continue business as usual? Will he, as he promised during the campaign, really take on the pharmaceutical industry and lower the price of prescription drugs? SCROLL TO CONTINUE WITH CONTENT Never Miss a Beat. Get our best delivered to your inbox. I am deeply distressed to hear stories of Americans being intimidated and harassed in the wake of Mr. Trump’s victory, and I hear the cries of families who are living in fear of being torn apart. We have come too far as a country in combating discrimination. We are not going back. Rest assured, there is no compromise on racism, bigotry, xenophobia and sexism. We will fight it in all its forms, whenever and wherever it re-emerges. I will keep an open mind to see what ideas Mr. Trump offers and when and how we can work together. Having lost the nationwide popular vote, however, he would do well to heed the views of progressives. If the president-elect is serious about pursuing policies that improve the lives of working families, I’m going to present some very real opportunities for him to earn my support. Let’s rebuild our crumbling infrastructure and create millions of well-paying jobs. Let’s raise the minimum wage to a living wage, help students afford to go to college, provide paid family and medical leave and expand Social Security. Let’s reform an economic system that enables billionaires like Mr. Trump not to pay a nickel in federal income taxes. And most important, let’s end the ability of wealthy campaign contributors to buy elections. In the coming days, I will also provide a series of reforms to reinvigorate the Democratic Party. I believe strongly that the party must break loose from its corporate establishment ties and, once again, become a grass-roots party of working people, the elderly and the poor. We must open the doors of the party to welcome in the idealism and energy of young people and all Americans who are fighting for economic, social, racial and environmental justice. We must have the courage to take on the greed and power of Wall Street, the drug companies, the insurance companies and the fossil fuel industry. When my presidential campaign came to an end, I pledged to my supporters that the political revolution would continue. And now, more than ever, that must happen. We are the wealthiest nation in the history of the world. When we stand together and don’t let demagogues divide us up by race, gender or national origin, there is nothing we cannot accomplish. We must go forward, not backward.

Network Virtualization: 6 Best Practices for Overcoming Common Challenges Many organizations that have realized the benefits of server virtualization are ready to move to network virtualization. By combining hardware and software resources and functionality into a single, software-based administrative entity, these organizations can reap the benefits of greater data center agility. But network virtualization presents new challenges. The network is not a fixed platform like a server; it is a dynamic, fluid, multivendor environment that wasn’t built with network virtualization in mind. To complicate matters, very few data centers will be 100 percent virtualized; many workloads will run only in physical environments. Thankfully, these challenges are not insurmountable. With a bit of planning—and the following best practices—organizations can overcome these challenges with a simple, open and smart approach. Credit Union Times Credit Union Times is the nation's leading independent source for breaking news and analysis for credit union leaders. For more than 20 years, Credit Union Times has set the standard for editorial excellence and ethical, straight-forward reporting.

News University of Sydney replicates Mars Rover for Powerhouse Museum 2 April 2011 An operational model of NASA's Mars Exploration Rovers built at the University of Sydney will give high school students firsthand experience of robots that have provided invaluable data on the red planet. Click here to read the full story

1. Introduction =============== Chronic pulmonary aspergillosis (CPA) refers to a group of infectious consuming diseases that typically cause prolonged and relapsing cough, dyspnea, and hemoptysis. CPA most often affects patients with underlying pulmonary conditions and common immunosuppressive conditions. CPA is further divided into several subtypes, including chronic cavitary pulmonary aspergillosis (CCPA), chronic fibrosing pulmonary aspergillosis (CFPA), aspergillus nodule, single aspergilloma, and subacute invasive pulmonary aspergillosis (usually occurs in moderately immunocompromised patients with more progressive features within 3 months). CPA has recently been recognized as a significant global health burden.^\[[@R1]\]^ It is associated with significant morbidity and mortality, but the optimal diagnosis and treatment strategy has yet to be determined. The prevalence of CPA varies widely, with a higher prevalence in developing countries compared with developed countries. A previous study by Denning et al^\[1\]^ reported that 21% (US) to 35% (Taiwan, China) of post tuberculosis patients developed pulmonary cavities and about 22% of these patients developed CPA. The diagnosis of CPA is still unfamiliar to most doctors in China. Indeed, the China National Knowledge Infrastructure does not contain any clinical studies performed to investigate either the clinical manifestations of CPA or appropriate standards of diagnosis for CPA. Therefore, we sought to gain a better understanding of the diagnosis and clinical features of CPA in China. 2. Methods ========== We retrospectively reviewed the medical records of the 690 hospitalized patients who were diagnosed with "pulmonary aspergillosis" from January 2000 to December 2016 at Peking Union Medical College Hospital, a major referral center in China. Because of the retrospective nature of the study, informed consent was waived. The study was approved by the Ethical Committee of Peking Union Medical College Hospital (protocol number: S-K247). Of these 690 patients, 96.0% were Han Chinese, 1.0% were Hui, 0.5% were Mongolian, and the remaining patients were either Tujia or Korean. The patients' clinical characteristics were retrieved, and the data were reviewed and identified by a multidisciplinary team, including one senior pulmonologist, one infectious disease physician, one radiologist, and one pathologist. Of the 690 patients reviewed, 69 patients were determined to meet all of the 5 diagnostic requirements for CPA (the case do not meet any one out of the 5 diagnosis requirements would be removed). These requirements were as follows:1.At least a 3-month duration of pulmonary or systemic symptoms, with at least a 1-month duration of subacute invasive aspergillosis. A duration of less than 3 months was acceptable for simple aspergilloma patients who received their diagnosis prior to surgery at the beginning of their clinical course.2.Radiological evidence of chronic pulmonary lesion with surrounding inflammation, with or without an intracavitary mass.3.Direct evidence of *Aspergillus* from sputum or lung tissue biopsy.4.Exclusion of other pulmonary pathogens that might explain the present clinical course, such as tuberculosis mycobacteria.5.Exclusion of major discernible immunodeficiency, such as AIDS, leukemia, or organ transplant. Modest immunocompromising factors, such as diabetes mellitus, chronic liver disease, history of malignancy, or prolonged corticosteroid administration^\[[@R2]\]^ were considered acceptable. After extensive review of the clinical and radiological data, all diagnosed 69 cases were classified into 5 categories:1.Chronic cavitary pulmonary aspergillosis (CCPA), 10 patients: Patient is immunocompetent or mildly immunocompromised, with formation and expansion of one or more pulmonary cavities over at least 3 months of observation.2.Chronic fibrosing pulmonary aspergillosis (CFPA), 0 patients: Patient shows severe fibrotic destruction of at least 2 lobes of the lung leading to major loss of lung function3.Semi-invasive aspergillosis (SAIA), 15 patients: Patient is immunocompromised to some degree and presents with progressive features over 1--3 months as well as variable radiological features, including cavitation, nodules, or progressive consolidation with abscess formation.4.Simple aspergilloma, 41 patients: Patient is immunocompetent and shows single pulmonary cavity containing a fungal ball with microbiological evidence implicating *Aspergillus spp.* and with no radiological progression over at least 3 months of observation: Duration before diagnosis may be less than 3 months if the patient warrants diagnosis with simple aspergilloma before surgery at the very beginning of the clinical course.5.*Aspergillus* nodule, 3 patients: Patient is immunocompetent and presents with one or more nodules which may or may not cavitate. Clinical characteristics were retrieved from the patients' medical records. The following data were collected for further analysis: age, sex, underlying diseases, symptoms, chest computerized tomography (CT) images, white blood cell (WBC) and eosinophils (EOS) counts from a blood routine examination, high-sensitivity C-reactive protein (hsCRP), erythrocyte sedimentation rate (ESR), and serum 1,3 b-D glucan testing. 2.1. Statistical analysis ------------------------- The main statistical objective of this investigation was to compare CCPA, SAIA, and simple aspergilloma patients with respect to their demographic, laboratory, and radiological characteristics. We also compared CCPA and SAIA to determine any group difference. The sample size is of study is small especially as it is further divided into subgroups. So we choosed Fisher exact test and Kurskal−Wallis test for this study. The Kruskal−Wallis test was applied to investigate the differences in age, course before diagnosis, and laboratory test results, including levels of WBC, EOS, ESR, hsCRP, and serum 1,3 b-D glucan. Fisher exact test was applied to investigate differences in sex, symptoms, and imaging features. A 2-sided *P* \< 0.05 was considered to indicate statistical significance. Continuous variables are presented as a mean ± standard deviation, and categorical variables are presented as numbers and percentages. All analyses were performed using R Studio Version 3.3.2. 3. Results ========== A total of 69 patients were finally diagnosed with CPA from the 690 pulmonary aspergillosis patients. These included 10 patients with CCPA, 15 with SAIA, 41 with simple aspergilloma, and 3 with Aspergillus nodule. No patients were diagnosed with chronic fibrosing pulmonary aspergillosis. 3.1. General characteristics ---------------------------- Of the 69 CPA patients, 28 (41%) were male. The ages ranged from 19 to 74 years, with a median age of 53 (40, 59 y) years. The course of the disease was variable, and the longest duration before diagnosis was 8 years. 3.2. Predisposing conditions ---------------------------- Of the 69 patients determined to have CPA, 8 (11.5%) patients were obviously immunocompromised, including 1 patient with allergic bronchopulmonary aspergillosis, 1 patient with systemic vasculitis, 1 patient with nephrotic syndrome, 3 patients with different types of interstitial lung disease, 1 patient with systemic lupus erythematosus who was being treated with immunosuppressive therapy, and 1 patient with esophageal cancer who was receiving chemotherapy. We considered patients who had no major discernible immunodeficiency but showed a certain degree of immunocompromise because of immunosuppressive therapy to be obviously immunocompromised. All of these 8 patients were considered to have SAIA. Thirteen patients (18.8%) showed mild immunodeficiency. These cases stemmed from ankylosing spondylitis, idiopathic thrombocytopenic purpura, nephrotic syndrome with a history of immunosuppressive therapy, diabetes, chronic hepatitis B, and history of esophageal cancer or breast cancer. We considered patients who had relevant systematic diseases or a history of obvious immunocompromise that may affect immune status to be mildly immunocompromised. Of these 13 patients, 6 were determined to have CCPA, 4 to have SAIA, and 3 were determined to have simple aspergilloma. Finally, 48 patients (69.6%) were found to have normal immunity, and these included 4 patients with CCPA, 3 with SAIA, 3 with aspergillosis nodule, and 38 with simple aspergilloma. In addition, 43 patients (62.3%) presented with a history of lung abnormality, including bronchiectasis from a known or unknown cause, COPD, asthma, allergic bronchopulmonary aspergillosis, and congenital lung and heart disease (Table [1](#T1){ref-type="table"}). ###### Predisposing factors in all chronic pulmonary Aspergillosis patients.  3.3. Symptoms ------------- The most common symptoms in the CPA patients were cough (92.8%), hemoptysis (63.8%), sputum production (23.2%), fever (17.4%), breathlessness (7.2%), chest pain (5.8%), and constitutional symptoms (5.8%). Four patients (5.8%) were asymptomatic. The symptoms varied by CPA type (Table [2](#T2){ref-type="table"}). ###### Symptoms by type of chronic pulmonary Aspergillosis.  3.4. Laboratory examinations ---------------------------- All of the 69 CPA cases had direct evidence of *Aspergillus* infection. The pathogen was identified from sputum (33.3%), lung resection surgery (62.3%), percutaneous lung biopsy (1.4%), or bronchoscopy biopsy (2.9%). Blood routine examination results revealed that the mean WBC in our patient group was 8.1 ± 4.4 × 10^9^/L (normal range, 3.5--9.5 × 10^9^ /L), the mean EOS level was 0.2 ± 0.2 × 10^9^/L (normal range, 0.02--0.5 × 10^9^/L), the mean hsCRP level was 38.5 ± 57.9 mg/L (normal range, 0--3.0 mg/L), the mean ESR was 30.9 ± 29.9 mm/h (normal range, 0--15 mm/h), and the mean 1,3 b-D glucan testing result was 281.2 ± 598.2 pg/mL (normal range, 0--50 pg/mL). These examination results varied by CPA type (Table [3](#T3){ref-type="table"}). ###### Laboratory features by chronic pulmonary Aspergillosis type.  3.5. Radiological examinations ------------------------------ All patients underwent chest CT imaging. The most common CT abnormalities were cavity (94.2%), nodules (84.1%), consolidation (4.3%), pleural thickening (2.9%), and infiltration (2.9%). Most of these (81.2%) were solitary lesions. Table [4](#T4){ref-type="table"} presents the radiological characteristics listed by CPA type. ###### Radiological characteristics by chronic pulmonary Aspergillosis type.  3.6. Comparison of clinical features by CPA types ------------------------------------------------- The comparisons of clinical and radiological data in CCPA, SAIA, and simple aspergilloma are summarized in Table [5](#T5){ref-type="table"}. CCPA, SAIA, and simple aspergilloma patients significantly differed with respect to many clinical characteristics, including course before diagnosis (*P* = .0022), constitutional symptoms (*P* = .011), fever (*P* = .0005), hemoptysis (*P* = .0077), breathlessness (*P* = .0046), WBC count (*P* = .0001), ESR (*P* = .0002), and hsCRP count (*P* = .0138). Only 1 patient, in the simple aspergilloma group, was asymptomatic. With regards to the radiological results, presence of a nodule and presence of a solitary lesion were found to differ significantly among these three groups (both *P* \< .0001). No significant differences were found for any other characteristics. ###### Comparison of clinical features in types of chronic cavitary pulmonary aspergillosis, semi-invasive aspergillosis, and simple aspergilloma.  The comparisons of clinical and radiological data between CCPA and SAIA are summarized in Table [6](#T6){ref-type="table"}. SAIA patients had a significantly shorter course before diagnosis compared with CCPA patients (7.4 ± 12.0 months vs 20.8 ± 19.8 months; *P* = .0034) and a significantly higher WBC count (12.9 ± 5.8 × 10^9^/L versus 6.8 ± 3.9 × 10^9^/L; *P* = .0025). No significant differences were found in any other clinical or radiological characteristics, and there was no significant difference in age (*P* = .5977) or sex (*P* = .2262) between the 2 patient groups. ###### Comparison of clinical and radiological features between patients with chronic cavitary pulmonary aspergillosis and those with semi-invasive aspergillosis.  4. Discussion ============= Chronic pulmonary aspergillosis (CPA) is an uncommon and problematic pulmonary disease. In 2016, Denning and others published clinical guidelines for global diagnosis and management of CPA.^\[[@R2]\]^ However, the definition of CPA still contains some degree of uncertainty, especially with regard to the division of phenotypes. A chronic and characteristic feature of thoracic imaging, direct or indirect evidence of *Aspergillus* infection and exclusion of alternative diagnoses is essential for the diagnosis of CPA. By convention, a diagnosis of CPA usually also requires that the disease has been present for at least 3 months, and patients are usually not severely immunocompromised by HIV-infection, cancer chemotherapy, or immunosuppressive therapy. In contrast, SAIA can be diagnosed after just a 1-month period, and this diagnosis can occur with or without an underlying immunocompromising disease. We report that the most common form of CPA in China is simple aspergilloma. The clinical presentation of *Aspergillus* lung disease is determined by the interaction between fungus and host. Invasive aspergillosis develops in severely immunocompromised patients. Except in cases of SAIA, CPA occurs in patients who are not obviously immunocompromised.^\[[@R3]\]^ Although CPA patients may have been treated with some level of immunosuppressant therapy,^\[[@R2]\]^ CPA is more likely to develop after progression of previous anatomical alterations, such as in cases of inactive tuberculosis with residual cavities.^\[[@R1]\]^ By far, the most common local predisposing factor for CPA is previously treated tuberculosis, sarcoidosis, asthma, or COPD.^\[[@R1],[@R4]--[@R6]\]^ In our study, the predispositions for CPA varied. Fifty-three percent of SAIA patients were observed to be obviously immunocompromised. Further, 60% of CCPA patients, 26.7% of SAIA patients, and 7.3% of simple aspergilloma patients were observed to be mildly immunocompromised by underlying conditions, including ankylosing spondylitis, idiopathic thrombocytopenic purpura, nephrotic syndrome with a history of immunosuppressive therapy, diabetes, chronic hepatitis B, and a history of esophageal cancer or breast cancer. Previous underlying lung abnormalities were observed in 20% of CCPA patients, 53.3% of SAIA patients, and 80.5% of simple aspergilloma patients. These abnormalities included bronchiectasis, COPD, asthma, allergic bronchopulmonary aspergillosis, and especially congenital lung and heart diseases. These congenital diseases included pulmonary sequestration and Tetralogy of Fallot, both of which have seldom been mentioned in previous studies. The nature of the underlying lung diseases that we observed suggests that both systemic immunodeficiency and mechanical impediments of the lung contribute to increasing the susceptibility to CPA.^\[[@R7]\]^ Patients with CPA usually suffer from chronic productive cough, hemoptysis, breathlessness, and chest pain. In addition, these patients occasionally experience constitutional symptoms such as weight loss, malaise, sweats, or anorexia. Hemoptysis occurs in all types of CPA and can occasionally develop into life-threatening massive hemoptysis.^\[[@R8],[@R9]\]^ However, the specific symptoms of the different subtypes of CPA remain unclear. Our results suggest that the most common symptoms of CPA are cough (92.8%), hemoptysis (63.8%), chronic sputum (23.2%), and fever (17.4%). Hemoptysis appears most often in simple aspergilloma patients, even though these patients experience a relatively quiet clinical course. Hence, hemoptysis does not necessarily indicate CPA exacerbation. In the present study, fever and constitutional symptoms were observed to be more common in SAIA and CCPA patients. This suggests that there was a larger systemic inflammatory response in these CPA patients. The clinical manifestations of *Aspergillus* infections largely depend on the immune status of the host.^\[[@R3]\]^ The CPA patients in the current study were in the middle or lower intervals of the immune status spectrum. Hence, the peripheral eosinophil count of our CPA patients remained normal. The WBC levels obtained from the blood routine examinations were significantly higher in SAIA patients compared with CCPA and simple aspergilloma patients. WBCs are essential in the initiation and execution of the acute inflammatory response and the subsequent resolution of fungal infection by mechanisms such as respiratory bursts.^\[[@R10]\]^ Therefore, although WBC levels have little diagnostic value in CPA, they may help to distinguish between SAIA and other noninvasive CPA subtypes. Antibody testing is important to the diagnosis of CPA, and *Aspergillus*-specific IgG is always raised in this disease. Antibody levels are also used to monitor treatment response in CPA.^\[[@R11]\]^ The diagnostic value of galactomannan in bronchoalveolar lavage fluid has been demonstrated to be high for invasive pulmonary aspergillosis in nonhematological patients, especially in patients with immunosuppressive conditions.^\[[@R12]\]^ Unfortunately, testing for *Aspergillus*-specific Ig G is not yet practiced in our hospital. Serum 1,3 b-D glucan testing is unreliable, and it was reported that 1,3, b-D glucan positivity was only observed in 15.4% in CPA patients.^\[[@R13]\]^ Comparison of 1,3 b-D glucan test results showed no significant differences between the CPA subgroups. With an increasing number of diagnosed CPA cases, galactomannan, and *Aspergillus*-specific IgG testing should become a more common practice in the clinic. Radiographic features of CT scan secondary to *Aspergillus* infection range from a typical appearance of a fungus ball within the lung cavity to complex pleuroparenchymal features related to progressive destructive cavitary disease. CCPA generally presents first as indistinct regions that progress to form more distinct cavities.^\[[@R14],[@R15]\]^ Single and multiple nodules can also be present in CPA. Such nodules have been noted to be moderately or strongly positive on positron emission tomography scanning and can mimic carcinoma of the lung.^\[[@R16]\]^ SAIA and CCPA are difficult to radiographically distinguish from each other because they both show features of chronic pulmonary infiltrates, progressive cavitation, and subsequent aspergilloma formation. It has been suggested that pre-existing cavities showing pericavitary infiltrates with or without aspergilloma indicate CCPA.^\[[@R17]\]^ In the current study, the imaging characteristics of simple aspergillosis and *Aspergillus* nodules were quite discriminable, whereas CCPA and SAIA were quite similar in manifestation of nodules and cavity and consolidation features. The different forms of *Aspergillus* infection are associated with significantly different morbidity and mortality rates.^\[[@R18]\]^ If the lung function permits, surgical removal of the lesion is the best choice for patients with simple aspergilloma.^\[[@R19]\]^ However, benefit from the operation in CCPA patients is much less.^\[[@R20]\]^ Clinical distinctions between SAIA and CCPA are necessary because the treatment and prognosis goals for these 2 conditions are different.^\[[@R2],[@R15]\]^ Many authors have sought to distinguish the 2 entities by cavity features, host immune status, and the degree of suspected tissue invasion.^\[[@R21]\]^ SAIA usually occurs in immunocompromised or very debilitated patients and is more rapid in progression than CCPA despite showing similar clinical and radiological features.^\[[@R22]\]^ In addition, SAIA patients are more likely to have detectable *Aspergillus* antigen in the blood and to show hyphae invading the lung parenchyma.^\[[@R23]\]^ The comparison of subgroups in our study revealed that course before diagnosis and WBC count significantly differed between SAIA and CCPA, and these results may aid in distinguishing these 2 conditions. 5. Conclusions ============== In China, the nature of the underlying systemic immunocompromise and mechanical impediments from lung disease contribute to increased susceptibility to different types of CPA. Hemoptysis is a predominant symptom in CPA patients, but direct evidence of *Aspergillus* is important in the diagnosis of CPA. Simple aspergillosis was the dominant diagnosis for all CPA patients. The imaging characteristics of simple aspergillosis and *Aspergillus* nodules were quite discriminable, whereas CCPA and SAIA were quite similar. CCPA and SAIA were also quite similar in their clinical features. Distinguishing between these 2 types of CPA requires the clinical judgment of an experienced physician. Because of the uncertainty of the definitions, the possible unfamiliarity of clinicians with the diagnosis, and the low incidence of CPA, the sample size is relatively small especially in the need to compare between groups in the current study. However, in the field of such a fresh definition, our findings might be clinically beneficial and may inspire future studies in China. Abbreviations: CCPA = chronic cavitary pulmonary aspergillosis, CPA = chronic pulmonary aspergillosis, CT = computerized tomography, EOS = eosinophil, ESR = erythrocyte sedimentation rate, hsCRP = high-sensitivity C-reactive protein, SAIA = semi-invasive aspergillosis, WBC = white blood cells. The authors declare no conflicts of interest.

Earthquake So as you know the country of Haiti was devastated by an earthquake this past week. RWI spent 9 days in Haiti in September 2009. We brought medical care to more than 3,000 people, we delivered a baby boy named Washington, and were eternally touched by the hearts and spirits of the people of Haiti. We made lifelong friends while there. RWI had a second trip planned for August 2010, but due to the circumstances we're heading there early. We will be bringing food, water filtration systems, and medical supplies to those we know in Port Au Prince. The Ruuska Village in the Bon Repo district of Port Au Prince is where we stayed. It's a women's village run by an American woman named Barbara. She's responsible for 70 women and orphaned children. Her food supplies, clothing, and medical supplies were wiped out during the earthquake. Their buildings fell down and currently they are all sleeping outside in the courtyard, due to the fact that none of the structures are stable to enter. We also have families that we are in contact with who have lost their homes and family members. They have clean water (because we gave them filters in September), but they will be out of food by Wednesday (1-20-2010). They are also in need of basic medical supplies to treat cuts, bruises and minor breaks. If you would like to donate supplies (to be hand carried to Haiti by myself)

Empty London - TranceMan http://www.roberttimothy.com/empty-london ====== sillysaurus2 The author explains how they took these photos: [http://blog.roberttimothy.com/2013/05/Deserted-empty- London-...](http://blog.roberttimothy.com/2013/05/Deserted-empty-London- photos-of-British-capital-without-any-people-28-days-later-style- pictures.html) ~~~ brownbat > I didn't want to cheat and use Photoshop I was actually hoping he did something clever like take multiple shots and stitch them all together. Ah well, I suppose this is more noble. ~~~ nostromo It's actually much easier than manual stitching. Take 3+ shots on a tripod then take the median value of each pixel. Anything that is moving (pedestrians, cars) will vanish. Example: [http://www.creativetechs.com/iq/photoshop_cs3s_automatic_peo...](http://www.creativetechs.com/iq/photoshop_cs3s_automatic_people_remover.html) ~~~ ollysb Now That would be a useful feature on a camera. You could call it the tourist eraser :) ~~~ Joeri Nokia already has it on the lumia: [http://conversations.nokia.com/2013/07/03/nokia-smart- camera...](http://conversations.nokia.com/2013/07/03/nokia-smart-camera- remove-moving-objects-walk-through/) ------ ilamont The zombie film _28 Days_ set up a few shots like this in downtown London ... but with a movie budget and some official clearances they were able to get some sunlit shots, which appeared to be taken very early in the morning. It was a great Danny Boyle movie, incidentally. Within the past 10 years, I remember seeing another another film set in NYC which showed a scene in Times Square, completely devoid of people or traffic. It was quite striking. Anyone remember what it was? EDIT: I see from the other comments it was _Vanilla Sky_ ~~~ Nursie "Downtown" London. Which part would that be? I don't mean to snark, that's not a meaningful phrase to this englishman with 10 years London living under his belt. I actually struggle with definitions of downtown or uptown, it's not something we would say. How do they apply to (for instance) NYC which I'm a little familiar with? \--edit-- yes I am drunk and this is a stupid question :) ~~~ anigbrowl Near Westminster bridge IIRC, but it's been a while since I saw the film. By US standards downtown would be the shopping district from Marble Arch to Trafalgar Square, if you were thinking of it in commercial terms, or almost all of zone 1. Of course over here Downtown is wherever the most tall buildings ae, whereas in London most of those seem to be in the City. ~~~ barrkel London is a basically a bunch of villages with dense residential areas filling the gaps between. I've gone whole 6-month periods never going further west in the city than Holborn (Kingsway), and whole years never going south of the river east of Greenwich. You're suggesting that downtown is Oxford & Regent Streets, i.e. essentially high-street fashion shopping. Thing is, almost every shop on those streets is also in both Westfield malls on either side of the city, and many of the bigger brands are also on dozens of high streets across the city. There's seldom much call for most Londoners to actually go to those streets (IMO). In a business context, downtown in London is the City, but the tallest buildings aren't in the City, they're in Canary Wharf, a privately owned near- island with 24-hour guards at all entry points, and barriers that go up on the roads at night. ~~~ Tenoke >The tallest buildings aren't in the City, they're in Canary Wharf, a privately owned near-island with 24-hour guards at all entry points, and barriers that go up on the roads at night. Not to nitpick but this isn't strictly true. The tallest building is in neither but very close to the City, then the 2nd tallest is in Canary Wharf but the third and fourth are definitely in the City again. You have some in the Wharf and some in the City after that but I am not sure if the difference regarding skyscrapers in the 2 parts is very relevant or explicit anymore. ------ Brakenshire And the tents were all silent, the banners alone, The lances unlifted, the trumpet unblown. And the widows of Ashur are loud in their wail, And the idols are broke in the temple of Baal; And the might of the Gentile, unsmote by the sword, Hath melted like snow in the glance of the Lord. [https://en.wikipedia.org/wiki/The_Destruction_of_Sennacherib...](https://en.wikipedia.org/wiki/The_Destruction_of_Sennacherib#The_poem) ~~~ virtualwhys Reminds of the recounting of the fallen angels in Paradise Lost. Rather than face the awesome wrath of Jesus/God miffed, the to-be-fallen angels into the abyss, drift (well, really, leap in terror, but that doesn't work so well). ~~~ 6d0debc071 Not how they told it to themselves at least, IRRC ^^; Him the Almighty Power Hurled headlong flaming from th' ethereal sky With hideous ruin and combustion down To bottomless perdition, there to dwell In adamantine chains and penal fire, Who durst defy th' Omnipotent to arms. [...] What though the field be lost? All is not lost; th’ unconquerable will, And study of revenge, immortal hate, And courage never to submit or yield. [...] Here at least we shall be free; the Almighty hath not built Here for his envy, will not drive us hence: Here we may reign secure, and in my choice to reign is worth ambition though in Hell: Better to reign in Hell, than serve in Heaven. ~~~ virtualwhys Thanks for the refresher. If any book will make one a Christian, Paradise Lost is probably it ;-) ------ CWIZO At first I thought he combined several images into one (there was a project a while ago that did that). But after reading that he actually waited for everyone to clear ... that blew my mind. I absolutely can't imagine seeing big ben or piccadilly without a single person in my eyesight. Absolutely marvellous! Too bad I'm away for christmas this year, I'd love to stroll trough the empty streets ... ~~~ ye I'm pretty sure he's lying. There's no way for most of these places to clear completely. It's like seeing Times Square empty. I'm 99% sure it's a composite from multiple exposures. ~~~ pdknsk > It's like seeing Times Square empty. It's interesting you mentioned this. The pictures reminded me of Vanilla Sky, which prominently features empty Times Square. ~~~ danso Funny you should mention that. Every time I think of Times Square being empty (which can happen at certain angles at certain very early times of day), I think of Roger Ebert's review of Vanilla Sky: [http://www.rogerebert.com/reviews/vanilla- sky-2001](http://www.rogerebert.com/reviews/vanilla-sky-2001) > _Note: Early in the film, there 's an astonishing shot of Tom Cruise > absolutely alone in Times Square. You might assume, as I did, that computers > were involved. Cameron Crowe told me the scene is not faked; the film got > city permission to block off Times Square for three hours early on a Sunday > morning. Just outside of camera range there are cops and barricades to hold > back the traffic._ ------ kailuowang I am wondering if there is any connection between this project and Tokyo Nobody by Masataka Nakano [http://www.amazon.com/Tokyo-Nobody-Masataka- Nakano/dp/489815...](http://www.amazon.com/Tokyo-Nobody-Masataka- Nakano/dp/4898150314) ~~~ mturmon Thanks for that. The London photos made me think of empty mini-mall photos taken in LA by Cathy Opie. Here's an example: [http://arttattler.com/Images/NorthAmerica/NewYork/Guggenheim...](http://arttattler.com/Images/NorthAmerica/NewYork/Guggenheim/Catherine%20Opie/4_Untitled_01_6.5MG.jpg) They were shot in black and white, and when shown in a gallery context, they are very large (4 feet wide or so). She used a similar technique -- show up early in the morning (like 4am) and be patient. She had do it late enough to be after the clubgoers, junkies, and criminals were asleep, but before regular people were awake. You can google "cathy opie mini mall series" \-- she's better known for her earlier, transgressive lesbian/body images. ------ standeven I had to catch an early flight and found myself walking around Dubrovnik at 4am. Seeing the wide stone streets, polished by the feet of thousands who were now completely absent, was surreal. I highly recommend waking up extra early in a normally busy city and taking a stroll; you end up seeing and appreciating completely new things. ~~~ thruflo One summer, a few years ago, a friend and I flew from New York to Iceland. After a jet lagged snooze, we ventured out into Reykjavik town centre around 10am on Saturday morning -- to find the streets completely deserted. Made sense later on, when we realised that seemingly everyone in town went out after midnight to party through the night. Boom years when the sun doesn't set... ------ drfuchs And Paris is pretty empty early in the morning, too. Check out the 1976 Claude Lelouch 8.5-minute vehicle(!), "C'était un Rendezvous" ("It was a date"). Classic! [http://www.streetfire.net/video/ctait-un-rendez-vous- claude-...](http://www.streetfire.net/video/ctait-un-rendez-vous-claude- lelouchflv_2064708.htm) or other similar. ------ coherentpony I'm using linux. This site's scroll behaviour is infuriating. ~~~ aj700 Yes. Usability fail. OS X often has no scrollbars. Unity has none? My mouse has no horiz-scoll. Wed designers stop doing this. We aren't all using tablets! ------ ngpio What a surprisingly pleasant side-scrolling experience. ------ Usu If you liked this, you should also check out this beautiful timelapse video of Milan (same concept): [http://www.youtube.com/watch?v=EyHsouXc_HU](http://www.youtube.com/watch?v=EyHsouXc_HU) ------ spjwebster I've previously done this kind of thing with an ND filter and long exposures to save getting frustrated by occasional passers-by. Here's a series of photographs of major cities around the world done using this technique by Lucie & Simon: [http://petapixel.com/2012/03/28/post-apocalyptic- photographs...](http://petapixel.com/2012/03/28/post-apocalyptic-photographs- of-major-cities-around-the-world/) [http://www.lucieandsimon.com/works/silent_world](http://www.lucieandsimon.com/works/silent_world) ~~~ StavrosK Wouldn't it be "easy" to capture a video of a minute or so and then write an algorithm to keep the parts that were unchanged among all frames? I did something like that ten years or so ago, and it worked very well (it took the mode of each pixel among X frames). ~~~ alephnil In many cases that will do, but there will be problem with continuously changing objects, such as ads, escalators and clocks that will be blurred, at least unless a quite sophisticated algorithm is used. ------ csmuk The square mile looks like that on a weekend. The rest looks like that at 05:30. in summer. ~~~ walshemj Yes I remember having to go into work to reboot our systems once back in the 80's 200/300 yards from oxford street and it was quiet as the grave. Many cafes, bars and pubs in the city shut down at the weekend. ------ yuvadam In Israel, there is one day a year [1] where the streets actually look like this [2]. (Granted, most of the time you will see plenty of people walking around the streets, or children riding bicycles.) [1] - [https://en.wikipedia.org/wiki/Yom_Kippur#Observance_in_Israe...](https://en.wikipedia.org/wiki/Yom_Kippur#Observance_in_Israel) [2] - [http://www.demotix.com/photo/862508/tel-aviv-streets- empty-y...](http://www.demotix.com/photo/862508/tel-aviv-streets-empty-yom- kippur) ~~~ zek saturdays in Israel are quiet empty as well ------ tomsaffell Nice work! And to prove they are not phony, time for a game of 'I Spy'! ISWMLE: a cyclist a trash collector possibly a policeman several lit car tail lights Advances? ------ sjtgraham I live near quite a few of these. The way to experience this is by being there very early on a Sunday morning or a Bank Holiday. Let me tell you there are few things as eerie as riding a bicycle around Central London and not seeing a single soul. Of course it's not totally deserted, you'll see the odd vehicle especially on the main roads, but there are definitely moments where it feels like being in 28 Days Later. ~~~ ABS Preparing for a marathon I always did my saturday long run starting very early in them morning (like 5am or 6am, once I even started at 4am because I had a company event I needed to be at early) and it was definitely...awesome. Especially running along the Thames in Central London during sunrise: there were entire 10/15 minutes stretches without people and even cars. ------ sharkweek Reminds me of the opening scene of Vanilla Sky where Tom Cruise is running through downtown Manhattan alone -- [http://www.youtube.com/watch?v=6DIsa_SLifQ](http://www.youtube.com/watch?v=6DIsa_SLifQ) I always think it's cool when we're able to capture this sort of rare feat on film, in this case emptying out Times Square for a few brief moments ~~~ jknightco Times Square is in Midtown. Downtown is the Financial District :) ------ crorella Nices photos, horrible website usability. ~~~ SomeCallMeTim Black page when scripts are disabled. And the photos popping up in random places as you're scrolling? Sigh. ------ web64 Those photos are great! I've been taking some night shots of street art in London, and because of the long exposure the streets often appear to be empty. You can see some of my photos here: [http://advers.com/gallery](http://advers.com/gallery) ------ cmdkeen You don't even have to get up to experience this - just head into the City of London[1] on a weekend, especially a Sunday. Most of the streets are empty. [1]: [http://en.wikipedia.org/wiki/City_of_London](http://en.wikipedia.org/wiki/City_of_London) ------ shittyanalogy Gorgeous, but they look more like early morning shots than abandoned city shots. Give me broad daylight or with all the lights off and it'll really feel atmospheric. The extreme saturation also doesn't contribute to a feeling of desertion. Also, abandoned London is spotless. ------ markkum This is the London I remember from early morning July 8th, 2005, the morning after the bombings. Was walking around to find a ride to the airport, couple of blocks from the double-decker wreck. Wish not to experience the same again. ------ kenshiro_o That's awesome work! Strangely I cannot believe that a place like Piccadilly Circus is ever empty. It feels so unreal. He must have: a) waited a lot to see the streets clear b) been quite lucky the streets eventually cleared. ------ ekr Very interesting (and beautiful I might say, seeing the empty streets awaken some beautiful memories), but that's not how London would look like if everyone left. Not even close. Maybe only for the first couple of days. ------ benblodgett This is really cool, I've never been to London so I have no reference for how busy the places he photographs typically are. I would love to see a similar project for NYC. ~~~ dblacc Very busy is probably the only way to describe them. I work not far from where some of these photos were taken where its frustratingly busy at times. You would never think this was possible. ------ chrislo I also enjoyed this collection of "empty" photos of all 270 tube stations: [http://instagram.com/tube270](http://instagram.com/tube270) ------ kcovia _28 Weeks Later_ also takes place in an abandoned London. ------ darkFunction Nice photos but it also highlights how claustrophobic London is. I live here and don't like how you can never be really alone outside of your own home. ------ gulbrandr A similar experiment was done in Paris a few weeks ago: [http://vimeo.com/74857458](http://vimeo.com/74857458) ------ shalmanese For Americans who want to replicate this, Thanksgiving day around 2 - 3pm is also similarly eerily quiet and a great chance to get a shot like this. ~~~ driverdan Thanksgiving morning would be better. There is usually a ton of people out in the afternoon picking up last minute things at grocery and liquor stores. ------ vlad Anyone else notice that the second-to-last photo has 4 or 5 people in the scene, as well as a moving car? Otherwise, well done! ------ kubatyszko I recommend a photo album "Tokyo Nobody" \- similar concept. ------ gpvos The people who left forgot to turn off the lights. ------ joelle Wow those photos stunning...and thought provoking. ------ ldn_tech_exec1 beautiful

Tag - infertility issues In September, a 36-year-old Swedish woman became the first ever to give birth from a transplanted womb. A new paper published in The Lancet provides a "proof of concept" report on the case. "Absolute uterine factor infertility" is the only type of female infertility still considered to be untreatable. This condition is often a consequence of Rokitansky syndrome, which is when a woman is born without a womb. Adoption and surrogacy have so far been the only options for women [...] It‘s official. What you eat and how much you exercise can actually boost your baby making ability. According to new research you can change the strength of your gene’s (DNA) by keeping in optimum physical shape.Research from Department of Obstetrics & Gynecology at the Robinson Institute, Research Centre for Reproductive Health at the University of Adelaide in South Australia found that a fathers diet and body composition at the time of conception is likely to affect his future child’s [...] You could increase your chances to get pregnant by... getting a job! A US study matched 140 million female birth records with unemployment rates and found that the negative effects of unemployment on fertility increase over time. Scientists have been researching the relationship between fertility and unemployment for more than a century. Most studies find that fertility falls with unemployment in the short run but it is not known whether these negative effects persist because women simply may postpone childbearing to better [...] Alice Tan: "Trying to have a baby for OVER 3 YEARS" Alice Tan and her husband did NOT quit. After more than 3 years of no success in conceiving they decided to try Conceive Plus...Today they're the happy parents of a 1-year old baby boy!!! Trying to get pregnant? If you are trying to get pregnant, using Conceive Plus fertility lubricant can help increase the chances, naturally. Use in place of your regular lube, Conceive Plus is a gentle lubricant that actually helps the process [...] We’ve all grown up with this same idea “First comes love, then comes marriage, then comes baby in a baby carriage.” But reality is that the society changes over time. For modern women, it’s a bit more like “First comes the education, then the graduate degrees and then having a good job and financial security” and only after all this come love, marriage and babies. But is this happy ending necessarily given??As much as we would like to believe, [...] Elisabeth Rohm just wrapped up participation in Fertility Planit - a two day event April 4-5 at the University of California at Los Angeles. The first event of its kind, Fertility Planit was an all-fertility focused show featuring leading fertility experts. Topics included Beginners Guild to Infertility, Becoming a Single Parent by Choice, Egg Freezing, Creating a LGBT family, Adoption, Male Infertility, Fertility Over 40, Adoption, and IVF.The actress talked about motherhood, IVF and her book, "Having the Child [...] Reportstack has announced a new market research publication on Prenatal Testing Market in the US 2014-2018. The report pinpoints declining fertility rate as a key challenge to the American prenatal testing market. The findings are for the forecast period 2014-2018. The declining fertility rate and related drop in number of pregnancies is leading to a marked reduction in the demand for prenatal testing. Additionally, the risks related to invasive diagnostic procedures are also discouraging expectant mothers from undergoing these procedures.”The US fertility [...] Sperm has been successfully grown in a test tube for the first time, a breakthrough technology that could eventually help cure male infertility, Japanese scientists said Thursday.In the experiment, researchers at Yokohama City University were able to produce healthy, fertile offspring using the laboratory created sperm. Their findings can be found in the journal Nature.“Until now, none of the attempts have been wholly successful, and when the sperm have been used, the pups born have not been healthy and have soon [...] Couples with fertility problems are more likely to stay together if they eventually have a child together, new research indicates.Previous studies have shown that fertility problems can have a massive impact - both physically and psychologically - on couples, particularly women. Some studies have even found that undergoing unsuccessful fertility treatment may increase stress and depression levels and lower overall quality of life.However, other studies have found that fertility problems can bring couples closer together, so Danish researchers decided [...] Conceive Plus video testimonial "We used a sperm safe fertility lubricant..."PREGNANCY TIPS TO HELP YOU CONCEIVE The time to start working toward a healthy pregnancy is before you conceive. If you are trying to get pregnant our pregnancy tips are good start to get your body ready for conception process. Read more here MORE ABOUT CONCEIVE PLUS If you have just started trying to get pregnant or have been trying for a while, Conceive Plus® can help increase your chances of conception naturally! [...]

Defining combined immunodeficiency. Although the extreme condition of typical profound T-cell dysfunction (TD), severe combined immunodeficiency (SCID), has been carefully defined, we are currently in the process of better defining less typical T-cell deficiencies, which tend to present with autologous circulating T-cell combined immunodeficiency (CID). Because autologous cells might interfere with the outcome of bone marrow transplantation, protocols usually include conditioning regimens. Therefore it is important to define the numbers of autologous cells usually detected in patients with CID versus those with SCID. We sought to determine the number of circulating T cells in patients with SCID as opposed to those with CID, to study their function, and to evaluate their possible detection during newborn screening using T-cell receptor excision circle (TREC) analysis. Numbers of circulating CD3(+) T cells (as determined by means of flow cytometry), in vitro responses to PHA, and TREC levels, all measured at presentation, were compiled from the research charts of the entire cohort of patients followed prospectively for T-cell immunodeficiency at the Hospital for Sick Children. Clinical data were ascertained retrospectively from the patient's hospital charts. One hundred three patients had CD3(+) determinations, and 80 of them had a genetic diagnosis. All patients considered to have typical SCID had CD3(+) T-cell counts of fewer than 500 cells/μL. Some variability was observed among different genotypes. In vitro responses to PHA were recorded in 88 patients, of whom 68 had a genetic diagnosis. All patients with low CD3(+) T-cell numbers (<500 cells/μL) also had markedly decreased responses to PHA (typical SCIDs). However, responses ranged widely in the groups of patients with TD who had more than 500 CD3(+) autologous circulating T cells per microliter. Although patients with Omenn syndrome and ζ chain-associated protein, 70 kDa (ZAP70), and purine nucleoside phosphorylase (PNP) deficiencies had low responses, patients with the p.R222C mutation in the IL-2 receptor γ(IL2RG) gene as well as IL-10 receptor and CD40 ligand deficiencies had normal or near-normal mitogen responses. Finally, 51 patients had TREC levels measured. All patients with typical SCID, Omenn syndrome, and ZAP70 deficiency had low TREC levels. In contrast, patients with mutations in forkhead box protein 3 (FOXP3), CD40 ligand (CD40L), and IL-10 receptor α(IL10RA), as well as patients with the p.R222C mutation in the IL2RG gene, had normal TREC levels. Patients with typical SCID can be defined as having fewer than 500 circulating CD3(+) T cells. Most patients with autologous T cells still have profound TD, as defined by reduced in vitro function and thymus output. Some patients with conditions including TD have normal TREC levels and will therefore not be detected in a TREC-based newborn screening program.

6*c Expand (-l**4 + 4*l - 4*l)*(3*l + 6*l + 2*l). -11*l**5 Expand (2 - 1 + 2)*(3*r**2 + 11*r**3 + r**2 - 6*r**2). 33*r**3 - 6*r**2 Expand (3*o**2 - 5*o**2 + o**2)*(2*o + o - 4*o)*(2*o + o + 2*o). 5*o**4 Expand -3*z - 2*z + 4*z + (4*z + 3 - 3)*(-3 - 3 + 4). -9*z Expand (-12 + 12 + 2*b**4)*(-2 + 2 + 3) - 2*b**4 + 0*b**4 + 0*b**4. 4*b**4 Expand (0*p**5 - 2*p**5 + 4*p**5)*(1 + 4 - 3) + 8*p**2 + 9*p**5 - 8*p**2. 13*p**5 Expand (-4*y + 0*y + 2*y)*(-2 + 2 + y) + 0*y - 12*y - 7*y - 4*y**2 + 2. -6*y**2 - 19*y + 2 Expand (2*i**3 - 5*i**3 + i**3)*(-i - i + 4*i - 1). -4*i**4 + 2*i**3 Expand (-5*n - 4*n**3 + 5*n)*((n - 1 + 1)*(2 - 3 + 3) + 4*n + 2*n - 7*n). -4*n**4 Expand (0 + v + 0)*(0 - 1 + 2)*(8*v - 3*v - v)*(-5*v + 4*v + 3*v). 8*v**3 Expand -17*m**2 - 24*m**5 + 13*m**5 + 10*m**5 + m**5 - m + m + (4*m - m - m)*(1 + 2*m**4 - 1). 4*m**5 - 17*m**2 Expand (0 - 1 - 5)*(2*x**3 - 2*x**2 + 2*x - 2*x). -12*x**3 + 12*x**2 Expand (-2*f + 0*f + 4*f)*(-3*f**2 + f**2 + f**2 + (0*f - 4*f + 2*f)*(3*f + 2*f - 3*f)). -10*f**3 Expand (h - 3*h + h)*(-h - 2*h + 5*h)*(-3*h + 4*h + h). -4*h**3 Expand 19 - 10*w**4 - 19 + (w + w + 0*w)*(-5*w**3 - 2*w**3 + 6*w**3). -12*w**4 Expand (2*d**3 - 3*d**3 + 2*d**3)*(12 + d - 28 + 17). d**4 + d**3 Expand (-4*p + 2*p**2 + 4*p)*(-14 - 27*p + 14)*(3 - 1 + 0) + 0*p**3 + 0*p**3 - p**3. -109*p**3 Expand (0*d + 2*d - 4*d)*(2 - 2 + d) - 8*d + 1 + 8*d + d**2. -d**2 + 1 Expand (3*c + 107 - 107)*(-5*c + 3*c + 3*c - 1). 3*c**2 - 3*c Expand (-2 + 3 + 3)*(0*f - f - f + (-4 + 4 + 2*f)*(-3 + 4 - 3) + 3*f + 4*f - 6*f + f + 0 + 0 + (1 + 0 - 3)*(2*f - 4 + 4) - 1 + f + 1). -28*f Expand (-1 + 4 + 0)*(-3*w**5 + 5*w**5 - 7*w**5). -15*w**5 Expand (-4 + 5 - 3)*(-4*t - 7*t - 1 + 5*t). 12*t + 2 Expand (2*l**3 - 2*l**3 + l**3)*(0 + 0 + l) + (2*l**3 - 2*l**4 - 2*l**3)*(-1 - 1 + 4). -3*l**4 Expand p + p - 4*p + (-2 + 3 - 2)*(0 + 2*p + 0) + (5*p - p - 2*p)*(2 - 1 + 1)*(-1 - 1 + 1). -8*p Expand (3*y**2 - y**2 - 3*y**2)*(2 + 1 - 5 - 11*y). 11*y**3 + 2*y**2 Expand (-4*z**2 + 11*z**2 + z**2)*((-2 + 1 + 0)*(2 + 1 - 4) + 1 + 0 + 0 + 3 + 1 - 2 + 2 + 5 - 5). 48*z**2 Expand (1 - s**4 - 1)*(0*s - 3*s + 4*s) + 13*s**4 + 6*s**5 - 13*s**4 + (-s**3 + s**3 + 2*s**5)*(-2 + 1 + 3) + 0*s**5 + 2*s**5 - 3*s**5 - 3*s**3 + 3*s**3 - s**5. 7*s**5 Expand (-2*y**5 - y**5 + y**5)*(4 - 5 - 2). 6*y**5 Expand (-v**2 + 3*v**2 - 4*v**2)*((-4 + 1 + 0)*(4 - 7 + 4) + 2 + 1 - 2). 4*v**2 Expand ((-3*p + 2*p + 0*p)*(p**2 + 0*p**2 + 0*p**2) + (2*p**2 - p**2 - 3*p**2)*(-2*p + 3*p + 0*p) + 12 - 12 - 6*p**3)*(-p + 4*p - 4*p). 9*p**4 Expand (7 - 3 + 7)*(-2*v**2 + v**2 + 0*v**2). -11*v**2 Expand 0*c**5 + c**5 + 0*c**5 + (-3*c + 3*c + c**3)*(5*c**2 + 3*c**2 - 6*c**2) + 0*c**5 + 2*c**5 + 0*c**5 + 0*c**5 - 3*c**5 + 7*c**5 + 0*c**5 - 4*c**5 + 3*c**5. 8*c**5 Expand 2 - 2 + 3*t**2 - 4*t**2 - t**2 + 4*t**2 + (0*t - 3*t + t)*(0 + t + 0) - 2*t**2 + 4*t - 4*t + 0*t**2 + 2*t**2 - t**2 + (3*t - 4*t - t)*(-2*t + 2*t - 2*t). 3*t**2 Expand (u - u - 2*u**2)*((-6*u + 3*u + 2*u)*(0*u**2 - 2*u**2 + 4*u**2) + 0*u**3 - 4*u**3 - 2*u**3). 16*u**5 Expand (-2 - d**2 + d**2 - 2*d**3)*(8 - 4 + 8). -24*d**3 - 24 Expand ((4 + 0 - 2)*(3 - 3 - u) - 3*u + u + u - u - 4*u + 2*u)*(-4*u + 6*u - 3*u). 6*u**2 Expand ((-2 + 2 - l)*(-3 - 1 + 2) - 3 + 2*l + 3)*(2*l**2 - l**2 - 4*l**2). -12*l**3 Expand (-4*h + 3*h - h)*(15 - 19*h**2 - 15). 38*h**3 Expand (0*z + 3*z - z)*(-1 + 2 + 1)*(32*z**3 + 56*z**3 + 7*z**3). 380*z**4 Expand (18*z**3 + 4*z**2 + 1 - 35*z**3 + 13*z**3)*(-z**2 - 2*z**2 + z**2). 8*z**5 - 8*z**4 - 2*z**2 Expand -2 + 3*j**3 - 6*j**4 + 9*j**3 - 14*j**3 + 4*j**3 - 4*j**3 - j**4 - 6*j**4 + j**4 + 3*j**4 + (2*j**3 - 3*j**3 - j**3)*(2*j + 0*j - j). -11*j**4 - 2*j**3 - 2 Expand 2*y - 6*y - 2 + y + (4 + 0 - 3)*(1 - 1 - y) + 0*y - 3*y + y - 2*y - 1 + 1 + 3*y + 1 - 1 + y + 2*y - y + (1 + 2 - 5)*(2*y - 4*y + y). -y - 2 Expand (3 - 1 + 0)*(-3*k - 2*k + 6*k) + k - 6*k - k. -4*k Expand 2*m - m**5 - 2*m + (3 - 2 + 0)*(m**5 + 0*m**5 - 2*m**5). -2*m**5 Expand (-14 + 14 + 3*t)*(-11*t**2 + 11*t**2 + 14*t**4). 42*t**5 Expand 96 - 17*r**2 - 96 + (-3 - 2*r + 3)*(-r + 4*r - 2*r). -19*r**2 Expand (-7*y + 2 + 1 - 2)*(10*y - 12*y + 9*y)*(-2 + 0 - 1). 147*y**2 - 21*y Expand (15 - 1 - 4)*(0*n**3 - 2*n**4 + 0*n**3). -20*n**4 Expand (0 + 3 - 8)*(-3*r**3 + 4*r**3 + 4*r**3 + (2*r**2 + 2 - 2)*(r + 0*r - 2*r)). -15*r**3 Expand 3*d**3 - 7 + 7 + (-d**2 + 2*d**2 + 0*d**2)*(4*d - d - 4*d) + 0*d**3 + 3*d**3 - 5*d**3 + 5*d**3 - 2*d**3 - d**3. 2*d**3 Expand (1 - 1 + c)*(-2 - 6 + 3) + (0*c - c + 0*c)*(1 + 2 - 5). -3*c Expand (-5 + 4 + 2)*(0*m + m + 0*m + (1 - 1 + 2*m)*(-3 + 3 + 1))*(m**3 - m**4 - m**3). -3*m**5 Expand (3*j - 2*j + 0*j)*(-2*j - 2*j + 3*j) + (j - j - 4*j)*(-j - j + 3*j). -5*j**2 Expand (2 + 3 - 3)*(0*g + 3*g - 4*g)*(-9 + 9 - 3*g**3 - 1 + 1 - 3*g**3 + (-4*g + g + g)*(-2*g**2 + 1 - 1)). 4*g**4 Expand ((1 + 1 + 0)*(-1 + 1 - 1) - 4 - 2 + 1)*(-3*n + 2*n - n)*(-2 - 2*n + 2). -28*n**2 Expand (2 - 1 + 1)*(-18*w**2 + 18*w**2 - 8*w**4). -16*w**4 Expand (0*r + r - 5*r)*(-4*r**3 + 3*r**3 + 6*r**3). -20*r**4 Expand (-61*d**4 + 13*d**4 - 22*d**4)*(0*d + 2*d - 4*d). 140*d**5 Expand (-4*d**2 + 27*d - 27*d)*(d + 3*d - 3*d). -4*d**3 Expand (-v**2 + 5*v**2 - v**2)*(5 + 4*v**2 + 5*v**2 - 16*v**2). -21*v**4 + 15*v**2 Expand 337 + 3*b**5 - 566 + 370 + (b**3 + 0*b**3 + 0*b**3)*(2*b**2 + 5*b - 5*b). 5*b**5 + 141 Expand (0 + x + 0)*(2 - 3 + 4)*(-18*x + 18*x + x**2). 3*x**3 Expand (1 + 3 - 3)*(0 - 1 + 3)*(2*o**2 - 2*o**2 + 2*o**2). 4*o**2 Expand 178*g - 178*g - 8*g**5 + (3*g**2 - 2*g**2 + 0*g**2)*(2*g**3 + 0 + 0) + 4*g**4 - 4*g**4 + g**5. -5*g**5 Expand -d - 3*d**2 - 3*d + 2*d**2 + (-2 - 2 + 2)*(5*d - 5*d + d**2). -3*d**2 - 4*d Expand (5*a - 3*a - 3*a)*(-2*a**2 + 17*a**2 + 6*a**2 - 2*a**2). -19*a**3 Expand 28 - 6*b + 7*b + 0*b + b - 2 + 2 + (1 - 2*b - 1)*(0 + 2 - 1) + b - 6*b + 3*b - 4*b - 3*b + 5*b. -4*b + 28 Expand 2*z**5 + 2*z**3 - 2*z**3 + 0*z**5 + z**5 + 0*z**5 + (3*z**4 + 0*z**4 + z**4)*(3*z + 3*z - 5*z). 7*z**5 Expand -2*n**3 - n**2 + n**2 + (3*n + n - 3*n)*(-n**2 - 2*n**2 + 2*n**2) - 2*n - 5*n**3 + 2*n - n**2 + n**3 + n**2. -7*n**3 Expand (3795 + 85*c**4 - 2*c - 3795)*(-3*c - c + 2*c). -170*c**5 + 4*c**2 Expand ((-6*v - 6 + 6)*(2*v + 0 + 0) - 3*v**2 + v**2 + 5*v**2)*(v**3 + 3 - 3). -9*v**5 Expand (2 + 1 - 2)*(-2*d - 2*d + 5*d) + 0 + d + 0 + 0*d + 0*d + 2*d. 4*d Expand (0*s**2 - 3*s**2 + 5*s**2)*(-2*s + s - 2*s + s + 0*s + 0*s + (-1 - 2 + 2)*(3*s - 3*s - s)). -2*s**3 Expand (2 - 2 + n**3)*(-3*n + n + 0*n) - 1 - n**4 + 10*n - 3*n - 3*n. -3*n**4 + 4*n - 1 Expand ((5*r - 2*r + r)*(-2 + 3 + 2) - 5*r + 3*r + r + 0*r - 3*r + 0*r + (2 + r - 2)*(2 - 4 + 0) + 2 - 2*r - 2 + 0*r - 2*r + 0*r)*(-2*r - 4*r + 4*r). -4*r**2 Expand (-3 + 2 - 3)*(-2*n + 2*n + n)*((2 - 6 + 2)*(-1 - 3 + 2) - 1 + 1 + 1). -20*n Expand (0 + 0 + j**2)*(3*j**3 - 5*j**2 - 2*j**3 + 9*j**2). j**5 + 4*j**4 Expand -4*g + 4*g + 2*g**3 - 2*g**3 + 0*g + 0*g + 5*g**3 + g**3 - 4*g**3 + (1 + 5 - 5)*(-4*g**2 + 4*g**2 + g**3) - 3*g**2 + 3*g**2 + 3*g**3. 6*g**3 Expand (-2 + 2 - 2*p)*(-1 + 0 + 0) - 20 + 4*p + 20 + (-4*p + 0*p + 2*p)*(4 - 5 + 2). 4*p Expand (-9*g + 8*g - g**3 + 0*g**3)*(-13*g + 12 - 12) + 4*g**3 - 4*g**3 + 2*g**4 - 1 + g**4 + 1. 16*g**4 + 13*g**2 Expand (-3*h - h + 5*h)*(h**2 - 2*h**2 + 3*h**2)*(3 + 7 - 4). 12*h**3 Expand (-3*l + 2 - 2)*(-4 - 8 + 0 + 7). 15*l Expand 0*u**5 - 5*u**5 + 2*u**5 + (1 + 2*u**2 - 1)*(3*u**3 - 6*u**3 + 2*u**3) + 3*u**5 + u**5 + 0*u**3 + 2*u**3. -u**5 + 2*u**3 Expand (34*n + 5*n + 55*n + 17*n)*(-2 + n + 2). 111*n**2 Expand (-3*b**4 + 5*b**4 + 0*b**4)*(-1 + 2 + 0) + (9*b**2 - b**2 - 3*b**2)*(-4*b - 2*b**2 + 4*b). -8*b**4 Expand (0 + 2 + 0)*(-2*s**5 + 0*s + 0*s) + 3*s**4 - 2*s**5 - 3*s**4 + 3*s**5 - 6*s**5 + 2*s**5 + (-5*s**3 + 3*s**3 + s**3)*(3 - 3 + 2*s**2) - 5 + 5 + 4*s**5. -5*s**5 Expand (0*b**4 - 2*b**4 + 3*b**4)*(-6*b + 13 - 13). -6*b**5 Expand 6 - 4*m**3 - 6 + (4*m**2 + m**2 - 6*m**2)*(2 + m - 2) - 1 + 117*m + m**3 - 117*m. -4*m**3 - 1 Expand (-3*v + 0*v + 4*v)*(2*v + 0*v - v)*(-3 + 3 + v). v**3 Expand (-3 + 3*w**2 + 3)*(11 + 6 - 2). 45*w**2 Expand (3 + g - 3 + (3 + 2 - 4)*(0*g + g - 3*g) - 4 - g + 4)*(g**4 + 9 + 11 + 2*g**3 - 19). -2*g**5 - 4*g**4 - 2*g Expand (2 - 2 - 11)*(-1 - 3 + 2)*(-p**3 - 2*p**3 + 0*p**3). -66*p**3 Expand 871*q**2 - 871*q**2 - 23*q**5 + (-2*q**5 + 0*q**5 + 4*q**5)

4 months ago 4 months ago 4 months ago 4 months ago Big East M5: 04.02.13 Edition Georgetown fans received some measure of consolation after a disappointing Second Round upset when the AP named Otto Porter a first-team All-American yesterday. Tying Trey Burke for the most first-team votes received, Porter became the first Hoya to claim the honor since Allen Iverson did so in 1996, and was the sixth first-team All-American in program history. (Patrick Ewing earned the distinction in three difference seasons, so Porter’s appearance is actually the eighthin Georgetown history.) Joining the Big East’s Player of the Year with AP team honors was Louisville’s Russ Smith (third team), while teammates Gorgui Dieng, Peyton Siva, Syracuse’s Michael Carter-Williams and Notre Dame’s Jack Cooley captured honorable mentions. Shortly before going into surgery to repair the compound leg fracture he’d suffered against Duke on Sunday, Louisville guard Kevin Ware borrowed a nurse’s cell phone to contact his mother, knowing “she’d be freaking out.” Six hundred miles away in suburban Atlanta, Lisa Junior was just as much in the dark regarding her son’s status as anyone watching the CBS broadcast: “He didn’t even say hello. He just said, ‘Mom, I need you to calm down.’ He knew I’d be a mess. Once I heard his voice, I was better.” Ware was walking with the aid of crutches yesterday after surgeons successfully stabilized his broken tibia with a metal rod and closed the ghastly wound where it had broken skin. He will reportedly travel to Atlanta with the Cardinals this week and sit on the bench for the Final Four match-up with Wichita State. USF has inked a home-and-home deal with Detroit, to begin in Tampa in 2013-14. Detroit’s visit to the Sun Dome will feature three returning rising senior starters, including star Ray McCallum Jr. (18.8 PPG, 5.2 RPG, 4.5 APG this season). But the return trip to Detroit in 2014-15 will be a homecoming for native sons head coach Stan Heath and incoming guard Byron Ziegler, while freshman JaVontae Hawkins will be playing an hour down the road from his hometown of Flint. It will also probably be a rebuilding year for the Titans, giving Heath a golden opportunity to recruit the area and sell the idea of a non-conference series close to home to Detroit prospects. Tulsa is slated to announce in a late-morning press conference that it will join the NewOld Zombie Big East in all sports. The impending additions of Tulsa and ECU reflect an emphasis on football stature in Mike Aresco’s new lineup, but Rob Dauster points out that Golden Hurricane basketball isn’t a complete disaster, and says “[coach Danny] Manning has the team going in the right direction, despite a depleted roster from transfers.” After winning 17 games in 2011-12, Manning held serve at around .500 in his first year as head coach, going 17-16 before losing to Wright State in the CBI. Just to salt the wounds from last weekend’s loss, Carmelo Anthony subjected Marquette fans to further indignity yesterday when he shamed Golden Eagles alum and fellow Knick Steve Novakon Instagram yesterday. Novak was apparently on the losing end of a bet on the Elite Eight game between their alma maters, and well, he made good on his wager in this shot: Kentucky native living and working in Washington, D.C. Aside from college hoops, other sources of spiritual fulfillment include road trips, tacos, and bourbon. I try to incorporate all of them into my writing.

Most Recent Auto Insurance News in Headlines A DUI conviction can have a sobering effect and no matter what you do, the insurance premiums are likely to go up steeply. The DUI conviction changes everything even if you have had a clean slate before. These are some of the reasons: To get the license back You will have to file an SR-22 Proof of Financial Responsibility Form if you have to get your license reinstated. This is because auto insurance post DUI conviction is an expensive affair and to keep you from avoiding the system by carrying insurance just for the period until you get your license … (more) February 13, 2011 It is a leap of faith from many parents when they hand over their car keys to their teenage son. This is especially because the chances of the car being crashed are 4 times more in case of teens compared to adults. There are in excess of 3000 fatalities every year which makes car crashes one of the biggest causes for the death of teens between the ages of 15 – 19. However, one insurance company has discovered that cameras mounted inside the vehicle could reduce risky behaviour during driving by a substantial 70%, saving a few lives in the … (more) February 8, 2011 Auto insurance rates might go down for the Wisconsin drivers. Republican lawmakers are debating the need to roll back the rules that mandate auto insurance coverage for certain levels. The state needs drivers to carry insurance coverage of at least 50,000 dollars for death or injury to one person, 100,00 dollar worth coverage per accident and 15,000 dollar coverage for damage to property. This rule came into effect since June of last year. Prior to this, Wisconsin was one of the two states in the country where auto insurance wasn’t mandatory for the drivers. A joint committee of lawmakers recently … (more) February 7, 2011 WebTech Wireless is one of the leading providers of ‘vehicle-fleet location-based services (LBS) & telematics technology. It has made announcements that it has expansion plans in the Mexican auto insurance industry after having getting the RFP from the existing insurance company, Grupo Nacional Provincial S.A.B. (GNP), on further buys of Quadrant ®hardware and services that is used by GNP for their auto insurance program. At least 1,500 Quadrant Locators have been delivered in December out of the new 10,000 units and an additional 1,000 have been scheduled for delivery this month through the WebTech Wireless’ Mexican distributor Prolog S.A. (Prolog). … (more) January 22, 2011 Insurance companies lower car insurance rates for drivers with safe driving habits. All that one needs to do is to install safety features or a little high-tech device which will help save up to 30% on their auto insurance rates. Allstate and Progressive are the first companies in America that reward drivers with safe driving habits where driver monitoring gadgets are used to evaluate safe driving. This safety device is almost the size of a pack of cigarettes and helps in monitor driving records such as mileage, speed, braking etc. All that the device does is monitors safe driving habits. … (more) January 16, 2011 Elderly drivers are considered a high-risk group and auto insurance companies are requesting them to hang up the keys and are asking families to take note of the driving abilities of their elderly drivers at home. Elderly drivers are responsible for at least 14% of all the crashes and 22% of fatalities caused due to crashes. The numbers have been steadily increasing in comparison with previous years. Although elderly drivers are high-risk groups they are not considered intentionally unsafe, but like the teens they too have a set of issues that are quite unique and that needs to be evaluated … (more) January 12, 2011 A high-tech gadget that can track your driving can bring you a lot of discounts on your car insurance policy. Snapshot discount program has been unveiled by Progressive Insurance in Michigan. This program comprises of installation of a monitoring device on your vehicle to record how fast, how much you drive, and your general driving patterns. Drivers can avail up to 30% discount depending on how some of these factors shape up. A lot of customers have already accepted this scheme, and seemed to have saved quite a bit. The device looks like a small garage door opener, which connects … (more) January 7, 2011 Poor driving conditions caused by bad weather have resulted in as many as 7000 fatal accidents along with 800,000 injuries, and in excess of 1.5 million vehicles crash year after year in this country. According to insurance agents, the number of auto insurance claims spikes steeply in the cold weather season compared to the other seasons of the year. The increase in the number of claims during winter is definitely because of the road condition that exists in cold weather months. This could be because a lot of people are accustomed to driving in the summer. Although it is difficult … (more) January 6, 2011 In a recent press conference, Richard Hutchinson, Progressive’s General Manager of Usage-Based Insurance said that no particular fee or any other increase should be expected to come with the Snapshot program device. The device is issued upon the request of insured car drivers. Data transmitted from the plug-in device to the Progressive Company can be used for possible discounts under the program. The device is plugged in a car’s on-board diagnostic port (OBD). It determines the time when a driver is using his or her car, how far they drive, as well as the speed they register. Car insurance advisors … (more) January 2, 2011 Mercury Insurance cuts an estimated total of 72 million dollar in rates for drivers. This happened after the company was challenged by the Consumer Watchdog, a non-profit group closely working with the Department of Insurance. Consumer Watchdog’s challenge to Mercury Insurance came at a time when Mercury Insurance planned to increase their car insurance premiums. Mercury Insurance proposed a car insurance premium hike amounting to a total of $32 million. The insurance provider sought approval from the Department of Insurance in California. California’s Department of Insurance, upon the Consumer Watchdog’s request for investigation, took action after Mercury Insurance’s submission of … (more) December 31, 2010 Progressive General Manager Of Usage-Based Insurance Richard Hutchinson recently explained about the company’s transformative discount system. This is in response to the growing market curiosity about how the discounts entitle the drivers and how they are applied. In Hutchinson stated that the Snapshot program primarily considers a car owner’s driving safety. Hutchinson first clarified that Progressive requires its insured car owners to plug in an authorized device under their 30 percent car insurance discount system. He added that the requirement to plug in the tiny device in a car’s on-board diagnostic (OBD) port must be done periodically. This will give … (more) December 30, 2010 The 2010 Auto Claims satisfaction study was recently released by J.D Power and its associates and the results show the satisfaction rate of claimants this year is slightly lower than that of 2009. In the 1000-point scale, the satisfaction rate, this year is only 837 compared to last year’s 842. Although this year’s satisfaction rate was lower than that of last year’s, there has been a 19-point improvement when compared to the year 2008 when the registered claimant satisfaction rate was only 818 points. J.D Power Insurance Practice Senior Director Jeremy Bowler said that the main reason for 2009’s high … (more) December 29, 2010 According to a recent survey, almost 3/4ths of the auto insurance policy customers would be more than happy to accept an insurance program based on telematics, if sharing data about their driving could help reduce their insurance premium to certain extent. The survey aimed to judge the level of comfort that most policy holders have with regards to sharing their driving data with the auto insurers compared to sharing other types of personal information on mobiles or on the internet. More than half of the people were comfortable enough to share data about various traffic accidents they were involved in … (more) December 24, 2010 Motorists who meet with an accident and need the help of FDNY should now be expecting a bill. Under serious concerns relating to the budget, FDNY has decided to go along with an increasing number of municipalities across the country, which charge motorists that meet with accidents and avail the emergency services of FDNY. The bills will be sent starting July 1st. Also known as accident tax or crash tax, this bill has left a lot of people across the country furious. In fact, some states have banned the practice too. According to a statement released by the FDNY, it … (more) December 21, 2010 For some policy holders there could be a reduction in auto insurance rates as early as this Thursday according to an announcement from the company. The automobile coverage rates offered by the auto industry insurance giant could be cut by 10% from next week. This announcement comes on the back of approval received from regulators of the state. The company based in Los Angeles had requested for a 72 million dollar reduction for all those customers who would be buying or renewing their policies before next Wednesday. According to the company announcement, this reduction will lead to a saving of … (more) December 19, 2010 A recent survey was conducted regarding the satisfaction that the claimants have as far as auto claims are concerned. Claimants seem to be less satisfied than they were last year. The current level of satisfaction is down by 0.005% from last year. Although the rate of satisfaction is less compared to the previous year, it is definitely more than the satisfaction level of claimants, couple of years back in 2008. The main reason behind the claimants’ satisfaction with auto insurance companies when it comes to claims is the reduction by 2days in the average time taken for repair. The satisfaction … (more) December 17, 2010 There is some good news for many policyholders, who would witness a drop in insurance rates by at least 10%. This insurance rate cut is planned to happen at Mercury, which is the 5th largest insurance company in California. According to an announcement from the company, based in Los Angeles, made on Thursday, a request for reduction in insurance rates has been approved by the regulators in the state. This rate reduction would be customers who buy or renew their old policies after December 15th. This policy change is likely to change an average of 72 dollar every year per … (more) December 12, 2010

Worldwide Ransomware cyber attack: What we need to do? Posted ON 16 May The WannaCry malware has already affected around 2 lakh users across ten thousand organizations in nearly 100 countries. People who are affected have either lost their money or compromised with their data. However, it’s not the time to be complacent. The threat has spread by different names across the globe. Whether you call it WannaCrypt, WCrypt, WCRY, or Ransomware WannaCry, it is designed in such a way that you need to pay a certain amount in bit coins to get access to a system. The worst affected are the Windows based machines, especially ATMs, as it works on the basis of Server Message Block concept, which is specific to Windows. Once the malware gets into the system, it scans all the hosts on a local area network and Internet by generating random IP addresses. If the random IP address gets connected to the traditional Microsoft networking port, i.e. port 445, exploit attempts are made. Among all the countries in the world, India and Russia were hit badly, as these countries have the maximum number of unsupported Windows XP, used by many government departments, bank ATMs. As a preventive step to avoid any consequences due to the Ransomware attack, hundreds of ATMs across India were shut down. According to sources, the Government of various countries affected by this have instructed all the banks to update the software at their respective ATMs, so that any potential or suspicious threat could be prevented. Since, Automated Teller Machines (ATMs) are highly exposed to malware attacks due to older versions of the OS; it makes software update extremely important exercise from time to time. Moreover, various security expert companies have given certain guidelines in terms of dos and don’ts to prevent Ransomware attack. The new Ransomware Wanna cry is spreading fast by encrypting the infected Windows system. There are various cyber criminals who are making the most of the situation by demanding as high as USD 300 for unlocking the affected devices. Meanwhile, Microsoft has also introduced some security patch, which, when downloaded can tackle the situation. In order to overcome any adverse situation, it is advised to follow the below mentioned measures to protect data from Ransomware. Take data backup Use a reliable security precaution Go through some Ransomware awareness training Disconnect from Internet Check file extensions Warn authorities and exercise caution However, everyone needs to be alert as the problem will get compounded when billions of devices gets connected with the concept of Internet of Things in the coming years.

Gatlin out to win races, not popularity contest EUGENE, Oregon (Reuters) - Justin Gatlin skipped along the track during his workout, sunglasses on, seemingly without a care in the world. And why not? The 33-year-old American, who has served two doping bans, rocketed to a lifetime best of 9.74 seconds in the 100 meters on May 15 and last weekend equaled his fastest ever 200m (19.68) at the Prefontaine Classic. Adoring fans kept him busy signing autographs for nearly an hour after his 200m win, but Gatlin's popularity is far from universal. Calls for the sprinter to be kicked out of the sport due his doping suspensions, one of which was for four years, have been widespread, coming from fellow athletes, social media and newspaper columns.

Pseudostructural inhibitors of G protein signaling during development. Heterotrimeric G proteins mediate signal transduction pathways to control development in fungal, plant, and animal cells. A recent study in the July issue of Molecular Cell identifies three proteins that, while not displaying sequence similarity to G protein subunits, appear to act as structural mimics of a Gbetagamma dimer to negatively regulate pseudohyphal growth in budding yeast.

LONDON (Reuters) - A “chlorinated chicken” and a “big girl’s blouse” - British Prime Minister Boris Johnson kicked off his first questions in parliament by goading opposition Labour leader Jeremy Corbyn for not backing a new general election. At Prime Minister’s Questions, a parliamentary session when lawmakers get to quiz the British leader every Wednesday, Johnson used some choice language to attack Labour and try to rally his Conservatives after a bruising night on Tuesday. After losing a vote on his Brexit plans late on Tuesday, Johnson was keen to get on the front foot by accusing Corbyn of supporting a policy of “dither and delay” over Brexit but also of running scared of his call for an early election on Oct. 15. “There’s only one chlorinated chicken that I can see ... and he’s on that bench,” Johnson said, pointing at Corbyn who has criticized the British leader’s enthusiasm for a trade deal with the United States over, among other things, concerns over food standards. He also appeared to shout at Corbyn that he was a “great big girl’s blouse” - a coward - over his decision to back an election only when a no-deal Brexit was off the agenda. Johnson, whose government has lost its majority after he axed 21 lawmakers from his party, wants to hold a snap election to shake up parliament, which is deeply divided over Brexit and rejected his predecessor Theresa May’s exit deal with the EU three times. Corbyn has also repeatedly said he wants an election to ditch Johnson’s “phoney, populist cabal” but first seeks to see a move to stop the prime minister from leading Britain out of the European Union without a deal embedded in legislation.

KD Interactive Soars into 2017 American International Toy Fair with Aura, a Gesture-Controlled Flying Robot Sure to Disrupt the Toy Drone Category Also from KD Interactive, the Next-Generation of its Best-Selling Smartwatch for Kids, Kurio Watch 2.0, and Upgraded Android Kids’ Tablet, Kurio Next Demonstrations of Aura and New Kurio Products Will Be Given Daily During Toy Fair, February 18th to 21st at the Javits Center in New York City, at KD Group’s Booth #5929 KD Interactive introduces Aura, a gesture-controlled drone that uses patented Gesturebotics(TM) technology powered by Locorobo. Using a wearable glove controller, kids can pilot the robot using hand motion wearing the glove. Aura can roll, climb walls and fly around the room. KD Interactive, maker of the best-selling line of kid-safe Kurio tablets and smartwatches, today introduces three new and innovative kid tech products for 2017: Aura, the most kid-friendly pilotable drone that is easily controlled by hand gestures made wearing a special glove controller; plus, next-generation versions of two of its most popular electronics items built especially for kids, Kurio Watch 2.0 and Kurio Next. “Today’s kids grow up with technology in their daily lives and have much more sophisticated expectations of what tech can and should do. It is always our goal to bring products to the market that will not only deliver on that expectation and offer great entertainment, but to also deliver a technology experience that is kid-friendly,” said Eric Levin, KD Group Strategic Director. “With Aura, we’re removing the boundaries of a traditional joystick controller, giving kids an innovative and super cool way to play and ensuring they have a successful first flight right out of the box. With Kurio, it’s always been about giving kids the real technology they want, be it wearable tech or tablets, but designing them to be age-appropriate.” KD Interactive’s new products for 2017 include: Aura is a gesture-controlled drone that uses patented Gesturebotics™ technology powered by LocoRobo. Using a wearable glove controller, kids can pilot the robot using hand motion wearing the glove. Aura can roll, climb walls and fly around the room. A rolling cage protects the robot from crashing, offering fun and safe play. Previously only used in military applications, this gesture technology disrupts the drone market and turns the traditional RC controller on its head. Aura puts the power in kids’ hands, removing the learning curve of using a joystick controller to pilot their flying robot. To further ensure a great flight experience, Aura will auto take off upon pairing the drone and glove controller, hovering at about four feet off the ground ready to be guided. It will also have height and distance limitations, allowing the drone to be flown indoors and offering a more controlled play experience. Aura will also have headless navigation, meaning that it will always follow your lead, regardless of its orientation. Aura will be available at major retailers across the U.S. and online in fall of 2017. The MSRP is $99.99. Kurio Watch 2.0 is the next generation of the popular Kurio Watch smartwatch for kids, following a sellout 2016 holiday season. Kurio Watch 2.0 offers more fun features and customization options: interchangeable wrist bands, including color-changing bands; an expanded selection of fun photo filters and frames; an included screen protector, and more. Kurio Watch 2.0 still includes all of the fun features that kids have come to know and love: a front-facing camera that’s perfect for selfies and videos with fun photo filters; games, including wrist-controlled games, that can be played alone or with a friend; watch-to-watch messaging via Bluetooth; the ability to place or take a phone call when connected with a parent’s smartphone (no additional phone plan required); plus, all of the features you would expect from a smartwatch, like a calendar, alarm, fitness tracker, calculator and more. Kurio Watch 2.0 will be available at major retailers across the U.S. and online in fall of 2017. The MSRP is $59.99. Kurio Next is an updated model of the award-winning, best-selling, Kurio Xtreme 2 kids’ tablet. Kurio Next is a 7-inch Android device that comes pre-loaded with the latest apps and games, including new apps that introduce kids to STEM and coding concepts. It also features “Surprise-a-Week” educational apps, e-books or videos delivered to the device every week for an entire year. A new anti-shock bumper protects the device during extreme play and also makes it spillproof. Kurio Next includes a free lifetime subscription to KD’s proprietary Kurio Genius Internet filtering system, which allows kids to safely search the web, covering more than 18 billion websites in 200 languages and providing in-app web filtering. Kurio Next will be available at major retailers across the U.S. and online in summer of 2017. The MSRP is $99.99. About KD Interactive KD Interactive is a division of KD Group, based in Lyon, France. The company has been making innovative kids electronic toys for more than 20 years, working with mass and specialty retailers in more than 20 countries around the world. The company’s in-house team of product engineers, scientists and educators is focused on creating products with huge play value that incorporate cutting-edge technologies into learning and childhood development. KD Interactive is well-known globally for its best-selling Kurio® line of kid-safe tablets and smart devices. For more information about KD Interactive, visit Group-KD.com.

Nano (NANO) is the latest cryptocurrency to join the Bitcoin Superstore family of crypto payment methods. It joins other top coins like Bitcoin (BTC), Ethereum (ETH), Bitcoin Cash (BCH), Dash (DASH), Litecoin (LTC), Ripple (XRP), Monero (XMR) and TRON (TRX). Bitcoin Superstore has stated that it wants to see a gradual acceptance of crypto as true currency. It, therefore, plans to add at least one crypto coin every other week. The addition of Nano so far makes it the 8th digital currency to be supported by the increasingly popular site. Bitcoin Superstore added Monero to bring the total coins to nine. How the Bitcoin Superstore works Bitcoin Superstore customers can easily purchase items from any major online retailer, including brands like Amazon, Alibaba, and John Lewis. Their services are also available at any other e-retail outlet that does not charge customers a membership fee. Customers can utilize the site’s Purchase Now feature to complete any purchase faster and securely using crypto. All a customer needs to do is to find the item they want to buy, enter details in the Purchase Now link and add it to the cart. Then they check out with any of the nine cryptocurrencies. The Bitcoin Superstore team works seamlessly behind the scenes to ensure that all purchases are completed within time. It takes between 1-2 hours to process the orders. They also provide tracking numbers, which are usually available within 24 to 48 hours after any purchase. The team also ensure shipping and deliveries proceed smoothly, essentially being with the customer from start to finish. Although they link customers to sites that do not charge a membership fee, the Bitcoin Superstore, however, charges users a 2% fee for every order’s subtotal. The store ships to almost every corner of the world, including the U.S, the U.K, Australia, and Canada. Nano publishes weekly developer update In other developments, the Nano team released its weekly developer update yesterday. Among the updates is the final release of Nano Node Version 15/15.1. The team wrote that version 15.0 had some bugs and therefore would need to be cleared manually. It further notes that they changed the update number of the release from 15.0 to 15.1 to avoid any confusion. They also gave a new release date for the Vote by Hash feature. It is a system feature that reduces bandwidth usage on the NANO network. The developers have given September 1st, 00:00 UTC as the date the feature activates. The Nano community also undertook a stress test on the network. The team reported that tests took about 30 minutes and the average TPS from the participants ranged from 70-90. You can read more about the developer update report from here. Andy Woolmer, the CEO of New Change FX, has also joined the Nano Foundation. According to the team, Mr. Woolmer is vastly knowledgeable in financial markets and will bring a lot of that experience to the foundation. Nano (NANO) is amongst the biggest gainer in the top 50 cryptocurrencies on XBT.net in the last 24 hours. The coin has gained by over 5.42 percent against the US dollar to exchange hands at $1.94. NANO/USD has also performed impressively over the week, gaining over 50 percent. Nano currently slots in at position 34 with a market cap of $258 million and a daily trading volume of $9.9 million.

Profile of typical and atypical celiac disease in Serbian children. We compared the clinical, biopsy and serology profile in typical vs atypical celiac disease. Mean TTG value for Marsh 3b/c in typical group was (140.53+/-88.77) and in atypical (140.66+/-73.53) (P=0.622). Seventy seven percent of patients had Marsh 3b/c in typical and 67.5% in atypical group (P=0.400).

Published by Image Comics last year, Dioramas centers on a serial killer who displays his victims in true-life dioramas in order to impress the girl of his dreams. That woman also happens to be the police detective who’s hot on his trail. Ricketts wrote the graphic novels “Nowheresville” and “Lazarus Jack,” and he penned “Iron Man” for Marvel Comics.

Cerebral amino acid, norepinephrine and nitric oxide metabolism in CNS oxygen toxicity. CNS oxygen (O2) toxicity is complex, and the etiology of its most severe manifestation, O2 convulsions, is yet to be determined. A role for depletion of the brain GABA pool has been proposed, although recent data have implicated production of reactive O2 species, e.g. H2O2, in this process. We hypothesized that the production of H2O2 and NH3 produced by monoamine oxidase (MAO) would lead to depletion of GABA and production of nitric oxide (NO.) respectively, and thereby enhance CNS O2 toxicity. In this study, rats treated with an MAO inhibitor (pargyline) or a nitric oxide synthase inhibitor (LNNA) were protected against O2-induced convulsions. Selected cerebral amino acids including arginine were measured in control and O2 treated rats (6 ATA, 20 min) with or without drug pretreatment. After O2 exposure, the cerebral pools of glutamate, aspartate, and GABA decreased significantly while glutamine content increased relative to control (P < 0.05). After treatment with either enzyme inhibitor, glutamine, glutamate and aspartate concentrations were maintained near control levels. Remarkably, GABA depletion by O2 was not prevented despite protection from seizures by both pargyline and LNNA. The NO. precursor, arginine, was increased significantly in the brain by toxic O2 exposure, but both pargyline and LNNA inhibited this effect. Simultaneous norepinephrine measurements indicated that its storage substantially decreased during hyperoxia (P < 0.05), but this effect too was blocked by either pargyline or LNNA. These data indicate that protection against O2 by these inhibitors is not related to preservation of the GABA pool. More importantly, O2 dependent norepinephrine metabolism and NO. synthesis appear to be interactive during CNS O2 toxicity.

Digitalis toxicity: a fading but crucial complication to recognize. Digoxin usage has decreased in the treatment of congestive heart failure and atrial fibrillation as a result of its inferiority to beta-adrenergic inhibitors and agents that interfere with the deleterious effects of the activated renin-angiotensin-aldosterone system. As a result of reduction of usage and dosage, glycoside toxicity has become an uncommon occurrence but may be overlooked when it does occur. Older age, female sex, low lean body mass, and renal insufficiency contribute to higher serum levels and enhanced risk for toxicity. Arrhythmias suggesting digoxin toxicity led to its recognition in the case presented here.

Structural and chemical characterization of S-layers of selected strains of Bacillus stearothermophilus and Desulfotomaculum nigrificans. The structures, amino acid- and neutral sugar compositions of the crystalline surface layers (S-layers) of four selected strains each of Bacillus stearothermophilus and Desulfotomaculum nigrificans were compared. Among the four strains of each species a remarkable diversity in the molecular weights of the S-layer subunits and in the geometry and constants of the S-layer lattices was apparent. The crystalline arrays included hexagonal (p6), square (p4) and oblique (p2) lattices. In vitro self-assembly of isolated S-layer subunits (or S-layer fragments) led to the formation of flat sheets or open-ended cylindrical assembly products. The amino acid composition of the S-layers exhibited great similarities and was predominantly acidic. With the exception of the S-layers of two strains of B. stearothermophilus (where only traces of neutral sugars could be detected), all other S-layer proteins seemed to be glycosylated. Among these strains significant differences in the amount and composition of the glycan portions were found. Based on this diversity interesting questions may be asked about the biological significance of the carbohydrate units of glycoproteins in prokaryotic organisms.

[Palliation of urothelial carcinoma of the bladder]. Bladder cancer is a disease that occurs late in life (> 50% of the patients in Germany are 70 years or older). The general condition of the patients is frequently reduced, aggressive therapy of advanced tumours stages is therefore often contra-indicated. In this situation, palliative treatment is of extraordinary importance. Strangely enough, controlled prospective trials are lacking. They are, however, necessary in order to establish, or improve, standards of palliative treatment. Several smaller studies proved the potential of bladder irrigation and the embolisation of A. iliaca to stop bleeding from the tumourous bladder. If the tumour causes urinary retention, a permanent ureteral stent may in certain cases help to guarantee adequate flow. The assessment of palliative radiotherapy is not possible due to small numbers of (and highly selected) patients. It may have a potential in cases of hematuria, pain, and incontinence. New anti-tumour agents (e.g. Gemcitabine) may turn out to be a tolerable and effective palliative.

Is art therapy a reliable tool for rehabilitating people suffering from brain/mental diseases? Whether art therapy can be an effective rehabilitative treatment for people with brain or mental diseases (e.g., dementia, Alzheimer's disease, Parkinson's disease, autism, schizophrenia) is a long-standing and highly debated issue. On the one hand, several observational studies and anecdotal evidence enthusiastically support the effectiveness of arts-based therapy. On the other hand, few rigorous clinical investigations have been performed, and there is too little empirical evidence to allow a full assessment of the risks and benefits of this intervention. Nevertheless, there is a progressively increasing demand for the development of appropriate complementary therapies to improve the personal and social lives of patients with neurodegenerative diseases. This is because conventional medical treatments are aimed at alleviating symptoms but cannot arrest or reverse the degenerative process. Thus, as disease progresses and adverse effects emerge, patients' quality of life dramatically decreases; when this occurs patients seek different forms of intervention. Art therapy is a potentially appealing treatment because of its more holistic approach to healthcare. However, as with any medicine, its effects must be tested by using standard, rigorous scientific approaches. This report describes the current state of research into art therapy and outlines many key factors that future research should consider, all of which are directly or indirectly related to the neural mechanism underlying behavioral changes: brain plasticity. Artistic performance could promote some form of brain plasticity that, to some extent, might compensate for the brain damage caused by the disease.

About “Proseed, a Washington County native, began emceeing in ’98 at the age of 14, the year Gang Starr put out Moment of Truth and the year Black Star debuted. It could have been the magic of the late nineties, or the teenage need to rebel, but whatever the reason, Proseed started to live the life of a politically-charged, clear-headed lyricist. Proseed circa 2012 Though mostly known for his versatile songwriting and stage presence, Proseed is also an adept producer, making many of his own beats. Since his early beginnings, Proseed has performed at sold-out venues and has shared stages with Aesop Rock, Mr. Lif, Tech N9ne, Louis Logic & JJ Brown, Blueprint, Illogic, Qwel and Maker, Manchild of Mars ILL, Cee Know the Doodlebug of Digable Planets and more. Proseed has outlived many emcees and continues to provide raw talent to a scene that desperately needs it.”

It’s been quite the year for Chris Serban. After winning Canada West and CIS Rookie of the Year honours last November in his first season at UBC, the 19-year-old Vancouver Whitecaps Residency alumni was called into his first Canadian training camp the same month. After impressing as a sub against England and as a starter against Russia, Serban was named to Rob Gale’s squad for the CONCACAF U20 Championship in January, the qualifying tournament for this year’s FIFA U20 World Cup in New Zealand. The tournament may not have gone well for Canada, who finished fifth in their six team group, but on a personal level for Serban, it was a huge success, with the defender playing the full 90 minutes in all five of Canada’s matches. Fresh from representing his country, Serban returned to Vancouver and the Whitecaps, signing a USL contract with the ‘Caps in February for WFC2’s inaugural season. Helped by his ability to play both right and left back, Serban soon made an impact for WFC2 and became a pivotal member of the backline, making 16 appearances, all but three of them starts, before a flying elbow caused a season ending injury down in Portland in July. He’d played 1181 minutes in the USL, adding one goal and an assist. His injury and recuperation may have ruled him out of the rest of WFC2’s season, but it meant he was fresh to return to UBC for the CIS one. For as we revealed back in March, Serban is trying to make it in the pro game, while also continuing his education at UBC, where he is studying business. It makes for a lot of work both in the classroom and on the football pitch, but Serban’s handling it well and his game has seen the full benefit. “It was definitely tough at USL,” Serban admitted to AFTN after last Saturday’s Canada West Championship triumph. “It was training every day with quality players. It definitely helped develop my speed of play and it got me more confident playing in the CIS. “My first year I think I did okay, but I was lacking confidence compared to this year, where I feel comfortable and I know what it’s about. I have the experience as well, so it was definitely a lot of help improving speed of play.” Strange to hear a player who won both Conference and National Rookie of the Year honours describe his season as just “okay”, but that just shows what standards Serban sets himself and what he hopes to achieve in the game. He was a standout in his short spell with the Whitecaps U18s in 2014 and looked even better for the Thunderbirds last season, where he played for all but 16 minutes in UBC’s 11 regular season games, contributing two assists in the process. But since he’s been training and playing in the USL with WFC2, the further improvement in Serban’s game has been evident during his second year with the Thunderbirds, especially to UBC head coach Mike Mosher. “I think the biggest development that I’ve seen with Chris is his attacking abilities,” Mosher told AFTN. “What he can give us now, in that final third of the field, is his crossing of the ball is much better now than a year ago. His ability to penetrate inside on a dribble is better than it was a year ago. His ability to be on the ball, be it an overlap on the outside or coming in through the inside, is better than it was a year ago. “Those are probably, for me, the biggest advancements in his game. He’s always been very solid defensively and I think he’s improved there [too].” Serban recovered fairly quickly and returned to UBC in time for the start of the CIS season. So was that always going to be the plan? Or was the expectation that he would see out the full USL season with the ‘Caps before returning back to playing college soccer? “It was always somewhat the plan,” Serban told us. “We couldn’t have predicted the injury, but once it happened I was basically ruled out for the rest of the ‘Caps season anyways. Then it was good because that’s when the UBC season was starting, right when theirs was ending. So it was a good transition to come right back into it and not miss any games and be able to get good game time.” And that he did. Serban has made 13 appearances for the Thunderbirds this season, playing 1079 minutes. The development of his attacking abilities that Mosher referred to has been very evident, with the full back getting forward a lot more often. That’s resulted in two goals and two assists on the year, but Serban saved the most important for the last game of the Canada West season, scoring the Championship winning goal in extra time in Saturday’s 2-1 triumph over UVic Vikes. After running almost the full length of the pitch, Serban buried the ball past the Vikes keeper, capping off a whirlwind year for the young defender in some style with his first Championship. But he’s not finished there. “It feels amazing,” Serban told us. “It’s a dream come true to win it, but it’s not over yet. We want to push hard at nationals and obviously win a national title. That’s the main goal this year. This is just the first and the beginning of three games to come where we have to work hard and obviously win a championship.” Every player dreams of scoring the goal that wins his team the Championship. Serban is no different and he’s proved that dreams can come true! “Before every game I dream that I’m going to score,” he joked with us. “But usually as a defender it never happens. So it was quite something to be able to get it and it was a good fight too for my teammates to slip that ball in. I just saw the goalie and aimed for the corner and hoped for the best.” So a 16th Canada West title in the bag for UBC, but now the full attention is turned to this week’s CIS Nationals that get underway at York University in Toronto today. The undefeated Thunderbirds kick off their quest for a record 14th CIS crown against Toronto Varsity Blues and Serban feels that the tough test posed by the Vikes on Saturday will set the team in good stead for the challenges facing them out east this week. “Definitely,” Serban said. “[Victoria] definitely made us work for it. We were down 1-0 first half. We knew we needed to come back. Got a quick goal, luckily, then it was all about tough work. “My team-mates just worked hard the whole game and now we can fly out to Toronto happy and with the world of confidence and hopefully we’ll be able to do well at nationals.” So with all that he’s achieve this past year, what would winning his first national title in Toronto this week mean to Serban? “It would be amazing,” Serban said with an instant smile at the thought. “It’s tough to come by trophies. It’s so much competition for any trophy, so that’s our main goal. From the start of playing with UBC, that’s what I wanted to do. I wanted to win nationals. That’s been the main goal and now my focus is there and it’s going to mean everything if we win it. To me and to the rest of the guys.” Sunday’s final is also Serban’s 20th birthday, if you need any omens. Confidence is high in the Thunderbirds camp but they know they’ll have to do it the hard way, with a semi-final against defending champions and top seeds, York Lions, looking set for Saturday. However this week pans out for Serban and the Thunderbirds, the future is looking very bright for the full back, who earned Canada West All-Team honours last week. Serban will return to WFC2’s preseason camp shortly, ahead of the 2016 USL season. The young defender is certainly turning heads and looks to be a great prospect for the Whitecaps. And as far as Coach Mosher is concerned, he sees a bright future for him in the game. “Who knows how far this kid could go,” Mosher told us. “At every level he goes to, he does well. He did well with the [Canadian] U20s, he’s done well with the USL team. Great kid. Super attitude. Intelligent. Those are pretty darn good prerequisites. “I think for him, it’s to progress at that USL level and if he can keep developing there, maybe there’s opportunities beyond that. That’s probably for him the next step. To become a real solid pro at that level and see where he goes.” It will certainly be an interesting journey to watch and hopefully it will be in a blue and white Whitecaps strip.

349 So.2d 672 (1977) Violet JANES, As the Personal Representative and Administratrix of the Estate of Julia McFarland, Deceased, Appellant, v. BAPTIST HOSPITAL OF MIAMI, INC., and Travelers Insurance Company, Appellees. No. 76-1563. District Court of Appeal of Florida, Third District. August 9, 1977. Rehearing Denied September 13, 1977. *673 Mark J. Feldman, Miami, for appellant. Adams, George, Schulte & Ward and Amy Shields Levine, Miami, for appellees. Before BARKDULL, HAVERFIELD and NATHAN, JJ. PER CURIAM. This an appeal by the plaintiff, Violet Janes, as personal representative and administratrix of the estate of Julia McFarland, deceased, from an order denying motion for new trial, in an action for negligence against Baptist Hospital of Miami, Inc., and Travelers Insurance Company, its insurer. A jury trial was held. The jury rendered a verdict in favor of the plaintiff in the amount of $1,500.00, judgment was entered thereon, plaintiff's motion for new trial was denied and this appeal ensued. Plaintiff contends that the trial court erred in refusing to admit into evidence certain hospital and doctor bills for services rendered to the deceased, for the reason that they had been paid, in substantial portion, by the deceased's Medicare. We agree and reverse. Florida follows the collateral source rule which stands for the proposition that total or partial compensation received by the injured party from a collateral source wholly independent of the wrongdoer will not operate to lessen the damages recoverable from the person causing the injury. See Finley P. Smith, Inc. v. Schectman, 132 So.2d 460 (Fla.2d DCA 1961); Paradis v. Thomas, 150 So.2d 457 (Fla.2d DCA 1963); Greyhound Corporation v. Ford, 157 So.2d 427 (Fla.2d DCA 1963); Walker v. Hilliard, 329 So.2d 44 (Fla.1st DCA 1976). As stated in Walker v. Hilliard, supra, it is well settled that recovery of damages from a tort feasor may not be reduced by the amount of insurance proceeds received by the injured party from his insurance company; a wrongdoer should not be permitted to benefit from a policy of insurance where there is no privity between him and the plaintiff's insurer, and the policy was written for the benefit of the insured and not the wrongdoer; if there must be a windfall, it is more just that the injured party profit, rather than the wrongdoer be relieved of full responsibility for his wrongdoing. The value of services rendered the injured party are a proper element of damages even though they were paid for by a collateral source. Paradis v. Thomas, supra. Based on the foregoing, we hold that the court erred in refusing to admit the bills into evidence so that the jury could take them into consideration in making a determination of plaintiff's damages. This does not, in any way, affect the entitlement of the collateral source, in this case Medicare, to recover such sums paid to, or on behalf of the plaintiff either by way of lien, intervention or otherwise. In light of the reversal on the foregoing point, the other point on appeal will not be discussed in this opinion. Reversed and remanded for a new trial.

Brotherton Brewing Company Brotherton Brewing Company is a craft beer brewery located in Shamong, New Jersey. At Brotherton Brewing Company, it started out as a dream for five lifelong friends to someday open a craft brewery. To push the boundaries of craft beer style and flavor. And to create some of the best tasting and most exciting beers for everyone to enjoy. After many years of planning, paperwork construction and just plain jumping through hoops, that dream is now a reality. Counties Philadelphia Chester Bucks Berks Montgomery Delaware Learn More About Brotherton Brewing Company And Their Beers By Visiting Their Website.

Q: Android: Incrementing an integer causes an allocation The following line appears in the allocations pane of eclipse: Alloc Order Allocation Size Allocated Class 509 12 java.lang.Integer It references this line of java code: MyInteger++; I changed it around a little bit, but it still causes an allocation. MyInteger=MyInteger+1; MyInteger=MyInteger+MyIntegerIncrementor; Why do these lines of code cause an allocation? A: Since Integer is immutable, each time you increment it a new object is created, hence the allocation.

Fiancee Shitai Manga 1) I Want to Be a Fiancée (Fiancée Shitai). (There are 5 chapters to this story). Yukimi is a high school junior and cheerleader already scheduled for her first marriage interview. She's seen a disappointing picture of her nerdy potential groom - and he has such a weird name - so Yukimi has every intention of rejecting him, but she's still curious to go and see what a marriage interview is like. Later that day, Yukimi meets her ideal man at a football match and inadvertantly begins cheering only for him -- despite the fact that he's the opposing team's quarterback! He gives her a bold and seductive response. Ah, if only Yukimi's marriage interview could be with a guy like this... But why won't the sexy quarterback tell Yukimi his name...? 2) My Darling in the Infirmary Room (Hoken Shitsu no My Darling) Maki doesn't mind a few cuts and bruises if it'll earn her a ticket to the campus infirmary room. That's because her school's doctor is handsome Takashiro, age 23, single. She works so hard to make passes at him - and Takashiro knows it. But is Maki really so busy trying to catch his attention that she doesn't notice...? Related Manga 1) Let's Make Love!! (Make Love Shiyo!!). (v01 ch1 to 6) Mari Nishimiya is a high school junior who's tired of playing it safe. Less concerned with her summer session and more with achieving the love of a lifetime, she ventures... All Kumiko wants is to become a teacher; however her father is dead set against it. He is giving her one chance to prove herself as a teacher before forbidding her from pursuing this career forever. Meet her newest student, Ryu-kun.... The summer of a seventeen-year-old girl. Since her female friends backed out at the last minute, Mai ends up going on a trip with 3 boys. What's more, it is her first time meeting them!! This... this might be...!? Miu Sakurai, age 15, attends a Catholic school where she prays every day for her admired Shion Amamiya to return her love. When that doesn't work, she places her faith in a book of magic and tries casting one of its spells. However,... This is the first Shinjo Mayu anthology in the set of 3 titled Mayu-tan no Tokimeki Note #1. 1-3) Embrace Me in TABOO (TABOO ni Daite Asou) Yayoi is a high school freshman. Her parents died when she was very little, and so now she lives...

Matthew Prior A Flower. Painted By Simon Varelst - Poem by Matthew Prior Autoplay next video When famed Varelst this little wonder drew,Flora vouchsafed the growing works to view;Finding the painter's science at a stand,The goddess snatch'd the pencil from his hand,And finishing the piece, she smiling said,Behold one work of mine that ne'er shall fade.

Q: When do I use V for Ü in Pinyin programs I use a program called Sougou, which is very poopular in China I think. Sometimes I use the Microsoft pinyin language option. Sougou is very good at guessing my characters based on context, but sometimes I have to click through to find my character, especially when it's character with ü it seems. Is there a standard rule here? Should ü always be replaced with v in pinyin programs? What about after the J, Q, X and Y letters where ü is always implied, should I be hitting V or U on my keyboard? Sorry for the simplistic question, I wish I could understand the sougou documentation, but it's still "chinese" to me. Thank you. A: In the past (e.g. 80's to 90's), when the Chinese IME did not implement fuzzy logic, the rule was you should use v for and only for ü as you would write on paper. For example for J you should type ju not jv. Now all the mainstream Chinese IME (MSPY, Sogou, Google Pinyin, etc.) has fuzzy logic built-in and enabled by default. This question isn't much relevant anymore.

[Updated: Confirmed] Final Fantasy XV Delayed To November 29th In All Regions, According To Multiple Sources [Update] According to Kotaku’s news editor, Jason Schreier, Final Fantasy XV will indeed be delayed to November 29th. Schreier took to Twitter to share that another non-retail source has confirmed that the delay is real. [Original story] Earlier this year, Square Enix revealed during a special event that the highly anticipated role playing game Final Fantasy XV is going to be released on September 30th, after quite a long development time. Unfortunately, there’s the chance that the wait is going to be slightly longer than anticipated. According to Gamnesia, Final Fantasy XV is going to be released on November 29th and not next month, as announced back in March. The website has learned about this delay thanks to a source within GameStop management, who revealed that promotional material with the new date arrived in GameStop stores recently, and must not be put up until August 14th, when the delay is most likely going to be announced. While there’s no way to know right know if this information is legit, this source has correctly revealed previously unknown information, so there’s a good chance that Final Fantasy XV has indeed been delayed. Additionally Gematsu, who has correctly leaked the September 30th release date earlier this year, recently reported that one of their sources confirmed that Gamnesia report is correct. Earlier this week, some of the Famitsu articles focused on Final Fantasy XV’s Luminous Studio engine have been translated in English by a dedicated fan. The two articles focus on Advanced Illumnation techniques and Character Expression, and they are a very interesting read even for those who aren’t into the more technical elements of video games. Two weeks ago, some additional details on Final Fantasy XV summons have emerged online thanks to a showcase video. Judging from one of the debug menus seen during the video, the game will include at least 7 summons, with the classic Final Fantasy summon Shiva being among them. Final Fantasy XV launches in September 30th in all regions on PlayStation 4 and Xbox One. We will let you know about the game’s delay as soon as more comes in on it, so stay tuned for all the latest news.