Datasets:

health360
/

Healix-Shot

Dataset card Viewer Files Files and versions Community

Split (1)

train · 10.8M rows

text stringlengths 4.16k 144k
natural MoMuLV env gene with the gibbon ape leukemia virus (GALV) env gene. In small-scale pilot experiments, TE671 cells simultaneously infected with the three Ad vectors efficiently released helper-free retroviral particles at titers of up to 5 X 10^ iu/mL for at least 3 days following infection [67], The further separation of the key retroviral elements facilitated the indi vidual characterization of each retroviral function in terms of variable copy load on complementing retroviral cell lines. The results helped to shed light on the factors currently limiting retroviral vector production and allowed an investigation of particular cell type-specific features of the producer cells. The availability of packageable RNAs of the retroviral genome itself was not found to be rate limiting, with Ad-mediated overexpression resulting in increasing, nonsaturatable retroviral titers [67]. The results indicated that high expression of Gag-Pol and Env proteins through the introduction of high copy numbers of their genes was not required to achieve an efficient retroviral production and that there is probably a limit to the number of particles that a given cell may release. Increased GALV env copy number resulted in augmented glycoprotein synthesis, with RV particle production plateauing between m.o.i.s of 10 and 50. At higher m.o.i.s titers decreased, possibly by a break of tolerance by the cell to efficient RV particle assembly or budding. It was observed that Pr65 gag precursor expression saturated with Ad-gag/pol m.o.i.s of greater than 5 [67]. At higher titers, premature maturation of Pr65 transcripts became apparent, which normally occurs at maturation of the retroviral particles [73]. However, despite these observations, reported titers were equivalent to those generated on high titer-generating stable packaging cells [67]. A detailed analysis of the release of noninfectious/incorrectly processed budding particles may be of interest. Additionally, despite the expression of similar levels of Gag precur sors and premature forms, a wide variability was observed in the capacity of different cell types examined to assemble and release retroviral particles [67]. In the context of the hybrid adenoviral/retroviral vector system, when applied at optimal m.o.i.s, a critical limiting factor for the production of retrovirus is the ability to avoid premature activation and convert the bulk of Gag and Gag-Pol precursors in nascent viral infectious particles [67]. Despite the high copy number of all three retroviral units introduced into cells, no RCR could be detected. These Ad/RV hybrid vector studies go some way in aiding the elu cidation of the limiting factors involved in retroviral production in packaging cell lines and they indicate that the careful selection of packaging cell type is crucial. This observation is highly significant to therapeutic applications of the 17. Hybrid Adenoviral Vectors 5 0 1 hybrid vector system where different tissues of the body will be more suited to RV complementation than others. The hybrid Ad/RV system can also facilitate the rapid screening of various primate cells for their retroviral production potentials and allows simple substitution/pseudotyping of components in the system. 1. Tetracycline-Inducible Env Pseudotyping of Ad/RV Hybrid Vectors Pseudotyping the VSV-G retroviral envelope in the MoMuLV back bone, as discussed earlier, enhances the stability and tropism of the native virus [31]. This enhanced stability enables higher titer preparation to be prepared by centrifugation. Generating Ad vectors expressing the VSV-G envelope glycoprotein has, however, proven technically difficult due to the cytotoxic nature of the protein product. Yang and colleagues demonstrated that the VSV-G gene could be effectively controlled under the tetracycline inducible system [74] in packaging cell lines obtaining unconcentrated titers of 10^ to 10^ iu/mL [75], Yoshida and colleagues extended these studies by applying the tetracycline-inducible system in the context of an Ad vector [76]. Ad vectors were generated carrying VSV-G and MoMuLV gag/pol genes, both under the control of the tetracycline-controllable promoter. Hence, only upon the supply of doxycycline (a tetracycline homolog) efficient expression would proceed from the gag, pol, and env genes. Minimum "leaky" expression of cytotoxic VSV-G under the control of the inducible promoter remained low enough to allow Ad propagation to titers of 4 x 10^ pfu/mL. The drawback of this system is the necessity to provide a further Ad construct containing the tetracycline transcriptional regulator (Ad-rtTA), expanding the system to a four-adenovirus transduction strategy, together with Ad-TetGag/Pol, Ad- TetEnv, and the Ad/RV vector expressing neomycin resistance. Application of the four viruses in vitro generated retroviral transgene titers of up to 5 X 10^ iu/mL, which were further purified to titers of >10^ iu/mL following simple centrifuge concentration of the virus from culture fluids at 50-80% recovery efficiency [76]. Caplen and colleagues extended these studies in two tumor model systems in vivo by subcutaneous injection of 9L glioma tumors in rat or human A735 melanoma xenografts in nude mice [77]. Only upon application of all four viruses in the 9L rat model were neomycin-resistant cell cultures established from harvested tumor tissues. Molecular analysis of genomic DNA extracted from neomycin expressing 9L rat cultures, derived both in vitro and in vivo, showed the appropriate integration of the retroviral transgene cassette [77]. The human-xenograft nude mouse model system meant that Ad was not cleared in the time frame examined (4 weeks); hence efficacy was assessed as increases in G418R cells compared to single-hybrid Ad/RV-vector transgene transduction [77]. In the human-xenograft mouse model system, tumors har vested at 1, 3, and 4 weeks posttransduction displayed increased numbers 5 0 2 Murphy and Vile of neomycin-resistant colonies with time only upon transduction of the full complement of adeno-retroviral constructs. At 4 weeks, up to 7.2% of xenografted cells were retrovirally transduced. Transduction of tumors with Ad/RV vector alone yielded no increase in the number of neomycin-resistant clones. DNA extracted from the xenograft tumors, as for the rat model, only showed the presence of integrated proviral sequences when transduced with the full complement of adeno-retroviruses. Titers of retrovirus particles generated from the 9L rat glioma cells in vitro were dependent on the input m.o.i. of the adenoviruses, with maximum titers of up to 1 X 10^ iu/mL generated at m.o.i.s in the range of 200-300 for each virus [77]. Under these optimal conditions the presence of doxycycline (1 \|JiM) enhanced the titers by a factor of 2000-fold [77]. Interestingly, in vivo similar numbers of clones were observed after the four-adenovirus transduction strat egy in the presence or absence of doxycycline: 30 and 20 colonies per 10^ cells plated. Less than one colony per 10^ plated cells was observed with the Ad/RV vector alone. These low transduction titers do, however, indicate the current inefficiencies of the system, which are reduced compared to other reports [72]. But the inefficiencies can to some extent be explained by the application of four separate Ad vectors for the system to function, significantly increasing the kinetic complexity of the generation of retroviral vector producer cells in vivo. Additionally, the poor efficiency of transduction of the rodent cells by Ad is emphasized by the required m.oi.s applied (>200) to generate optimum titers [77]. 2. Cooperative Adenoviral/Retroviral Vector Delivery Other mechanisms of combining the advantageous properties of ade noviral and retroviral vectors have involved combinatory application of the separate vectors. Delivery of the retroviral genome in the context of a retroviral particle (RV vector) coinfected with an adenovirus expressing the gag, pol, and env genes (Ad-gag/pol/env) has been reported [78]. Coinfection of the vectors into NIH 3T3 cells generated retroviral titers >10^ iu/mL. The advantages of this system over the hybrid Ad/RV-vector delivery of the transgene cassette are questionable, specifically from a cell-targeting aspect. Several groups have also recently demonstrated stable ecotropic retrovirus-mediated gene transduction of human cells using preinfection of Ad or AAV vectors expressing an ecotropic receptor [79-81]. In order to target retroviruses specifically to malignant hepatic tissues, an adenovirus expressing the ecotropic receptor under the control of a hepatoma-specific promoter [82, 83] was constructed. Although tissue-specific expression of the retroviral ecotropic receptor and subsequent tissue-specific targeting of ecotropic enveloped retroviral vectors was demonstrated in vitro [84], the clinical benefits of this system are limited. In essence, direct application of the tissue-specific promoter to expression of a therapeutic transgene in the adenoviral vector would be more beneficial. 17. Hybrid Adenoviral Vectors 5 0 3 3. Nonspecific Integration of RV LTR Cassettes in the Context of Ad Vectors? The studies presented above all emphasize the requirement of all the gag/pol and env components to derive stable integration of a RV LTR- flanked transgene cassette. However, a controversial report printed in Nature Biotechnology challenged that doctrine. Zheng and colleagues reported that an RV LTR-flanked cassette contained in an Ad vector (Ad/RV-vector) could integrate efficiently in the absence of the retroviral enzymatic proteins [85]. The group studied a conventional MoMuLV LTR-flanked luciferase reporter gene cloned in the El-deleted region of a first-generation Ad vector (AdLTR-Luc), analogous to previous hybrid Ad/RV-vectors. A variety of cells and tissues permissive to Ad infection (epithelial cells, macrophages, and hippocampal cells) were transduced in vitro and in vivo by the hybrid AdLTR-Luc, and compared with transduction by AdCMV-Luc, a vector containing the CMV promoter in place of the LTRs. The AdLTR-Luc vector was demonstrated to direct sustained luciferase expression compared to the CMV promoter-driven vector. Despite probable well-documented CMV promoter inactivation events, the authors present evidence for stable integration of the LTR-Luc cassette at sites within the LTR elements by a mechanism independent of classical retroviral integration. Fluorescence in situ hybridization (FISH) analysis using probes for the 5' LTR and the luciferase gene revealed integration of the AdLTR-Luc vector with an apparent frequency of 10-15% in vitro and 5% in vivo. Southern blot analysis also implied integration of the 5' LTR of the hybrid vector, which was subsequently supported by sequencing of the region adjacent to the 5' LTR integration site. No integration of the AdCMV-Luc was reported. The frequency of spontaneous Ad integration has previously been reported at much lower frequencies (10~^ to 10~^) [86], suggesting the presence of the retroviral LTR elements in the AdLTR-Luc somehow potentiates integration. The major question is whether an endogenous retrovirus is present in these cells; however, the authors reported negative results for reverse transcriptase activity. Additionally, the integration events reported are not classic retroviral integration as integration does not proceed at a conserved terminal position and results in the random loss of substantial terminal LTR sequence. In vivo studies involved injection of rat submandibular glands by retrograde ductal instillation of 1 x 10^ pfu/gland. After initial high luciferase expression, the levels plunged to near zero for AdCMV-Luc after 9 weeks but stabilized with AdLTR-Luc after 2 weeks, although at significantly reduced levels. Although these findings are consistent with low-level integration of the LTR cassette, no specific mechanism of integration has been proposed and alternative inter pretations of nonspecific LTR-independent mechanisms are probable. As no drug selection gene was present in the vectors, clonal populations were derived on the basis of sustained luciferase expression. Hence, considering first the 5 0 4 Murphy and Vile well-documented in situ inactivation of CMV promoters, specifically in the context of integration, luciferase expression would be absent in long-term cul tures transduced with AdCMV-Luc. Therefore, the studies with AdLTR-Luc may have inadvertently selected for random integration events within the 5' LTR that maintained luciferase expression. The probability of such an event is fairly significant considering the limited extent of genetic material upstream of the LTR cassette in the Ad vector (ITR and \\|;). Additionally, with the high m.o.i.s applied, selection of high copy number-transduced cells is highly prob able, under which conditions spontaneous integration of the Ad vector is more probable. The sequencing data presented also demonstrate integration occur ring at sites within the U3 region of the 5' LTR for several clones that would ablate LTR promoter activity. The selection of these luciferase-expressing cells would more probably be due to multiple integration events, which were clearly demonstrated by FISH analysis [85], rather than integration site promoter effects. Integrated proviral sequences were not reported in animals that received the Ad/RV vectors alone in other similar studies [72, 77]. However these reports were looking specifically for retrovirus-mediated integration events and not the proposed alternative mechanisms reported by Zheng and colleagues [85]. The report by Caplen and colleagues [77] investigated the integration event based on the retroviral mechanism of reproducing the 3' LTR sequences to the 5' LTR structures [1]. The specific duplication of a
nucleotide restriction site upon retroviral replication was used as a marker of integration in Southern blot analyses. Analysis of a pooled population of neomycin-resistant colonies revealed efficient band size switching, indicative of the duplication event, and thus retroviral replication. However, consistent with the observation of Zheng [85], randomly integrated Ad-RV transgene cassette fragments could be seen in context of generalized hybridization of the probe to high-molecular- weight DNA from single-vector-transduced animals [77]. These bands were, however, weak and consistent with random integration. Further studies are therefore merited to evaluate the efficacy of integration of LTR-flanked cassettes in the context of an Ad vector to determine whether a specific mechanism does exist and whether it could be further refined for vector use. 4. Integration of Closed Circle Retroviral Cassettes Delivered by Adenoviral Vectors Following retroviral infection, reverse transcribed proviral DNA serves as a substrate for an integration reaction catalyzed by the retroviral integrase (Int) protein, which, along with viral Gag proteins, forms the preintegration complex [87]. This complex brings the 5' end of the 5' LTR (the U3 region) into close juxtaposition with the 3' end of the 3' LTR (the U5 region) [87]. The direct substrate for Int is most likely a linear, double-stranded molecule with blunt ends [88]. Int-mediated integration then occurs by a very precise mechanism 1 7 . H y b r i d A d e n o v i r a l Vectors 505 in which the terminal two base pairs of each LTR are lost prior to integration into the target cell genome [87, 89]. However, closed circular molecules have also been detected in the nuclei of retrovirally infected cells, which contain 2 LTRs joined covalently together at the so-called circle junction [87,90, 91]. Although there is considerable evidence that MoMuLV probably does not use a 2-LTR circle as the principal integration intermediate [S7^ 89, 92], it was hypothesized that it may still be possible for Int to use such a molecule as a template for integration if it were the only, or predominant, species delivered into the nucleus [87]. This hypothesis is supported by the existence of the 2-LTR circles in MoMuLV-infected cells [90] and evidence from the spleen necrosis virus (SNV) system that the LTR junction fragment can be an effective substrate for integration [91]. We investigated whether a 5' LTR-3 ' LTR junction fragment, in a closed circular DNA molecule excised from an incoming plasmid by Cre recombinase and in the absence of the preferred, linear viral DNA molecules, could be recognized by the retroviral integration machinery (Fig. 3). A fused LTR LTR Junction ITR 4 ^ ! ITR LoxP LoxP \ / Cre \ / Recombinase. \ / Genomic DNA Figure 3 Genomic integration of on adenovirolly delivered retroviral circular provirus cassette. A LoxP-flanked cassette containing a fused terminal LTR junction and transgenes of interest was inserted into an adenoviral vector. Upon infection of cells expressing Cre recombinase, this cassette is efficiently excised as a closed circular molecule. The fused LTR junction contained in this circular proviral molecule is subsequently recognized by retroviral Integrase, directing integration into the host chromosome. 5 0 6 Murphy and Vile junction fragment was thus cloned, containing the entire 3' LTR and just 28 bp of the U3 region of the 5' LTR (Fig. 4A). This LTR junction together with the puromycin resistance gene was flanked by LoxP sites and was demonstrated to efficiently excise a circular proviral intermediate in vitro upon supply of Cre recombinase in trans [93]. Further studies in cell lines ^m^s-complementing gag/pol gene functions, together with Cre recombinase, generated long-term neomycin-resistant clones. Genomic DNA extracted from stable clones was used to investigate the proviral integration structures by utilizing a panel of diagnostic PCR primers. The PCR demonstrated that integration following plasmid transfection, Cre excision, and puromycin selection for >1 month can produce a very specific molecular structure which is distinct from that produced by random plasmid integration. PCR results demonstrated that the 5' and 3' LTRs, which are adjoining in the plasmid backbone, become separated by the intervening sequences of the retroviral vector genome (between the loxP sites). A molecule is thus generated in which the proviral genome is now bounded by the LTRs in a manner typical of Int-mediated integration (Fig. 3). Critically, the terminal two base pairs of both the 5' LTR (U3 region) and the 3' LTR (US region) were lost (Fig. 4B). Hence these studies confirm that a circular retroviral genome with terminally fused LTR structures can indeed serve as a substrate for the retroviral machinery. From this initial proof of concept, the LoxP cassette was subsequently assembled into an El-deleted Ad vector. The Ad virus is used to deliver the LTR junction fragment into the nuclei of cells; the proviral-like intermediate can then be excised from the Ad genome by the Cre/lox system and forms a template for Int-mediated integration. This hybrid Ad/RV system thus has the high transient titer of Ad vectors, does not depend upon cell division for infection, and leads to long-term gene expression via integration of a proviral transgene cassette. Delivery of the Lox-Puro-Junc.-Lox cassette in an Ad vector, in the presence of Cre and Gag and Pol allowed cloning of cells which are resistant to puromycin for long periods in culture. Without Cre, such clones were impossible to obtain. Moreover, these clones contain a molecular structure consistent with proviral integration by PCR and contain integration sites which, for the majority of the clones (seven of nine), are typical of Int- mediated, rather than random, integration processes (Fig. 4B). Codelivery of three separate Ad vectors, Ad-Gag/Pol, Ad-Cre, and Ad.LTR.Junc, was also able to produce long-term integrants. Therefore, we are currently optimizing the design and use of this novel hybrid vector system into a single, or double. Ad delivery system. Recent experiments have shown that Pol-expressed Int alone is sufficient to drive the integration of the Cre-excised proviral form in vitro without the need for additional Pol or Gag proteins. An Ad vector was thus cloned incorporating the Int gene in the same cassette as the transgene cassette to enable a two-vector transduction strategy, which is currently under investigation in our laboratory. This novel hybrid vector system presents great 17. Hybrid Adenoviral Vectors 507 3'LTR fi;'l.TR ^ U3»R»U5 1 1 U3-R»U5 TTCATT AATGAA " " - • > < — CCCGTCAGCGGGGGTCTTTCATTAATGAAAGACCCCACCTGTAGGTT 3'LTM 5'LTR 1 •U3"R>»U5 1 dlJi " • " " t 28bp ^ LTR FUSION JUNCTION Clone 1 CCi:ACAGGTGGGGTCriTCA GmCTTCM£mG Clone 2 CCTACAGGTGGGGTCTTFCACMiCZGfiMffilMIOTMIM^ Clone 3 CCTACAGGTGGGGTCTTTCA (MMMMMMMMMMMIG. CCTACA(XJTGGGGTCTTTCA2IXXMMXiCCM,III^^ Clone 4 C(jrACAGGTGGG(ITCrrrCA(KJGC(MIG€m€a Clone 5 CCTACAGGTGGGGTCTTTCA MJmTfCMIGTMMM^IlIIiMC Clone 6 CCTACAGilTGGGGTCITTCA CTA(E1I:MICCCAT(^ Clone 7 CCTACAGGTGGGGTCTTTCATTAATGAAAGACCCCCGCTGACGGGTAGT licit sec\|iieiicecl Into genomic segment Clones TCATTAATGAAAGACCCCCGCTGACGGGTAGT/ICTGrGCCXTG B Figure 4 Sequencing of the integration junctions of the circular RV proviral cassette. (A) Schematic representation of the RV genome conformation in the noncovalently linked circular preintegration complex and the subsequently cloned fused LTR junction. (B) A human cell line expressing the retroviral gag/pol genes and Cre recombinase (TelCre) were infected with the Ad/RV hybrid vector expressing puromycin resistance. Colonies were selected which had stably integrated the RV proviral cassettes and the genomic DNA was extracted. The integration junctions were subsequently cloned by PCR amplification of religated restriction-digested fragments containing the integration site [93], which were subsequently sequenced through the integration site. 5 0 8 Murphy and Vile potential in enabling the stable transduction of all cells primarily infected by the Ad vectors. C. Adenoviral/Epstein-Barr Virus Hybrid Vectors An alternative application of the Cre/LoxP recombinase system of excis ing a circular proviral molecule from an Ad vector [93] has replaced the retroviral component w îth the genetic stability of the EBV replicon system [94, 95]. This hybrid Ad/EBV vector system utilizes Ad-mediated nuclear delivery of a Cre-excisable EBV replicon w^hich can be stably maintained as an EBV episome [96]. EBV episomes contain the EBV latent origin of replication (Orip) and the EBV nuclear antigen-1 (EBNA-1) which acts on Orip, driving episomal replication (Fig. 5A). Previous studies have demonstrated that EBV nuclear episomes are stably maintained through multiple cell divisions in primate and canine cells, replicating once during S phase and segregating to both daugh ter cells w îth approximately 95% efficiency [97]. Tan and colleagues flanked Orip and EBNA-1, together w îth the puromycin resistance gene, v^ith LoxP sites and cloned them into an El-deleted Ad vector [94]. How^ever, multiple attempts to make an adenovirus failed due to suspected inhibition of Ad replication upon binding of ENBA-1 to Orip. Hence a vector was assembled which only brought EBNA-1 upstream of its promoter following Cre excision of the proviral cassette (Fig. 5B), thus silencing its expression in the absence of Cre recombinase [94]. The resultant Ad/EBV hybrid vector stably transformed 37% of surviving canine D-17 cells to puromycin resistance following coinfec- tion with AdCre. The circular EBV replicons were maintained in daughter cells for 14 weeks, ^110 cell generations. Surprisingly, the puromycin resistance gene was also discovered in an integrated form, in the cellular chromosomal DNA [94]. Integration of EBV episomes has not been reported previously in human cells, although a differential function in the canine cells might be involved. One major limitation of the hybrid system was, however, that a large cell fatality was observed upon transduction with the Ad vector into the D-17 cells at the optimum transduction conditions (m.o.i. 30). This was discussed by the authors as a function of leaky Ad gene expression from the first-generation vector in the canine cells and not related to EBNA-1 toxicity [94]. Reports have previously shown that EBNA-1 does not elicit a cytotoxic T-cell response, due to the presence of a series of glycine-alanine repeats [98]. These repeats act in cis to prevent MFIC class I presentation by inhibiting antigen processing by the ubiquitous processing pathway [98]. A very similar Ad/EBV replicon vector has also been described in the context of an E4-deleted, second-generation Ad vector [99]. Coinfection of human cells with this vector, together with AdCre (also E4-deleted), resulted in efficient delivery and excision of the replicon in the absence of vector-induced toxicity. The replicons were maintained following successive cell divisions both 17. Hybrid Adenoviral Vectors 509 EBNA-1 OriP ^^^^^^Hs^§mKm. ITR LoxP Cre \ Recombinase. \ OriP Figure 5 Episomal replication and maintenance of a Cre-excised EBV replicon from an adenoviral vector. (A) A LoxP-flanked cassette containing the EBV origin of replication (Orip) nuclear antigen (EBNA-1) and transgenes of interest was inserted into an adenoviral vector. Upon infection of cells expressing Cre recombinase, this cassette is efficiently excised as a closed circular molecule. Upon action of EBNA-1 on Orip, the circular cassette is efficiently replicated by the rolling circle mechanism, facilitating maintenance of the cassette in the infected cells. (B) In order to control the expression of the EBNA-1 genes, the promoter and gene are separated in the adenoviral cassette and become productively in line in the excised replicon form only following Cre-mediated excision. (C) By inserting the left LoxP site between the Ad LTR and ^ , leaky excision of Cre recombinase and subsequent premature excision of the LoxP cassette would render the resulting Ad vector nonpackageable due to elimination of ^ . This strategy eliminates contamination of the excised adenoviral form upon propagation of the hybrid Ad/EBV vector. 510 Murphy and Vile EBNA-1 Promoter ^^ ^̂ ^ - • • 5^—• No Expression of Gene. rm¥ lITR LoxP OriP LoxP Cre Recombinase EBNA-1 Gene Expression i Episomal B Replication OriP Figure 5 {continued) in vitro and in vivo^ suggesting efficient extrachromosomal replication as well as nuclear retention of the episome. The residual Ad backbones were, however, progressively lost by a dilution mechanism occurring in the absence of DNA replication [99]. As for all gene therapy vector systems, incorporation of all the compo nents into a single vector would simplify delivery and therapeutic efficacy. As for the previously described Cre-excisable RV provirus strategy [93], combina tion of the vector elements for the Ad/EBV has its limitations. Any expression of Cre recombinase would result in premature excision of the EBV replicon, specif ically upon initial Ad propagation. Wang and colleagues, however, enabled incorporation of all the components into a gutless helper-dependent (HD) Ad vector by use of a tissue-specific promoter to control Cre expression [100]. 17. Hybrid Adenoviral Vectors 5 1 1 Placing Cre under the control of a synthetic
promoter (HCR12), consisting of hepatic locus control elements from the human ApoE/C locus fused to the first intron of the human EFla gene, allowed adequate suppression of expression in 293 cells while permitting recombination and subsequent gene expression in the target tissue. However, promoter activity was not completely extinguished in all nonhepatic cells. In order to limit the effects of leaky Cre excision of the LoxP cassette, the Ad packaging signal was included in the excisable cassette (Fig. 5C). The placing of a LoxP site between the LTR and \\|; has been demonstrated not to inhibit Ad expression extensively [13]. Thus leaky excision would remove \\|/ from the Ad vector backbone, rendering the Ad genome nonpackageable and hence preventing contamination in the final viral stocks. Additionally, removal of \\|/ from the cassette also eliminates the El enhancer elements, which are interlinked with the packaging elements, which have been reported to additionally limit leaky viral expression events from the adenoviral tripartite leader sequence (TPL) [100]. D. Hybrid Retroviruses Trafficking to the Nucleus While previously described strategies have focused on combining the advantageous properties of retroviruses into adenoviral vectors, research has also investigated the reverse scenario. An interesting study by Lieber and col leagues investigated the potential of inserting the nuclear localization functions of an adenovirus into a retrovirus [101]. The failure of MoMuLV to cross the nuclear membrane in the absence of cell division has limited retroviral vectors. Large proteins or complexes (>40-60 kDa), such as the retroviral preinte- gration complex, are too large to pass into the nuclear membrane by simple diffusion and require nuclear localization signals (NLSs). NLSs interact with cytoplasmic receptors initiating an energy-dependent multistep translocation into the nucleus. The efficient nuclear targeting properties of Ad vectors have made them ideal gene delivery vehicles. It is generally believed that NLSs in the preterminal protein (pTP) and the core protein V play a crucial role in directing the Ad genome complex to the nucleus. The Ad pTP binds alone or in a complex with the Ad polymerase to specific sequences at the termini of the adenoviral ITRs. Lieber and colleagues-investigated whether coexpression of pTP with retroviral DNA carrying pTP-binding sites would facilitate nuclear import of the preintegration complex and transduction of quiescent cells. Pre liminary experiments demonstrated successful nuclear import of plasmid DNA via the karyotypic pTP (in the presence or absence of Ad polymerase) into the nuclei of growth-arrested cells [101]. The pTP binding motif was initially established by engineering two head- to-head adenoviral ITRs, but was later reduced to an 18-bp terminal fragment of the ITR, deemed the minimum required unit [101]. Interestingly, attempts to introduce the full Ad ITR fragment into retrovirus vectors resulted in viruses 5 1 2 Murphy and Vile with very low titers (<10^ iu/mL), indicating adverse effects on retroviral replication. The minimal ITR 18mer oligonucleotide, however, allowed high- titer retrovirus production. The pTP binding site was placed in the center of the recombinant vector between hAAT and neo in order to avoid potential interference of pTP binding on preintegration complex stoichiometry. Results demonstrated that the incorporation of the pTP karyotypic machinery in the context of the retroviral backbone could indeed efficiently translocate the RV genome across the nuclear divide. pTP-mediated transduction was, however, always less than in proliferating cells, possibly indicating weak binding to the viral DNA, which is supported by AdPol increasing nuclear import and transduction. Alternatively the nuclear matrix binding properties of pTP could interfere with the retroviral transduction functions. Disappointingly, however, pTP nuclear import of MoMuLV DNA in nondividing cells was found not to be sufficient for stable transduction. Undetermined additional cellular factors activating during S phase and/or DNA repair are required for efficient retroviral integration [101]. E. Hybrid Adenoviral/Adeno-Associated Virus Vectors Incorporation of AAV nuclear retention functions into hybrid Ad vectors has also become a great interest in gene therapy. AAV vectors have emerged strongly as candidates for gene therapy, being nonpathogenic and presenting a mechanism of stable integration into a specific locus of the human host chromosome. The terminal ITR structures contain all the c/s-acting elements required to drive episomal replication, host genome integration and packaging into infectious AAV particles [102-105]. The rep gene products mediate the amplification of the AAV genome and facilitate site-specific integration into the human chromosome 19ql33^ termed AAVSl [106, 107]. In the context of double-stranded circular DNA plasmid vectors, the presence of the two AAV ITRs was demonstrated to be sufficient to rescue an AAV genome from the plasmid backbone and to mediate its integration into host DNA [108, 102]. These findings paved the way to the development of AAV vectors and initiated the application of AAV genomes in hybrid vector systems. The ITR-flanked AAV cassettes were subsequently demonstrated to also be efficiently rescued from the backbones of other viral vectors. In cultured cells, AAV integrates into the host chromosome with a relatively low frequency of 1 X 10""^ to 3 X 10~^ genomes per cell, with alternative episomal replication of its genome permitting long-term persistent expression in cells [109]. However, the integration efficiency can be enhanced by stimulation of the host DNA repair machinery by gamma irradiation or topoisomerase inhibitors [110,111]. The only requirements for AAV integration and episomal concatemerization appear to be the presence of AAV ITRs and as-yet-undetermined cellular factors [102, 103, 108]. 17. Hybrid Adenoviral Vectors 513 Following the hybrid Ad/RV studies, AAV ITR-flanked transgene cas settes have been similarly applied in the context of an Ad backbone. AAV ITR cassettes can be efficiently rescued from Ad genomes and assembled into AAV particles upon the supply of rep and cap functions in trans [15]. In the absence of the cap genes, Ad-mediated delivery of the AAV ITR cassettes can result in its stable integration into the host genome, in the presence or absence of the rep genes (Fig. 6). However, studies on the relationship between Ad and AAV demonstrate a strong interference of AAV on the Ad life cycle [112]. Although the precise mechanism is undetermined, rep expression is sufficient to suppress the maturation of Ad replication centers [113]. Hence the major complica tion in the union of the Ad/AAV hybrid vector system has been strategies to facilitate rep expression in the context of an adenoviral vector. The AAV rep gene encodes four proteins that are expressed from indepen dent promoters (Fig. 7A). The Rep68 and Rep78 differentially spliced products are expressed from the P5 promoter and individually are capable of catalyzing AAV genome integration [114, 115]. The poorly characterized Rep40 and Rep52 proteins are expressed from the PI9 promoter and, although having Ad AAV Ad ITR hF iHlTR + Rep 19ql3.3 (AAVSl) Genomic Integration: - Rep Random Transgene AAV Genomic DNA Figure 6 Hybr id-Ad/AAV vector-mediated integration of the AAV ITR cassettes. Infection of cells with the hybrid A d / A A V vector enables precise excision of the ITR-flanked cassette from the adenoviral genome, v/hich can subsequently be integrated into the host genome. This mechanism can occur in the absence or presence of the AAV Rep proteins. In the presence of Rep the cassette is predictably integrated into the AAVSl locus on human chromosome 19. 514 Murphy and Vile Rep SA SD Cap llliiiil ̂ ^̂ ^̂ "̂ -»- 3'rrR P5 P19 P40 Cap Structural Proteins VPl,VP2andVP3. Rep78 Splicing Rep68 Rep52 Splicing A Rep40 Rep SA<SD P5 P19 P40 Rep78 B Promoter ^ Rep78 rm LoxP LoxP ^ v Cre Recombinase. - • Rep78 EXPRESSION rmpr LoxP Figure 7 Control of the expression of the AAV Rep proteins in the context of their inhibitory effects on Ad production. (A). Schematic representation of the AAV genome. Three promoters are contained in the AAV genome: P5 and p i 9 control expression of the alternatively spliced Rep68/78 and Rep40/52 transcripts, respectively, while P40 controls expression of the Cap gene products. (B) In order to restrict expression from the Rep cassette to just the Rep78 form, a point mutation was introduced into the PI 9 promoter's ATG start site, preventing Rep40/52 expression, and a similar mutation in the P5 transcript's splice site eliminated Rep68 expression. (C) In order to further restrict Rep78 expression from the Ad vector, a LoxP cassette flanking a poly(A) stop site was cloned between the Rep78 gene and its promoter. This cassette completely silences Rep78 by preventing translation by premature termination at the introduced poly(A) site. Cre-mediated excision removes this cassette, permitting Rep78 expression to proceed. 17. Hybrid Adenoviral Vectors 5 1 5 similar catalytic properties to the other proteins, their function is undetermined and believed to be distinct from Rep68/78 [116]. Recchia and colleagues inves tigated amplification conditions that v^ere likely to minimize Rep inhibition of vector production [117]. Specifically, PI9 promoter expression of Rep52 and Rep40 v̂ âs reported to impose significant inhibitory functions to Ad replica tion, although Rep68 and Rep78 functions w êre also apparent. To minimize the complications of Rep-mediated interference of Ad production, the expres sion of Rep proteins w âs restricted to just the Rep78 isotype, by inactivating the Rep52 and 40 transcripts by ATG mutation and preventing Rep68 splicing by similar point mutations at the splice site (Fig. 7B). Rep79 was placed under the control of either the T7 promoter, a promoter previously applied to the production of adenoviruses expressing toxic genes, or the a 1-antitrypsin (alat) liver-specific promoter, to additionally minimize any interference. The AdT7- Rep78 shuttle vector w âs successfully recombined in 293 cells to generate the Ad vector, whereas shuttle vectors containing the wild-type Rep, or only expressing the Rep52 and —40 isotypes, did not yield any viral plaques. The functionality of the AdT7-Rep78 vector was demonstrated in an AAV rescue study [117]. As expression from the a la t promoter restricts expression to hepatic tissues, Ueno and colleagues applied an alternative Cre/LoxP bacteriophage PI system as a switch to regulate Rep expression from an Ad vector [118]. A LoxP-flanked cassette containing a transcriptional silencing sequence (SV40 poly(A)) was cloned between the Rep78 gene and its CAG promoter (Fig. 7C). Hence upon Cre recombinase expression the LoxP cassette is excised, uniting promoter and transgene and allowing transcription to proceed. The authors failed to yield any virus with Rep78 driven by the CAG promoter in the absence of the Lox-stop cassette. The vector system thus required a third Ad expressing Cre (AdCre) to be coexpressed with AdLoxP-Rep78 and the Ad/AAV hybrid vector. Only upon application of all three vectors to HeLa cells (m.o.i.s of 10 to 20) was site-specific integration into AAVSl detected by PCR analysis of genomic DNA [118]. As with the previous systems, incorporation of all the vector components into a single gutless vector is a major aim. The application of Cre recombinase would thus, as with the previous Ad/EBV replicon system [94], require tightly controlled expression to be incorporated into the same helper-dependent (HD) vector as the LoxP cassette. 1. Helper-Dependent Ad/AAV Recchia and colleagues furthered the studies of Ad/AAV hybridology by incorporating the system into HD Ad vectors [117]. The system applied a similar two-vector strategy with the AAV ITR transgene cassette and Rep78 genes on separate gutless vectors, HD-AAV and HDalat-Rep78, respectively. The gutless Ad constructs consisted of the terminal c/s-acting regions of the Ad genome (ITRs and ^\r) together with the transgene cassette(s), as well as 5 1 6 Murphy and Vile additional inert staffer sequences, to bring the vector genome size above the efficient packaging size threshold (>27kb) [35]. Large-scale production of HDalat-Rep78 generated titers of 3 x 10^ iu from 5 x 10^ cells, indicating 50-100 Rep-expressing viruses per cell could be produced. This HDalat- Rep78 virus expressed Rep78 selectively in hepatic cells (Hep3B). Rescue of the AAV-ITR transgene cassette from HD-AAV into infectious AAV particles was observed upon coinfection of Hep3B cells w îth HDalat-Rep78 and w îld- type Ad2 helper. No AAV rescue w âs detected upon elimination of any of the three vector components, demonstrating the functionality of each component. Coinfection of HD-AAV w îth HDalat-Rep78 into a number of cell lines of hepatic origin showed stable integration of the AAV transgene cassettes into the host cell genome specifically at AAVSl, by nested PCR analysis. Southern blotting, and integration site junction sequencing [117]. FISH studies on HepG2 cells infected with both vectors demonstrated targeted integration to AAVSl in 14 of 39
(35%) metaphases analyzed. In the absence of the Rep78 vector only one integration in chromosome 19 was observed in 34 metaphases analyzed (3%). Hence, the study by Recchia and colleagues demonstrates that Rep78 expression increases the targeted integration of AAV-ITR-flanked DNA without affecting the overall integration frequency in cells of hepatic origin [117]. In contrast to other studies on 293 cells [114,119,120], however, Rep78 did not increase the stable transduction efficiency on the hepatic cell lines investigated, which was believed to be due to cell-type effects [117]. The next advance in this study will be incorporation of both cassettes into a single HD Ad vector. This will be much more complex than originally perceived considering the action of Rep78 on the AAV cassette, especially in the high copy number context of adenovirus production. Additionally, considering the Rep-independent processing of the AAV ITR cassette, the fate of the cassette at high copy number in the producer cells would be of great interest. 2. Generation of Mini-Ad/AAV Hybrid Vectors by in Vitro Hybridization Inverted repeat (IR) sequences inserted into first generation Ad vector genomes were recently reported to mediate precise genomic rearrangements resulting in vector genomes devoid of all viral genes but which were efficiently packaged into functional Ad virions [121]. These genomes were generated by a ^m/zs-recombination between two Ad genomes exchanging sequences either side of the IR regions. Hence two species are generated. Firstly, a small genome containing only the transgene cassette flanked on both sides by precisely duplicated IRs, Ad packaging signals (i\|/), and Ad ITRs (Fig. 8). Second, a larger genome is generated containing the transgene cassette flanked by the IRs and also the rest of the Ad genome (Fig. 8). The presence of the Ad packaging signal only in the mini-genome product meant that only this form could be packaged, whereas the larger genome just facilitated helper 17. Hybrid Adenoviral Vectors 5 1 7 Figure 8 Generation of mini-Ad genomes by recombination between inverted repeat (IR) regions. The presence of IR regions in adenoviral cassettes enables precise recombinations between different Ad genomes within the IR regions. This recombination generates mini-Ad genomes with the precisely replicated IR cassettes being flanked at either end by Ad ITR and ^ sequences. A second, much larger, recombinant species is also generated which also contains a precisely replicated IR cassette but is flanked on either side by the rest of the adenoviral genome. This larger recombinant, as well as being of a size nonpackageable into an adenoviral virion, lacks the Ad ^ and hence is not packaged. In contrast, the smaller mini-Ad genomes can be efficiently assembled into adenoviral particles assembled by the larger genome's helper functions. functions. Application of this precise recombination mechanism to generate mini-Ad genomes deleted of all viral genes could minimize the immunogenicity apparent with first-generation vectors. By modifying the IR regions to increase the efficiency of recombination, further selection for the recombinant mini- genomes could be achieved [121]. The mini-Ad virions could be efficiently separated on CsCl gradients by buoyant density, v\̂ ith great resolution from the larger helper viral genomes enabling efficient purification. The generation of the recombinant mini-Ad genomes was very efficient (^5 X 10"̂ genomes per cell) and did not depend on the sequences within or adjacent to the IRs [121]. The mini-Ad vectors efficiently infected cultured cells with the same efficiency as first-generation vectors. However, in the absence of any vector selection in the cell (episomal replication or integration), transgene expression was only transient (^7 days) due to the instability of the deleted genomes within transduced cells. 5 1 8 Murphy and Vile Lieber and colleagues further developed the system to incorporate AAV cassettes into a hybrid vector system [121]. The AAV ITRs flanking the trans- gene cassette vŝ ere used as the IRs to mediate the recombination event, as well as stimulating transgene integration into the host genome of transduced cells. The Ad-AAV vectors efficiently generated mini-genomes by IR recombination as by-products of first generation Ad-AAV vector amplification. The mini- genomes containing only the transgene flanked by AAV ITRs, Ad \I/s, and Ad ITRs could be efficiently assembled in Ad capsids and purified to high titers and purity. The mini-Ad-AAV hybrid vectors transduced cells w îth efficiencies comparable to AAV, but w êre less efficient than conventional Ad vectors due to elevated particle to infectious unit ratios [121]. Since the hybrid mini-vectors contained no cytotoxic viral genes, the hybrid virus could be applied at very high m.o.i.s to increase transduction rates. The AAV transgene cassettes ran domly integrated into the host cell genomes as head-to-tail concatemers, as shown by Southern blot analysis and pulsed-field gel electrophoresis. Amplification of Ad-AAV hybrid vectors in 293 cells routinely yielded final mini-Ad-AAV genome titers of 5 x 10^^ genomes per milliliter, or '^lO'^ packaged genomes per 293 cell, comprising 10% of the total number of adenoviral virions [121]. The 5.5 kDa mini-Ad-AAV hybrid vectors which contain two Ad packaging signals were, however, packaged approximately fivefold less efficiently than the corresponding full-length genomes [121]. These results are compatible with the published observations that Ad vector genomes of less than 27 kb package with much reduced potentials compared to full- length genomes [35]. Additionally, contamination of mini-Ad-AAV hybrid vector preparations with the parental Ad-AAV hybrid vector was less than 0 .1%, consistent with conventional gutless Ad purification [13]. The efficiency of vector production measured on a genome-per-cell basis was reported to be comparable to or higher than the labor-intensive techniques for AAV production. The transducing titers expressed as neomycin-resistant colonies per milliliter were 9 x 10^ for AAV and 2.5 x 10^ for the mini-Ad-AAV hybrid vector [121]. These results present significant clinical promise for mini-Ad/AAV hybrid vectors in the clinic. IV. Conclusion The establishment of hybrid Ad vectors incorporating the advantageous properties of other viruses greatly expands their therapeutic potential. In the early 1990s, after the initial decade of proof-of-concept for Ad-mediated gene therapy, the main focus was on limiting the immunogenicity of the vectors to enhance transgene expression. Further restricting the expression of the highly immunogenic late viral transcripts by E4 deletions or by complete deletion of all viral genes in the gutless vectors notably enhanced transgene expression [11-13, 35]. However, complete ablation of immunogenicity is 17. Hybrid Adenoviral Vectors 5 1 9 restricted by the highly inflammatory nature of the Ad particles themselves in the absence of viral expression. While suppression of specific immune responses can counter these effects to some extent, in many disease states w^here the immune system is already compromised this rationale is not ideal. Pseudotyping the Ad vectors vv̂ ith alternative surface moieties does, hov^ever, offer great potential. First, novel surface structures can be introduced v^hich can reduce the immunogenicity of the viral particles by either shielding or replacing the highly immunogenic w^ild-type structures. Future research may permit the complete replacement of the viral external domains with immune- tolerated surface structures. Second, the introduction of new^ targeting ligands v îll enable selected infection of desired tissue populations, limiting the required vector doses. Additionally, the avoidance of infection of nontargeted tissues, specifically cells of the immune system, v îll negate potentially immunogenic signalling w^hich the vectors can initialize upon receptor docking. It is now^ w êll accepted that the immune system is not the major limiting factor in the transient expression attained from Ad vectors. The absence of a specific mechanism of long-term retention of the viral genomes in infected cells is critical. As presented at the start of this chapter, the rapid lytic life cycle of w^ild-type adenoviruses does not require long-term persistence of the genomes. Adenovirus infection, genome replication, virion packaging, and lysis of the host cell are generally completed w^ithin 48 h. While these properties have proved highly beneficial in the area of vector production, they do not aid in vivo stability. By combining the long-term stable persistence mechanisms of other viral systems into the Ad vectors, the efficacy of Ad-mediated gene therapy has been significantly enhanced. A number of mechanisms have been presented in this chapter for the combination of adenoviral and retroviral vectors. Initial applications utilized Ad vectors to deliver RV packaging functions to producer cells in vitro^ in attempts to increase the efficiency of RV production. From these initial studies, the potential of the hybrid Ad/RV vectors for the establishment of RV producer cell in vivo w âs realized. As producers of RV packaging cells in vitro, the Ad/RV hybrid vector system has a number of advantages over conventional packaging cell lines. RV titers generated from transient plasmid- transfected producer cells are generally several orders of magnitude low^er than the best stable clones [3]. Therefore, as the Ad/RV hybrid system has been demonstrated to generate RV titers of the same orders of magnitude as conventional producer cells, it bypasses the need to isolate clonal populations and makes scaling up production more manageable. The requirement of GMP screening for replication-competent adenoviruses (RCA), as w êll as replication- competent retroviruses (RCR), w^ould, how^ever, be a concern. The separation of the different retroviral components on separate viruses, as well as limiting the potential of RCR, makes pseudotyping very simple. For instance, in the treatment of specific tissues, an envelope gene best suited for tropism to that 5 2 0 Murphy and Vile tissue can be easily incorporated into the vector system. The separation also enables characterization of individual RV components. Application of the individual Ad/RV hybrid vectors at varying m.o.i.s enables study of the RV production at varying copy load. Additionally, as different target tissues have been v^ell documented to have different potentials as RV producer cells, the hybrid Ad/RV system enables the rapid screening of tissues for their suitability as RV producer cells. How^ever, this measure of suitability is also influenced by the susceptibility of the cells to Ad transduction. Understanding the effects of saturating RV components could allov\̂ us to determine w^hat factors need to be further regulated in future hybrid vectors to enable enhanced RV production both in vitro and in vivo. Elucidation of host factors vital to efficient assembly of RV particles w^ould be very valuable. In future vectors, these host factors could be codelivered or upregulated to enhance RV titers. One major question is: w^hat advantages does the hybrid Ad/RV vector system have over conventional Ad or RV delivery? The ability to establish RV producer cells in vivo following Ad infection is a major step forw^ard in gene therapy. Previous methods of ex vivo transduction with retroviral vectors and reimplantation are laborious and inefficient. Vector spread is limited by the restricted migratory properties of the reimplanted cells. Application of the hybrid Ad/RV vector enables a noninvasive therapy with enhanced distribution and infectivity in target tissues. The subsequent local release of retroviral particles following adenoviral transduction also tackles the problem of inserting high levels of vector deep into the middle of tissue or tumor masses, rather than to just the peripheral layers. The major advantage over conventional Ad vectors is the establishment of a stable population of transgene-expressing cells in the surrounding tissues, through RV integration, following the initial transient Ad transduction. This permanency of therapeutic transgene has major implications in the clinic, specifically for the treatment of inherited diseases. The separation of the RV genes, as well as the introduction of additional regulatory elements carried on separate rAds, instills a multiple- vector transduction strategy. Vector systems involving more than one vector are limited by codelivery kinetics. The greater the number of individual vectors, the lower the probability that a cell will receive the full vector repertoire to allow retroviral production to occur. Therapeutic transgene expression can, however, proceed from the adenoviral vector itself, initiating an initial boost of gene expression, followed by a secondary level of sustained expression in RV transduced cells. Currently, however, the secondary phase of RV expression is much reduced compared to the initial Ad-mediated expression. This would minimize the sustained therapeutic effect of the vector system. Nevertheless, this hybrid Ad/RV vector system has great potential for the treatment of genetic disorders. The dual transduction properties of the Ad/RV hybrid vector also present the possibility of combinatory gene therapy where the Ad and RV portions 17. Hybrid Adenoviral Vectors 5 2 1 of the vector provide different therapeutic effects. This mechanism could have specific advantages to the treatment of
cancer. The initial Ad transduction could act to initially immunostimulate the tumor mass, aiding a break in tolerance by drav^ing in immune effector cells and initiating a "danger signal." The secondary RV transduction could deliver a cytoreductive transgene aimed at tumor cell killing, to eliminate tumor tissue and further immunostimulate the tumor environment. A major limitation of the system is the requirement of active cell division in neighboring cell populations to enable RV transduction. Hence, inserting a gene in the Ad vector, separate from the retroviral cassette, could trigger cell division of neighboring tissues so that they become fully receptive to the subsequently available retrovirus. An alternative strategic context of application could be applied to tumors, v^here the actively dividing tumor tissue is generally surrounded by virtually quiescent normal tissue. Utilizing a highly regulated cytotoxic gene, under the control of an inducible or tissue-specific promoter system, the primary Ad infection would enable production of retroviral particles w^hich in theory v^ould selectively infect dividing tumor cells. Subsequent cytotoxic gene expression could, to some extent, restrict cell killing to tumor cells. Ad-mediated delivery of an excisable closed circular RV cassette that can subsequently be integrated into the host genome w^ould be of great value to gene therapy in the clinic. The system provides the potential to direct stable transgene expression in each primarily Ad-infected cell. This would be a significant advance on the previous Ad/RV hybrid system, where the secondary RV transduction is extensively reduced compared to the primary Ad transduction. Although the closed circular form is not the primary substrate for retrovirus integration, in the absence of the wild-type substrate, Int has been demonstrated to integrate such structures into the host genome. While the efficiency of such a system has still to be addressed, further elaboration of the integration mechanism could enable increased affinity of the RV machinery for closed-circle LTR proviral forms. The system would also have the potential of combinatory gene therapy by the inclusion of transgene cassettes within or outside the integrating RV cassette. Transgenes outside the excisable cassette would provide transient expression for the duration of the Ad genome retention in infected cells. The integrated cassette could provide stable expression for the lifetime of the cell. The major advance of this system will come from the development of highly regulated expression systems that can completely silence Cre expression. Silencing of Cre recombinase expression would enable assembly of all the vector components into a single gutless HD Ad vector. Although the system proposed by Wang and colleagues [122] goes some way to prevent expression, the system is still leaky and restricts therapeutic application to hepatic tissue. The alternative strategy of maintaining a Cre-excised circular molecule by utilizing the EBV episomal replication system provides another potentially 5 2 2 Murphy and Vile powerful gene therapy vector, providing many of the advantageous properties detailed above. The Ad/EBV hybrid system would again require absolute con trol of Cre expression to combine all the components into a single vector. One limitation of this system is that EBNA-1 gene expression would have to be permanently maintained in the host cell, which could involve long-term cell regulatory or immunological problems in vivo. Conversely, the integration mechanism requires only transient expression of integrase to facilitate inte gration, and the transgene cassette is then maintained in the context of host cell chromosome replication. While the EBV replicon has the advantage of avoiding integration-related shutdown of transgene expression, other cellular factors are believed to be involved in the eventual loss transgene expression. EBV retention in human cells has been deemed limited and lost with time [123, 124]. Without drug selection, plasmids carrying the EBV elements are lost from human cells at rates of between 1 and 5% per generation [125]. The Ad/AAV hybrid vector system provides a powerful mechanism of maintained transgene expression by integration or episomal replication. The system also provides the potential of predictable integration at a specific locus in the human genome in the presence of Rep78. The establishment of targeted integration strategies introduces valuable safety features into a gene-therapy protocol. This advantageous property of integration also carries with it the potential hazard of insertional mutagenesis and the risk of activating cancer oncogenes in vivo. Although there are limited literature reports on the impact of such phenomena in a gene therapy protocol, as vector technology increases and the efficiencies of integration in human tissues are potentiated, these effects could become more significant. However, even in the context of the targeted integration of AAV, the exact phenotype of integration at chromosome 19^5^13.4, as well as the activity of genes integrated at such a locus are still to be determined. The generation of the mini-Ad/AAV hybrid vectors enables the high-titer purification of adenoviral particles deleted of all the Ad genes, analogous to the HD rationale. The mechanism of preparation and purification, however, appear to be simpler. The Ad/AAV hybrid vector is applied to the producer cells as an Ad, which also supplies the helper functions. This bypasses the necessity of HD plasmid transfection and subsequent serial passage to enhance titers to enable purification from the contaminating helper virus. The extensive size difference of the derived mini-Ad/AAV genomes, from the parental Ad/AAV genomes, also enables more efficient purification by buoyant density on CsCl gradients. Additionally, any contaminating parental vector will be a functional Ad/AAV hybrid vector. The biological stability of these mini-adenoviruses, in terms of both particle stability outside the cell and genome stability within the cell, still needs to be addressed. Nevertheless, considering the integration of the ITR AAV cassettes, the mini-Ad genome stability is not as important. Additionally although the transduction efficiency of the mini-Ad particles is 17. Hybrid Adenoviral Vectors 5 2 3 similar to AAV, the ratio of total particles to infectious virions is enhanced, limiting their efficiency compared to conventional Ad vectors. The vector is also limited in terms of codelivery of the rep gene, v^hich unlike the HD vectors cannot be easily incorporated into the same vector. HSV-based hybrid vectors have also been w êll reported in literature, presenting a number of advantageous properties over the described Ad-based systems. The development of the HSV-1 amplicon technology and helper-free packaging systems has made HSV-based vectors very promising clinical tools for gene therapy [39]. The large insert capacity of the amplicons (150 kb) and the concatemer-styled packaging, w îth up to 10 genome copies per virion introduces pov^erful features to gene therapy vectorology [25]. HSV vectors, like Ads, have tropism for most cells in the human body, but have particular affinity for neuronal tissues. The HSV-1-based amplicons do not, how^ever, retain the episomal maintenance functions of the parental herpes viruses and thus, as w îth Ad vectors, the genomes are rapidly lost in dividing cells. Hence, hybrid technology has been investigated to enhance the expression from HSV amplicon vectors. As w îth the Ad/AAV hybrid system, the presence of an AAV ITR-flanked cassette in the HSV amplicon vector can promote both extra- chromosomal amplification and integration of the transgene cassette into the host genome. The HSV/AAV hybrid vector system has been demonstrated to stably transform dividing cells for over 25 passages in culture [126]. Hepatic transduction in vivo v^ith an HSV/AAV hybrid vector supported gene expres sion in vivo for considerably longer periods than traditional HSV-1 amplicons, w îth minimal toxicity and immunogenicity [119]. An additional feature of the HSV/AAV studies w âs the placement of the rep gene under the control of its ow n̂ promoter, as literature has reported potential dov\An-regulation feedback inhibition of transcription v^hen Rep levels increase [127]. Thus the natural expression machinery of Rep is utilized to regulate its expression. Compared to Ad vectors, the HSV amplicon vector titers are limited (lO'̂ to 10^ iu/mL). Increased copy number can compensate for reduced titers in some fields of gene therapy, although for many corrective genetic therapies higher transduction efficiencies from higher titer viral applications may prove more efficacious. The reduced immunogenicity of the HSV-1 amplicons is, how^ever, a major advantage over Ad vectors. Other hybrid vectors have also combined RV and EBV functions w^ithin the HSV-1 amplicons, v^hich also have great potential as gene delivery vectors [123, 124, 128] The development of hybrid viral vector systems has thus revolution ized the way gene therapy vectors are conceived. The combination of the advantageous properties of different vectors goes some v^ay to establishing a vector system approaching the ideologies of a perfect gene transfer vehicle. The technologies are, how^ever, in their infancy and many factors need to be elucidated before the full potentials of the vectors can be achieved. In essence, further detailed elucidation of the viral life cycles and their interactions w îth 5 2 4 Murphy and Vile host cell factors is necessary. Understanding these factors will allow vectors to be developed which can interact with the host cellular machinery to facilitate long-term stable gene expression. Future "hybrid" vectors will be developed quite distinct from the currently perceived parental vectors. Virtually synthetic viral vectors will be established with predictable biological properties, which can effect desired clinical functions. The vast array of clinical phenotypes and biological properties of target tissues involved in human disease will, however, require a wide spectrum of clinical vectors, fashioned to specific disorders. Nevertheless, the current advances in gene therapy technology will ensure that hybrid viral vectors will play a major role in future clinical protocols. References 1. Coffin, J. M. (1996). Retroviridae: The viruses and their repHcation. In "Fundamental Virology" (B. N. Fields et ai, Eds.), 3rd ed., pp. 771-813. Raven Press, New York. 2. Vile, R. G., and Russell, S. J. (1995). Retroviruses as vectors. Br. Med. Bull. 51, 139-158. 3. Cossett, F. -L., Takeuchi, Y., Battini, J. -L., Weiss, R. A., and CoUins, M. K. L. (1995). High titer packaging cells producing recombinant retroviruses resistant to human complement. / . Virol. 69, 7430-7436. 4. Zhang, W. W. (1997). Review: Adenovirus vectors: Development and application. Exp. Opin. Invest. Drugs 6, 1419-1457. 5. Shenk, T. (1996). Adenoviridae: The viruses and their replication. In "Fields Virology" (B. N. Fields et ai, Eds.), 3rd ed.. Vol. 2, pp. 2111-2148. Lippincott-Raven, New York. 6. Bett, A. J., Prevec, L., and Graham, F. L. (1993). Packaging capacity and stability of human adenovirus type 5 vectors./. Virol. 67, 5911-5921. 7. Graham, F. L., Smiley, J., Russell, W. C., and Nairn, R. (1977). Characterisation of a human cell line transformed by DNA from human adenovirus type 5. / . Gen. Virol. 36, 59-72. 8. Bett, A. J., Haddara, W., Prevec, L., and Graham, F. L. (1994). An efficient and flexible system for construction of adenovirus vectors with inserts or deletions in early regions 1 and 3. Proc. Natl. Acad. Set USA 91, 8802-8806. 9. Gorziglia, M. I., Kadan, M. J., Yei, S., Lim, J., Lee, G. M., Luthra, R., and Trapnell, B. C. (1996). Elimination of both El and E2a from adenovirus vectors further improves prospects for in vivo human gene therapy. / . Virol. 70, 4173-4178. 10. Fang, B., Wang, H., Gordon, G., Bellinger, D. A., Read, M. S., Brinkhous, K. M., Woo, S. L. C , and Eisensmith, R. C. (1996). Lack of persistence of El-recombinant adenoviral vectors containing a temperature-sensitive E2A mutation in immunocompetent mice and hemophilia B dogs. Gene Ther. 3, 217-222. 11. Armentano, D., Zabner, J., Sacks, C , Sookdeo, C. C , Smith, M. P., St. George, J. A., Wads- worth, S. C , Smith, A. E., and Gregory, R. J. (1997). Effect of the E4 region on the persistence of transgene expression from adenovirus vectors./. Virol. 71, 2408-2416. 12. Wang, Q., Greenburg, G., Bunch, D., Farson, D., and Finer, M. H. (1997). Persistent trans- gene expression in mouse liver following in vivo gene transfer with a 5E1/5E4 adenovirus vector. Gene Ther. 4, 393-400. 13. Parks, R. J., Chen, L., Anton, M., Sankar, U., Rudnicki, A., and Graham, F. L. (1996). A helper-dependent adenovirus vector system: Removal of helper virus by Cre-mediated excision of the viral packaging signal. Proc. Natl. Acad. Sci. USA 93, 13,565-13,570. 14. Berns, K. I. (1991). Parvoviridae and their replication. In "Fundamental Virology" (B. N. Fields et al., Eds.), 3rd ed., pp. 817-837. Raven Press, New York. 17. Hybrid Adenoviral Vectors 5 2 5 15. Kremer, E. J., and Perricaudet, M. (1995). Adenovirus and adeno-associated virus-mediated gene-transfer. Br. Med.
Scheel, J. R., Vahanian, N., Yoshida, Y., Hamada, H., Blaese, R. M., and Ramsey, W. J. (1999). Adeno-retroviral chimeric viruses as in vivo transducing agents. Gene Ther. 6, 454-459. 78. Lin, X. (1998). Construction of new retroviral producer cells from adenoviral and retroviral vectors. Gene Ther. 5, 1251-1258. 79. Bertran, J., Miller, J. L., Yang, Y., Fenimore-Justman, A., Rueda, F., Vanin, E. F., and Nien huis, A. W. (1996). Recombinant adeno-associated virus-mediated high-efficiency, transient expression of the murine cationic amino acid transporter (ecotropic retroviral receptor) permits stable transduction of human HeLa cells by ecotropic retroviral vectors. /. Virol. 70, 6759-6766. 80. Qing, K., Bachelot, T., Mukherjee, P., Wang, X. S., Peng, L., Yoder, M. C , Leboulch, P., and Srivastava, A. (1997). Adeno-associated virus type 2-mediated transfer of ecotropic retrovirus receptor cDNA allows ecotropic retroviral transduction of established and primary human cells./. Virol. 71, 5663-5667. 81. Scott-Taylor, T, H., Gallardo, H. F., Gansbacher, B., and Sadelain, M. (1998). Adenovirus facilitated infection of human cells with ecotropic retrovirus. Gene Ther. 5, 621-629. 82. Huber, B. E., Richards, C. A., and Krenitsky, T. A. (1991). Retroviral-mediated gene therapy for the treatment of hepatocellular carcinoma: An innovative approach for cancer therapy. Proc. Natl. Acad. Sci. USA 88, 8039-8043. 83. Bui, L. A., Butterfield, L. H., Kim,J. Y., Ribas, A., Seu, P., Lau, R., Glaspy, J. A., and McBride, W. H., and Economou, J. S. (1997). In vivo therapy of hepatocellular carcinoma with a tumor-specific adenoviral vector expressing interleukin-2. Hum. Gene Ther. 8, 2173-2182. 84. Uto, H., Ido, A., Hori, T., Hirono, S., Hayashi, K., Tamaoki, T., and Tsubouchi, H. (1999). Hepatoma-specific gene therapy through retrovirus-mediated and targeted gene transfer using an adenovirus carrying the ecotropic receptor gene. Biochem. Biophys. Res. Commun. 265,550-555. 85. Zheng, C , Baum, B. J., ladarola, M. J., and O'Connell, B. C. (2000). Genomic integration and gene expression by a modified adenoviral vector. Nat. Biotechnol. 18, 176-180. 86. Harui, A., Suzuki, S., Kochanek, S., and Mitani, K. (1999). Frequency and stability of chromosomal integration of adenovirus vectors./. Virol. 73, 6141-6146. 87. Brown, P. O. (1990). Integration of retroviral DNA. In "Retroviruses. Strategies of Replica tion" (R. Swanstrom and P. K. Vogt, Eds.), pp. 19-48. Springer Verlag, Berlin. 17. Hybrid Adenoviral Vectors 5 2 9 88. Varmus, H. E., and Swanstrom, R. (1985). Replication of retroviruses. In "RNA Tumor Viruses" (R. Weiss, N. Teich, H. Varmus and J. Coffin, Eds.), pp 75-134. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 89. Brown, P. O., Boweman, P., Varmus, H. E., and Bishop, J. M. (1989). Retroviral integration: structure of the initial covalent product and its precursor, and a role for the viral IN protein. Proc. Natl. Acad. Set. USA 86, 2525-2529. 89. Panganiban, A. T., and Temin, H. M. (1984). Circles with two tandem LTRs are precursors to integrated retrovirus DNA. Cell 36, 673-679. 90. Shoemaker, C , Goff, S., Gilboa, E., Pasking, M., Mitra, S. W., and Baltimore, D. (1980). Structure of a cloned circular Moloney murine leukemia virus molecule containing an inverted segment: Implications for retrovirus integration. Proc. Natl. Acad. Sci. USA 77, 3932-3936. 92. Lobel, L. I., Murphy, J., and Goff, S. P. (1989). The palindromic LTR-LTR junction is not an efficient substrate for proviral integration. / . Virol. 63, 2629-2637. 93. Murphy, S. J., Chong, H., Bell, S., Diaz, R. M., and Vile, R. G. A novel integrating adenovi ral/retroviral hybrid vector for gene therapy. Submitted for publication. 94. Tan, B. T., Wu, L., and Berk, A. J. (1999). An adenovirus-Epstein-Barr virus hybrid vector that stably transforms cultured cells with high efficiency. / . Virol. 73, 7582-7589. 95. Leblois, H., Roche, C , Di Falco, N., Orsini, C , Yeh, P., and Perricaudet, M. (2000). Stable transduction of actively dividing cells via a novel adenoviral/episomal vector. Mol. Ther. 1, 314-322. 96. Sugden, B., Marsh, K., and Yates, J. (1985). A vector that replicates as a plasmid and can be efficiently selected in B-lymphoblasts transformed by Epstein-Barr virus. Mol. Cell. Biol. 5, 410-413. 97. Yates, J. L., and Guan, N. (1991). Epstein-Barr virus-derived plasmids replicate only once per cell cycle and are not amplified after entry into cells. / . Virol. 65, 483-8 . 98. Levitskaya, J., Sharipo, A., Leonchiks, A., Ciechanover, A., and Masucci, M. G. (1997). Inhibition of ubiquitin/proteasome-dependent protein degradation by the Gly-Ala repeat domain of the Epstein-Barr virus nuclear antigen 1. Proc. Natl. Acad. Sci. USA 94, 12,616-12,621. 99. Leblois, H., Roche, C , Di Falco, N., Orsini, C , Yeh, P., and Perricaudet, M. (2000). Stable transduction of actively dividing cells via a novel adenoviral/episomal vector. Mol. Ther. 1, 314-322. 100. Wang, X., Zeng, W., Murakawa, M., Freeman, M. W., and Seed, B. (2000). Episomal segre gation of the adenovirus enhancer sequence by conditional genome rearrangement abrogates late viral gene expression./. Virol. 74, 11,296-11,303. 101. Lieber, A., Kay, M. A., and Li, Z. Y. (2000). Nuclear import of moloney murine leukemia virus DNA mediated by adenovirus preterminal protein is not sufficient for efficient retroviral transduction in nondividing cells./. Virol. 74, 721-734. 102. Xiao, X., Xiao, W., Li, J., and Samulski, R. J. (1997). A novel 165-base-pair terminal repeat sequence is the sole cis requirement for the adeno-associated virus life cycle. / . Virol. 71, 941-948. 103. Yang, C. C , Xiao, X., Zhu, X., Ansardi, D. C , Epstein, N. D., Frey M. R., Matera A. G., and Samulski, R. J. (1997). Cellular recombination pathways and viral terminal repeat hairpin structures are sufficient for adeno-associated virus integration in vivo and in vitro. / . V/Vo/. 71, 9231-9247. 104. Duan, D., Sharma, P., Yang, J., Yue, Y., Dudus, L., Zhang, Y., Fisher, K. J., and Engel- hardt, J. F. (1998). Circular intermediates of recombinant adeno-associated virus have defined structural characteristics responsible for long-term episomal persistence in muscle tissue./. Virol. 72, 8568-8577. 5 3 0 Murphy and Vile 105. Wu, P., Phillips, M. L, Bui, J., and Terwilliger, E. F. (1998). Adeno-associated virus vector- mediated transgene integration into neurons and other nondividing cell targets. / . Virol. 72, 5919-5926. 106. Weitzman, M. D., Kyostio, S. R., Kotin, R. M., and Owens, R. A. (1994). Adeno-associated virus (AAV) Rep proteins mediate complex formation between AAV DNA and its integration site in human DNA. Proc. Natl. Acad. Sci. USA 91, 5808-5812. 107. Walker, S.L., Wonderling, R. S., and Owens, R. A. (1997). Mutational analysis of the adeno-associated virustype 2 Rep68 protein helicase motifs. / . Virol. 71, 6996-7004. 108. Balague, C , Kalla, M., and Zhang, W. W. (1997). Adeno-associated virus Rep78 protein and terminal repeats enhance integration of DNA sequences into the cellular genome. / . Virol. 71, 3299-3306. 109. Rutledge, E. A., and Russell, D. W. (1997). Adeno-associated virus vector integration junc tions./. Virol. 71, 8429-8436. 110. Alexander, I. E., Russell, D. W., Spence, A. M., and Miller, A. D. (1996). Effects of gamma irradiation on the transduction of dividing and nondividing cells in brain and muscle of rats by adeno-associated virus vectors. Hum. Gene Ther. 7, 841-850. 111. Russell, D. W., Alexander, I. E., and Miller, A. D. (1995). DNA synthesis and topoisomerase inhibitors increase transduction by adeno-associated virus vectors. Proc. Natl. Acad. Sci. USA 92, 5719-5723. 112. Carter, B. J., Laughlin, C. A., de la Maza, L. M., and Myers, M. (1979). Adeno-associated virus autointerference. Virology 92, 449-62. 113. Weitzman, M. D., Fisher, K. J., and Wilson, J. M. (1996). Recruitment of wild-type and recombinant adeno-associated virus into adenovirus replication centres. / . Virol. 70, 1845-1854. 114. Surosky, R. T., Urabe, M., Godwin, S. G., McQuiston, S. A., Kurtzman, G. J., Ozawa, K., and Natsoulis, G. (1997). Adeno-associated virus Rep proteins target DNA sequences to a unique locus in the human genome. / . Virol. 71, 7951-7959. 115. Lamartina, S., RoscilU, G., Rinaudo, D., Delmastro, P., and Toniatti, C. (1998). Lipofection of purified adeno-associated virus Rep68 protein: Toward a chromosome-targeting nonviral particle./. Virol. 72, 7653-7658. 116. Berns, K. I., and Linden, R. M. (1995). The cryptic life style of adeno-associated virus. Bioessays. 17, 237-245. 117. Recchia, A., Parks, R. J., Lamartina, S., Toniatti, C., Pieroni, L., Palombo, F., CiUberto, G., Graham, F. L., Cortese, R., La Monica, N., and Colloca, S. (1999). Site-specific integration mediated by a hybrid adenovirus/adeno-associated virus vector. Proc. Natl. Acad. Sci. USA 96,2615-2620. 118. Ueno, T., Matsumura, H., Tanaka, K., Iwasaki, T., Ueno, M., Fujinaga, K., Asada, K., and Kato, L (2000). Site-specific integration of a transgene mediated by a hybrid adenovirus/adeno-associated virus vector using the Cre/loxP-expression-switching system. Biochem. Biophys. Res. Commun. 273, 473-478. 119. Fraefel, C., Jacoby, D. R., Lage, C., Hilderbrand, H., Chou, J. Y., Alt, F. W., Breakefield, X. O., and Majzoub, J. A. (1997). Gene transfer into hepatocytes mediated by helper virus-free HSV/AAV hybrid vectors. Molec. Med. 3, 813-825. 120. SheUing, A. N., and Smith, M. G. (1994). Targeted integration of transfected and infected adeno-associated virus vectors containing the neomycin resistance gene. Gene Ther. 1, 165-169. 121. Lieber, A., Steinwaerder, D. S., Carlson, C. A., and Kay, M. A. (1999). Integrating adenovirus-adeno-associated virus hybrid vectors devoid of all viral genes. / . Virol. 73, 9314-9324. 122. Wang, X., Zeng, W., Murakawa, M., Freeman, M. W., and Seed, B. (2000). Episomal segre gation of the adenovirus enhancer sequence by conditional genome rearrangement abrogates late viral gene expression./. Virol. 74, 11,296-11,303. 17. Hybrid Adenoviral Vectors 5 3 1 123. Wang, S., and Vos, J. M. (1996). A hybrid herpesvirus infectious vector based on Epstein-Barr virus and herpes simplex virus type 1 for gene transfer into human cells in vitro and in vivo. / . Virol. 70, 8422-8430. 124. Sena-Esteves, M., Saeki, Y., Camp, S. M., Chiocca, E. A., and Breakefield, X. O. (1999). Single-step conversion of cells to retrovirus vector producers with herpes simplex virus-Epstein-Barr virus hybrid amplicons./. Virol. 73, 10,426-10,439. 125. Yates, J. L., Warren, N., and Sugden, B. (1985). Stable replication of plasmids derived from Epstein-Barr virus in various mammalian cells. Nature 313, 812-815. 126. Jacoby, D. R., Fraefel, C , and Breakefield, X. O. (1997). Hybrid vectors: A nev^ generation of virus-based vectors designed to control the cellular fate of delivered genes. Gene Ther. 4, 1281-1283. 127. Labow, M. A., Hermonat, P. L., and Berns, K. I. (1986). Positive and negative autoregulation of the adeno-associated virus type 2 genome. / . Virol. 60, 251-258. 128. Savard, N., Cosset, F. L., and Epstein, A. L. (1997). Defective herpes simplex virus type 1 vectors harboring gag, pol, and env genes can be used to rescue defective retrovirus vectors. / . Virol. 71,4111-4117. C H A P T E R Utility of Adenoviral Vectors in Animal Models of Human Disease I: Cancer Raj K. Batra,'§ Sherven Sharma/^ and Lily Wu,'§ *Division of Pulmonary and Critical Care Medicine Veterans Administration Greater Los Angeles Health Care System Los Angeles, California ^Wadsworth Pulmonary Immunology Laboratory University of California, Los Angeles Los Angeles, California ''^Departments of Urology and Pediatrics ^University of California, Los Angeles School of Medicine and Jonsson Comprehensive Center Los Angeles, California I. Introduction The development of molecular therapeutics for the treatment of human disease has a rational and predictable course. Because these therapeutics are generally derived from an understanding of molecular mechanisms underlying a disease process, the treatment strategies are hypothesis-driven and specifically targeted toward a pathway underlying the molecular and cellular pathogenesis. Accordingly, in addition to establishing therapeutic efficacy, the evaluation of a molecular therapeutic also confirms the importance of a specific genetic or biological pathway in the pathogenesis of a disease process. The evaluation of a molecular therapeutic typically begins by providing a molecular/cellular proof of concept in vitro, followed by an expansion of therapeutic princi ples and toxicological analyses of the intervention in animal models, and finally a systematic sequence of safety and clinical efficacy trials in human subjects. Logically, gene therapy paradigms using adenoviral (Ad) vectors can be expected to proceed along this course in order to be considered for the treatment of human disease. This chapter will focus on the use of animal ADENOVIRAL VECTORS FOR GENE THERAPY 5 3 3 Copyright 2002, Elsevier Science (USA). All rights reserved. 5 3 4 Batra ef al. models in the process of evaluating adenoviral gene transfer strategies for the treatment of human cancer. In this respect, we v îll offer a personal perspective, concentrated on outlining principles rather than cataloging indi vidual
examples. Because the focus is on principles, the revievŝ v îll not be an inventory of the various experimental therapeutic strategies for cancer that utilize the adenoviral vector, although specific examples may be cited. Rather, ŵ e w îll use our background and experience to illustrate the prob lems inherent in testing experimental hypotheses in animal models of cancer, w îth the confidence that themes particular to our research may have broader applicability. Last, because the authors have an interest in utilizing Ad-gene transfer techniques for the treatment of lung and prostrate cancer, respectively, this chapter will emphasize experimental designs relevant to those clinical entities. A primary goal of in vivo/animal experimentation is to build on an in vitro proof-of-concept and to strengthen the rationale for clinical testing of an experimental therapeutic intervention. To justify animal studies, there should already be an existent pathophysiological rationale and/or in vitro experimental data suggesting that a strategy is likely to be effective. At this juncture, the investigator is faced w îth the formidable challenge of approximating a human disease in an animal model. Although animal models cannot be exact replicas of the human disease, they should, at the very least, provide useful molecular and cellular similarities to the pathogenesis and clinical manifestations of the target disease [1]. For a variety of reasons (low expense for breeding and maintenance, susceptibility to tumorigenesis, well-defined immunosuppressive states, feasible duration of experimental studies, etc.) mice are considered to be the prototypic animal model for experimentation. Ideally, a mouse model would mimic the target human disease in its etiology, genetics, clinical presentation, and progression. To model human lung cancer, for example, the ideal mouse model would systematically (in defined pathological stages) develop lung cancer from exposure to cigarette smoke, and the disease could be characterized by sequential gene defects that culminate in the clinical progression that typifies the human disease. Second, in designing the experimental approach, the investigator must also take into consideration the "pharmacological intervention or drug" (the Ad vector here) that is being tested. Because the ideal drug should have reliable delivery, specific targeted distribution and mechanism of action, and predictable elimination, the challenge to test an adenoviral vector based ther apeutic in an apt animal model becomes particularly daunting for a gene therapist. Thus, to test whether an Ad-based therapeutic will have efficacy for the treatment of human cancer, we must (1) model the complex human disease in vivo and then (2) test a multifaceted biological compound with ill-defined pharmacokinetic and pharmacodynamic properties that are likely 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 3 5 unique to the host and/or the disease state. In order to overcome the inher ent complexity of the problem, we have adopted an approach that uses a combination of models to overcome specific deficiencies that accompany each individually. Consequently, v ê utilize xenogeneic models (engraftment of het erologous tissue derived from donors of a different species, typically into an immunodeficient host) to study the therapeutic-gene effects and Ad vec tor-target cell interactions. Syngeneic (engraftment of tissue from genetically identical donors) and allogeneic (engraftment of tissues from a genetically dissimilar member of the same species) models are used to study host-tumor interactions in terms of immunological parameters and metastasis. To further discern the specific immunologic parameters important for tumor rejection in mice, specific knockout (targeted gene disruption) mice are utilized. Last, we extensively utilize transgenic (in this context, referring to the tissue-specific expression of a transforming oncogene) models to study the effects of a molec ular therapeutic in the setting of established orthotopic (referring to organ- or site-specific) malignancy. We believe that integrating the results of these indi vidual approaches w îll enable us to meet the goals of in vivo experimentation for advancing adenoviral gene therapy. II. Animal Models of Lung Cancer A. Human Lung Cancer Lung cancer is the leading cause of cancer-associated mortality in both men and w^omen. Although susceptibility to environmental carcinogens may be predetermined and foUov^ a pattern of autosomal dominant Mendelian inher itance [2, 3], lung cancer results from an accumulation of acquired genetic mutations [4-6]. In fact, it is suggested that 10-20 genetic mutations may be necessary for the development of lung cancer [7], although the discrete steps for the progression of a hyperplastic bronchial lesion to metaplasia and anaplasia have not been uncovered. Tobacco use is the strongest epidemiologic risk for the development of lung cancer and it is anticipated that approximately 10% of all smokers w îll develop lung cancer over their lifetime [8]. Current paradigms predict that lung cancer results from the w^idespread exposure of the carcinogen, leading to a process of "field cancerization," w^hereby the entire aerodigestive track is exposed to the offending agents and leads to the occurrence of synchronous and metachronous tumors [9]. The tobacco carcinogens apparently invoke the multiple clonal chromosomal abnormalities found throughout the airw^ays and alveoli of smokers [10, 11]. Following, the series of genetic mutations likely results in patterned aberrancies in signal transduction and cell-cycle pathw^ays, eventuating in malignant and metastatic phenotypes [12]. The general pattern of genetic changes are characteristic but 5 3 6 Batra ef a/. not specific for pathologic subtypes of lung cancer (see below). Overall, K-ras mutations are observed in 20-50% [13], p53 mutations are present in 50% [14], 60% exhibit reduced expression of pl6-ink4a [15, 16], and 30% show deletion of Rb, Small-cell lung cancers (SCLC) display a greater proclivity to c-m);c-amplification and a greater degree of p53 (80%) and rb mutations (90%). Chromosome 3p deletions, occurring at a chromosomal fragile site that includes the FHIT locus, are found in 50% of non-small-cell lung can cers (NSCLC) and in 90% of SCLC primary tumors [17]. Overexpression of the tyrosine growth factor receptor erbB2-neu is seen in 10-30% and overexpression oi bcl-2 [18] in 10-25% of NSCLC tumors [19]. Clinically, lung cancer is discriminated into SCLC and NSCLC categories by histopathology or cytopatholgy and by their characteristic clinical presenta tions and divergent responses to conventional cytoreductive therapies. NSCLC may be further subclassifed pathologically into squamous cell (SCCa), adeno carcinoma, broncho-alveolar cell carcinoma (BAC), adenosquamous (mixed pathology), or large-cell carcinoma. As noted above, the progression of lung cancer from a premalignant state to the clinical/pathological entity that is diag nosed in the vast majority of patients is unknown. This is because although the disease is prevalent, it is typically diagnosed when it has already spread outside the lungs and is pathologically advanced. Not surprisingly, because of the late stage of diagnosis, progressive genetic instability confers marked genetic and phenotypic heterogeneity within lung cancers, even in individual patients. The late stage of diagnosis also results in an absolute lack of premalignant material, making it difficult to assign specific roles for the genetic mutations in the systematic progression of lung cancer. Recently, however, some of the characteristic genetic mutations of lung cancer (e.g., loss of heterozygosity at chromosome 3/?, /?53 mutations) are being identified in microdissected dysplas- tic epithelium [20]. Similar observations are implicating the characteristic K-ras abnormalities in lung cancer as a correlate of mucinous differentiation [21]. A precursor to lung adenocarcinoma, a lesion pathologically termed alveolar atypical hyperplasia or AAH, is being advanced. AAH is described by increased cellular proliferation when compared to adjacent normal parenchyma and by immunohistochemical evidence of p53 stabilization, K-ras mutations, and c-erb-B2 overexpression [22-24]. The presence of these mutations in AAH may explain why such mutations may be detectable in sputum cytology spec imens that predate the onset of clinical lung cancer [25]. Identification of these early events are a particular focus of study because they may serve as genetic markers for malignant progression, or as targets of specific genetic or chemopreventative approaches. More relevant to this discussion, perhaps, these early events may be better modeled in murine models than late stage lung cancer (see below). Thus, there exists an inherent complexity in human lung cancer, and to precisely recapitulate the disease process in animals is not practical. 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 3 7 B. Animal Models of Human Lung Cancer 1. Murine Lung Cancer and Transplantable Allografts Due to time of model development, ease of experimentation, and cost restraints, murine models of disease are the accepted standards. However, there are generic shortcomings in this approach. For example, cigarette smoke, w^hich is a strong epidemiological risk for the development of human lung cancer and is proximally responsible for approximately 85-90% of lung cancer cases in humans [26], is only w^eakly carcinogenic in mice [27, 28]. In addition, although both mouse and human lung adenocarcinomas may share common molecular defects [27], the histopathological repertoire of spontaneous or induced tumors in mice is very limited [29, 30], and morphologically, nearly all mouse lung tumors bear structural similarities only to BAG or well- differentiated adenocarcinomas. Consequently, whereas humans typically die from lung cancer of "late stage" metastatic disease, mice succumb to respiratory failure following the diffuse involvement of their lungs by "early stage" carcinoma in situ [1]. Spontaneous lung cancer develops in 3% of wild mice [31, 32] with strain-dependent sensitivity. Clones have been isolated from spontaneously arising tumors, and established as cultures in vitro. These cultures now serve as a readily available source for the generation of transplantable allografts. Many investigators, including our group [33-38] have extensively utilized line 1 alveolar carcinoma (L1C2), a murine lung cancer cell line that is syngeneic to BALB/c, and 3LL (Lewis lung cancer), which is syngeneic to C57B1/6. Usually, these cell lines are utilized to generate transplantable heterotopic (referring to a location outside of the organ of origin, typically subcutaneous) tumors in syngeneic mice. Our group has utilized these models to investigate, in general, the interplay between the immune system and the host. Both L1C2 and 3LL tumors are relatively "nonimmunogenic," as is human lung cancer, and immunogenetic strategies that modulate the immune system to generate an anti-tumor immune response can be systematically investigated in these models. However, other lung tumor-allografts, especially when cells are selected to express "marker antigens" to enable their easy detection in culture systems, may indeed become immunogenic. Notably, the transplantable allograft system is artificial, and all recipient hosts have a "stress" response to the implanted tumor that cannot be recapitulated in control animals. In addition, extrapolating anti-tumor responses in mice to humans is not a straightforward proposition, and many therapies that reliably "cure" tumors in inbred strains of mice are not as effective in humans. In part, these differences may be attributable to differences in immune responses in the two hosts. For example, cluster determinants (CD-antigens) in murine strains may not have homologous or functional cellular analogs in the human host. Laboratory animals used for medical experimentation are genetically inbred strains with reliable phenotypic characteristics. Although this feature 5 3 8 Batra et al. imposes a generic limitation on the extrapolation of results in lab animal studies to outbred populations, and thus, human disease, there are signifi cant advantages that need to be considered. The inbred nature of laboratory animals enable investigators to reliably establish disease in an animal host, and subsequently to study that disease process in controlled subsets. With respect to tumorigenesis, murine-A/J and SWR strains are the most sensi tive, BALB/c is of intermediate sensitivity, and DBA and C57BL/6 are the most resistant. Crosses betw^een susceptible and resistant inbred mouse strains may allows for the mapping of modifier loci for the development of lung cancer [39]. For example, it is reported that the propensity of strains to develop lung tumors correlates w îth a polymorphism in the second intron of K-ras [40]. Practical experience suggests that there are common genetic alterations affecting known tumor suppressor genes and proto-oncogenes occur during mouse lung carcinogenesis. Molecular abnormalities may also be shared w îth human lung cancer, and K-ras activation is a conspicuous example [41]. Human adenocarcinomas commonly carry K-ras mutations; most of these mutations are in codon 12 and are transversions of GGT to either TGT or GTT. It is postulated that these mutations occur early in lung cancer pathogenesis since they can be detected in sputum samples of smokers prior to the clinical diagnosis of lung cancer. Analogously, 80 to 90% of both spontaneous and chemically induced murine lung tumors con tain K-ras mutations. Moreover, K-ras mutations also occur early in murine
lung tumorigenesis, and remarkably, codon 12 is the site of genetic change induced by many chemical carcinogens [1]. Furthermore, a consistent loss of mouse chromosome region 4, an area that contains the mouse homolog of the human pl6-ink4a [42, 43], has been described to result in an allelic loss of the pl6-ink4a seen in 50% of mouse adenocarcinomas. Similarly, p53 mutations are found, albeit infrequently [44], although mouse chromosomal regions containing p53 and Rb more commonly exhibit LOH [43]. Reduced expression of Rb and pl6 and increased c-myc expression [39] have also been reported. These commonalties have suggested some to conclude that mouse and human lung carcinomas are sufficiently similar for the murine model to be informative [1], and have formed the rationale for the testing of chemo- preventative strategies [39] in mice. Analogously, these commonalties may be advanced to form the basis for the testing of genetic therapies in murine tumors as w êll. Mice strains also vary with respect to inducible-tumorigenesis. Generally, mice that are sensitive to the development of spontaneous lung tumors are also at the highest risk for chemically induced tumors [31] and form the basis for the quantitative carcinogenecity bioassays. Although a variety of agents, including urethane, metals, and concentrated components of tobacco smoke such as pol- yaromatic hydrocarbons and nitrosoamines [45, 46], can induce lung cancer in mice, tobacco smoke per se is only weakly carcinogenic [28]. Murine lung 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 3 9 tumors histologically resemble early lesions that originate peripherally (from type 2 alveolar cells or Clara cells) and simulate papillary or bronchioloalveolar cell cancer (BAG). In contrast, the bulk of human tumors are bronchogenic (arise in the airways) and, as described above, display a broad histopathologic variation. In fact, individual human lung cancers may be histologically hetero geneous; i.e., they often display mixed morphologies v^ithin the same tumor specimen. So how^ does one reconcile these differences betv^een murine lung cancer and human lung cancer, and moreover, can one generalize observations and results from one species to another, or even from one human being to another? When considered in the context of adenoviral gene delivery, there is a limiting paucity of in vivo data to generate any broad conclusion. On the contrary, our observations in vitro suggest that gene transfer into subtypes of human lung cancer is highly variable, and strategies directed toward achiev ing intratumoral gene transfer may require patient or disease-specific vector formulations [47]. The biological heterogeneity of human lung cancer drives our inves tigations along specified pathways, utilizing many different models and strategies to come up with viable treatment approaches. For instance, we believe that a systematic assessment of the efficiency and optimal route of adenoviral gene delivery in vivo into murine lung tumors and trans planted human xenografts needs to be performed. Researchers are beginning to identify the Ad-cellular attachment receptor (termed the Coxackievirus- adenovirus receptor (CAR) [48]) as a major determinant underlying effi cient transduction [49]. Along these lines, the scope and "polarity" of CAR expression in tumors in vivo needs to be defined. Thus, one focus of our program is to systematically evaluate gene transfer into these model sys tems using conventional and retargeted adenoviral vectors with the aim of optimizing a vector system and a mode of delivery. This focus evolves from the premise supported by our in vitro data that the histological heterogeneity of lung tumors may be a harbinger of variable responsive ness to both adenoviral entry and/or the efficacy of adenoviral gene ther apy [47]. Because uniform targeting of tumor in vivo may be unattainable, we have also generated protocols in which the Ad-vector is used in pre cisely controlled ex vivo "dosing" approaches to genetically modify antigen- presenting cells (APCs) or tumor cells to vaccinate the host against their tumor [37]. 2. Murine Models That Spontaneously Develop Lung Cancer Murine models of lung cancer include strains susceptible to chemically induced tumors and transgenic strains that express viral and cellular onco genes. The simian virus-40 large T-Ag (SV40-TAg) has been commonly used to produce tumors in transgenic mice [50, 51]. SV40-TAg binds and inca pacitates the cell cycle checkpoint and DNA-binding capabilities of the p53 5 4 0 Batra ef aL and Rb gene products, resulting in uncontrolled cellular proliferation [52]. To develop a murine model of lung cancer, Wikenheiser and colleagues chose to express the SV40-TAg under the transcriptional control of the lung-specific human surfactant protein C (SP-C) promoter in transgenic mice [53, 54]. They demonstrated that these mice consistently developed multifocal lung adenocarcinomas that had pathological features similar to some human lung adenocarcinomas, and that the mice succumbed to respiratory distress by age 4 - 5 months. As expected, the transgenic animals developed no tumors in any other organ systems, although some nonmalignant tissue also expressed the transgene [53]. Within the lungs, tumors consistently involved the bronchi- olar and alveolar regions of the lung while sparing the large airw^ays. The tumors of these mice also varied w îth respect to the expression of the large TAg, suggesting perhaps that SV-40 TAg may contribute to transformation, but continued expression may not be necessary for tumor progression. Like wise, organ-specific expression of SV40-TAg using the regulatory regions of uteroglobin [55] and the Clara cell-specific Mr 10,000 protein (CC-10) also results in the induction of lung tumors [56]. Uteroglobin is a marker protein for the nonciliated epithelial Clara cells, the source of xenobiotic metabolism in the lung, lining the respiratory and terminal bronchioli of the lungs. In animals expressing SV40-TAg under the uteroglobin promoter control, the pulmonary epithelium was morphologically normal at 2 months, dysplastic by 4 months, and transgenic animals were described as developing multifocal pulmonary adenocarcinoma present in various stages of differentiation by 5 months of age. In situ hybridization studies suggested that tumors did not contain the transcripts of the uteroglobin gene, and again, late stage tumors lost expression of the large T-Ag. Tumors also formed in the urogenital tract where uteroglobin is also expressed. Transgenic mice were also generated using the CCIO kDa promoter driving SV-40 large T-Ag [56]^ and it is in this model that we have chosen to test the immunomodulatory capacity of secondary lymphoid chemokine or sic [36]. In the 7736 mouse fine, CC-lOTAg-transgenic mice develop multifocal pulmonary adenocarcinomas and succumb to respiratory failure at 16-20 weeks of age. Pathology is localized to the lungs, and the tumors express the large T-Ag in normal Clara cells and in transformed tumor cells. Pathological progression is similar to that described above, with the lungs appearing morphologically normal at 2 months of age, a number of tumor foci are grossly discernable by 3 months, and the majority of the lung is replaced by coalesced nodules by 4 months of age. As tumor progresses, the expression of endogenous CCIO expression diminishes, and there is increased nuclear p53 expression, suggesting binding and stabilization of the protein by the large T-Ag [56]. From our standpoint, we have found that the reliable progression of lethal tumors in these transgenic mice enable us the test a number of hypotheses, dosing schemes, and dosing routes. Importantly, the effects of immunomodulation by 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 4 1 the gene transfer of specific cytokines and chemokines into tumor cells in vivo can be determined. Moreover, one can compare this direct-delivery strategy W\t\\ alternative approaches, including ex vivo modification of autologous APCs using recombinant Ad-vectors. The subsequent reintroduction of gene- modified APCs back into the tumor environment overcomes the inability of dendritic cells to maturate in the presence of tumor in vivo [57] by providing functional APCs that are capable of processing and presenting tumor antigens to cytolytic T cells in vivo [6]. 3. Murine Models vŝ ith Transplantable Xenografts Xenotransplantation of human tumors into immunocompromised mice began in the late 1960s [58] follov^ing the discovery of the nude mouse in 1962 and its characterization as an athymic mutant in 1968 [59]. The morphologic and karyotypic stability of tumors serially passaged in nude mice v^as described [60], and it v^as established that xenotransplanted tumors in nude mice often retained distinctive phenotypic and functional characteristics found in the human host [61]. However, the "tumor-take" rate for nude mouse xenotransplants is tumor-specific, and generally, carcinomas are more difficult to estabUsh than melanomas or sarcomas [62]. Thus, progressive tumor grow^th from inoculated primary tumors (i.e., cultured directly from the patient) is observed in only 33% for lung cancers [61, 63] and is virtually nil for primary breast or prostate cancers. In addition to properties inherent to the tumor, nude-mouse-related factors also impact on tumor take. For example, mice infected W\t\v the mouse hepatitis virus do not accept xenotransplants, presumably because of enhanced NK-cell activity [64]. In this regard, it is important to recall that although nude mice lack functionally mature T cells, they are capable of mounting normal humoral responses to T-cell-independent antigens [65] and they exhibit high NK-cell activity [GG]^ and these properties probably impact negatively on the tumor-take rate of xenotransplants. The high NK-cell activity also abrogates the metastatic potential of implanted tumors, and the incidence of metastasis is higher in mice Wixh lov^er NK cell activity, e.g., young (3-week-old) syngeneic mice or the beige (bgV bgO mutants derived from the C57BL/6 mice [67, 68]. The discovery of a severe combined immunodeficiency in mice [69] offered yet another option for hosting human tumor xenografts. The scid/scid mice are characterized by the virtual absence of functional T and B lumphocytes due to aberrancies in the rearrangement of antigen receptor genes [70]. The first successful engraftment of human solid organ tumors into scid mice began w îth the subcutaneous inoculation using the A549 lung adenocarcinoma cell line [71]. Since that time, a variety of human solid-organ cancers, both from cell lines and primary tumor specimens, have been successfully engrafted [72]. The higher rates of successful engraftment, presumably because of the lack of residual B-cell function in scid mice, have led many investigators to prefer 5 4 2 Batra ef al. scid/scid mice over nuinu mice as the host recipients of human xenograft tumors. Xenografts are still impacted upon by the scid host's innate immunity, and NK and monocyte/macrophage activities can be upregulated in these hosts. For specific needs, selective breeding of other available mutants (beige mutants with reduced NK-cell activity and osteopetrosis with altered macrophage differentiation) enables the generation of strains that harbor overlapping defects in immune function [73]. Furthermore, genetic engineering and gene- targeting technology has helped create murine-mutants with exquisitely specific immune defects, including mice in which CD4 or CDS T cells are deleted [74] and mice which lack p-2 microglobulin and thus do not express transplantation antigens \1S\. Xenotransplants have many advantages, the primary being that they provide a replenishable source of human tumor. This enables the genetic characterization and gene discovery of tumor-specific phenotypes and, in rare occasions, the progression toward an advanced or metastatic phenotype of the tumor (e.g., from an androgen-dependent prostate tumor to one that is androgen independent, see below). Xenografts incorporating human tumor cells in immune-deficient mice are plentiful. For example, we have devel oped a novel animal model mimicking intrapleural malignancy that allows for a controlled, focal dosing of reagents and evaluation of therapeutic ben efit [76]. The model is composed of 2.5-cm segments of rat intestine that is denuded, and then everted so that the serosal surface is converted into the lumenal surface of a tube. Lung cancer cells are instilled into the lumen via a polyethylene cannula on day - 1 , allowed to adhere to the serosal sur face overnight, and this tubular xenograft is implanted into the interscapular subcutaneous tissue of a nude mouse on day 0 \J(i\ The graft simulates metastatic tumor growth on the pleural surface basal lamina both grossly and histopathologically and enables robust quantitation of tumor kinetics \1G\. The appearance of tumor on this surface is nodular, and these nodules coalesce over time with intervening fibrous stroma. Neovascularization is evident on histological exam of the graft, and tumor growth is continuous with a vari ety of NSCLC cell lines. We have found this model to offer certain tangible advantages. For example, with respect to the transduction characteristics of tumor, the value of this model is evidenced
by the following: (1) the cells are representative of human lung cancer; (2) the location of the tumor is precisely known and tumor is directly accessible; (3) the vast majority of cells that repopulate the graft are derived from those instilled (host leukocytes and fibrocytes comprise the remaining minority); (4) the mode of delivery of reagents (fluid inoculation rather than intratumoral injection) is designed so as to be clinically applicable for installation into pleural space; (5) the size of the xenograft enables quantitative assessments of transgene expres sion and morphometry simultaneously, containing human tumor into nude mice \7(i\. 18. Utility of Ad Vectors in Animal Models I: Cancer 5 4 3 C. Gene Therapy of Lung Cancer Using Adenoviral Vectors 1. Gene-Based Therapies Targeting Molecular Transformation Abnormalities at the cell surface (e.g., erbBI), signal transduction (e.g., ras -oncogene), gene regulation and cell cycle control (e.g., /?53, Rfo, c-myc- oncogene), or apoptosis (e.g., p53, BCL-2) are all implicated in the process of transformation and can serve as targets for rational therapeutic intervention. For example, to overcome the deficits due to mutated p53, one strategy for lung cancer gene therapy has opted to replace the mutated p53 gene v^ith a normal copy [77]. Restoring p53 function in these cells has led to decreased tumorigenicity of human cancer cells in vitro and in animal models [78, 79]. Based on these preliminary studies, the first clinical gene therapy trial for human NSCLC also utilized a /?53-gene transfer strategy [77]. In this study, nine patients with advanced NSCLC vv̂ ere treated w îth either bronchoscopic or percutaneous CT-guided injections with a retroviral p53 expression vector (a genetically reengineered retrovirus that is designed to integrate into the cell genome and express the normal /?53-protein). Of the seven patients evaluated, three showed evidence of tumor regression at the treatment site and six showed increased apoptosis of tumor cells on posttreatment biopsies. Importantly, there was no significant toxicity associated with the therapy, and in situ gene transfer was achieved. However, limited therapeutic efficacy was observed and the mechanisms responsible for the anti-tumor effects are still under study. For example, although it was originally believed that mutated p53 function would have to be compensated in each and every cell for restoration of the normal apoptosis-program, the results suggested otherwise. Because there was substantive tumor regression despite poor in situ gene transfer, mechanisms for the observed "bystander effect" were hypothesized [80]. The term "bystander effect" refers to the ability of gene-modified tumor cells to mediate killing of neighboring nontransfected cells. One plausible explanation is that wild-type /?53 induces release of angiostatic factors, thus undermining the blood supply to the tumor [81]. In addition, the expression of p53 may also contribute to an immune-mediated response [82, 83]. These issues have led to more mechanism-based bench and animal studies, as well as other phase 1 clinical trials using Ad vectors encoding the p53 gene for a variety of cancers, including lung tumors [84]. Because of the high frequency of p53 mutations, another strategy that uses replication-competent viruses has been hypothesized to be ideally suited for lung cancer. This approach employs adenoviruses (mutant dll520 or ONYX-015) that are suggested to selectively replicate in p53-mutated (there fore, selectively in cancer) cells [85, 86]. Consequently, these mutant viruses are promoted as "magic bullets" that kill tumor cells and leave normal tis sues intact. This particular approach has generated considerable controversy 5 4 4 Batra ef aL both in terms of its reputed efficacy as well as its proposed mechanism of action [87-89]. In brief, its effectiveness in both in vitro and in vivo models of lung cancer needs to be confirmed. Nevertheless, the approach represents a prime example of a novel hypothesis-driven strategy that attempts to exploit the biology of a mutant virus to clinical advantage. 2. Immunogene Therapy Effective immunotherapy has the potential for systemic eradication of disease, a payoff that is especially enticing for the treatment of lung cancer. Pre vious, largely unsuccessful immunomodulatory campaigns utilized nonspecific immune strategies (e.g., BCG adjuvants). Increasingly, the interest now is in developing specific immune interventions for lung cancer. The major obstacle for effective immunotherapy of lung cancer has been a meager understanding of the immunobiology of this disease. However, a better understanding of the reciprocal interaction between the tumor and the immune system is starting to emerge, lending itself to plausible hypotheses for intervention. We realize that an effective aniti-tumor response may either provoke the immune system to recognize and attack the tumor, or conversely, it may serve to reduce the immunosuppression encumbered upon the host by the tumor. Specific and effective anti-tumor immunity requires both adequate tumor- antigen presentation and the subsequent generation of effector lymphocytes. A variety of cytokines have been investigated to implement such a program in situ [90-97], and many of the studies have utilized the Ad-vector for gene delivery. For several reasons, our efforts have focused on IL-7, IL-12, and more recently on the chemokine sic, for the treatment of lung cancer. The rationale underlying the use of these particular cytokines and chemokines is that they all optimize conditions for tumor antigen processing and presentation by the host's APCs, and they help appropriately localize and sustain the effector lymphocytes response [36, 37, 97, 98]. Although the cellular infiltrates differ depending on the cytokine and model used, many studies indicate that tumor cells that have been transfected with cytokine genes can generate specific and systemic antitumor immunity in vivo. Based on these promising animal studies, what prevents these strategies from being translated into successful and curative human clinical trials? One major problem in human cancer patients may be that although lung cancers express tumor antigens [99], they are ineffective as APCs [100]. Tumor cells cannot function as APCs because (i) they lack costimulatory molecules, (ii) they are unable to adequately process Ag, and (iii) they secrete a variety of inhibitory peptides which promote a state of specific T-cell anergy. Thus, even for highly immunogenic tumors, professional APCs are required for antigen presentation [101]. As described above, local augmentation of IL-7 and IL-12 may help to overcome some of these defects [37]. In addition, one may bring into the tumor environment professional APCs to orchestrate a satisfactory 18. Utility of Ad Vectors in Animal Models I: Cancer 5 4 5 immune response against the tumor. In this regard, dendritic cells (DCs) are potent APCs that are ideal for interacting with and activating naive T cells to generate antigen-specific immunity [102, 103]. Recent advances in the isolation and in vitro propagation of DC has stimulated great interest in the use of these cells for clinical cancer therapy [104, 105]. In such approaches, DC may be envisioned to serve as vehicles for genes expressing antigens [106] or expressing cytokines in lung cancer gene therapy [33]. In addition, DC-based immunogenetic therapies may be used in combination v^ith other strategies that have been optimized for Ag presentation [34, 37]. Importantly, of the various approaches tested to gene modify the DCs, our colleagues at UCLA have determined that the Ad-vector is best suited for DC-transduction [107]. 3. Targeting Tumor Invasion and Angiogenesis Overcoming metastatic disease is paramount for effective lung cancer therapy, and the biology underlying metastasis is gaining clarity. Metastasis is a process involving several complimentary yet distinct elements, including the capacity for tumor cells to invade and traverse the basement membrane, and to reestablish viable tumor foci in distant organs. Each step in this process may serve as a point for therapeutic intervention in lung cancer. As the molecular biology becomes better understood, the opportunity to incorporate specific genes into vector systems invariably materializes. The initial step, tumor invasion, requires proteolysis, v^hich has been suggested to be mediated by an overexpression and secretion of matrix metalloproteinases (MMPs) by lung cancer cells [108-111]. Therapeutically, gene transfer strategies have incorporated tissue inhibitors of metalloproteinases (TIMP) to inhibit invasion and metastasis [112], or have utilized antisense abrogation of MMPs to inhibit tumorigenicity [113]. Similarly, angiogenesis (induced grow^th of blood vessels) is suspected to be critical for tumor survival and progression at each stage of metastasis [114]. Angiogenic progression in lung cancer is felt to be due to an imbalance of angiogenic and angiostatic factors, and the risk of metastasis in NSCLC directly correlates v^ith the extent of tumor-derived angiogenesis [114]. Thus, strategies that inhibit of angiogenic mediators or restore angiostatic factors have potential utility for all stages of lung cancer [115-119]. The important mediators implicated in promoting or inhibiting angiogenesis lend themselves favorably for inclusion into gene therapy strategies. For example, recent studies indicate that vascular endothelial growth factor (VEGF) is an important angiogenic factor produced by a variety of tumors, including lung cancer. Lymph nodes with NSCLC metastases express significantly higher levels of VEGF than do normal, uninvolved nodes [120], consistent with the speculation that VEGF plays an important role in the metastasis of lung cancer. In addition to VEGF, recent studies have also implicated CXC chemokines in the abnormal angiogenic/angiostatic balance in NSCLC [121]. Members of 5 4 6 Batra ef at. this family containing the ELR motif (e.g., IL-8) are angiogenic, whereas those that lack this motif (e.g., interferon-inducible protein 10; IP-10) are angiostatic. Accordingly, neutralizing antibodies to IL-8 reduce angiogenesis and consequently the growth of human lung tumors in scid mice [122]. Other molecular strategies to specifically target angiogenic vessels are also being developed. For example, the adhesion protein av^s is relatively specific for angiogenic vessels where it mediates endothelial cells interaction with extracellular matrix components [123] and enables cell motility [124]. Importantly, its blockade can promote tumor regression in vivo in lung cancer models by inducing apoptosis of tumor-associated blood vessels [125]. More recently, phage-display peptide libraries, which are used to screen the specific binding of a massive array of peptides, have isolated small peptides which selectively bind to receptors (including avPa) on angiogenic vessels. Conjugat ing these peptides to chemotherapeutic agents have enabled investigators to specifically target tumor vasculature and abrogate tumor growth [126]. 4. Adjuvants to Conventional Therapeutic Approaches for Lung Cancer Conventional multimodality therapy for lung cancer incorporates surgery, radiation, and chemotherapy using a variety of clinical protocols dictated by the subtype and extent of disease. Theoretically, gene therapies may play important synergistic roles in augmenting the effectiveness of conventional approaches. For many such strategies, there already exists a scientific rationale to test them in combination with conventional multimodality therapy. For example, one may enhance the radiation-sensitivity or chemosensitivity of tumor cells (e.g., p53 or iKBa gene therapy) [127, 128] or modify normal tissue susceptibility to cytoablative therapy (e.g., mucosal/tissue protection: by virtue of MDR-1 or bFGF gene transfer). Examples of synergism with the suicide gene therapy approaches have also been studied. The HSV thymidine kinase gene/ganciclovir system induces radiation sensitivity into transduced tumor cells [129], suggest ing that these two forms of therapy can be combined to potentiate antitumor responses [130]. Similarly, tumor cells transduced with the cytosine deaminase transgene exhibit enhanced radiation sensitivity following pretreatment with 5-fluorocytosine [131]. Because the loss of p53 function can result in tumor resistance to ionizing radiation [132], restoring p53 function may restore apop- totic pathways and promote effective radiation or chemotherapy. In fact, gene transfer of wild-type p53 has been shown to enhance radiation sensitivity [133] and can act synergistically with as-platinum-based chemotherapy to augment cytotoxicity [134]. Many of the approaches outlined above as being strategies for gene therapy of 'lung cancer" are generic; these approaches can be generalized to a variety of malignancies since transformed cells have in common the same aberrant growth regulatory and signal transduction pathways. The molecular 18. Utility of Ad Vectors in Animal Models I: Cancer 5 4 7 and cellular pathogenesis of tumor invasion and immune evasion are also similar betvs^een tumors originating in diverse organ systems. Unfortunately, this commonality may not confer a broad-based advantage w^hen gene therapy strategies are advanced clinically. In this respect, vectors need to provide both efficient gene delivery as w êll as tumor specificity, and as a result, the gene trans fer strategies have to become "disease specific." Targeted vectors (as discussed elsew^here in this compilation) have to incorporate features rendering them capable of selective cell surface adherence or entry or, alternatively, express their therapeutic transgenes under tumor-specific regulation. Unfortunately, a lung cancer-specific cell surface target (for transductional targeting)
has not been identified, and one is left trying to use targets that are generally over- expressed in tumor cells or tumor-induced endothelium 1135, 136]. Similarly, lung cancer also does not express a specific tumor marker. Thus, transcriptional targeting approaches largely utilize elements that are "tissue-specific" rather than "cancer-specific." Accordingly, constructs where transgene expression is regulated by tissue-specific promoters (e.g., SLPI, SP-A, CC-10) are being actively developed and tested. III. Animal Models of Human Prostate Cancer A. Human Prostate Cancer After lung cancer, cancer of the prostate (CaP) is the second most com mon cause of cancer death in American males. A latent disease, many men have prostate cancer cells long before overt signs of the disease are apparent. The annual incidence of CaP is over 100,000 in the United States, of w^hich over 40,000 w îll die of the disease. Nearly a third of patients present with locally advanced or metastatic disease, and androgen deprivation therapy forms the basis of conventional therapy for the majority of these patients. How^ever, cur rently available approaches for advanced CaP are not curative [137], primarily because the cells lose their dependence on androgenic stimulation. The mech anisms of progression of CaP cells to hormone independence under androgen ablation therapy remain unclear. To investigate the factors and mechanisms that underlie the development of androgen resistance and metastasis, reliable in vivo models that mimic human CaP progression are essential. Moreover, it is critical that tumor models mirror the pathology and cellular and molecular characteristics of human CaP if it is to serve as a useful tool for basic research, drug screening, or the evaluation of new therapeutic strategies. B. Spontaneous and Transgenic Models of Human Prostate Cancer Currently, a single animal model cannot epitomize the multifaceted aspects of CaP pathogenesis and progression. Rodent models of prostate 5 4 8 Batra ef al. carcinoma have been developed by hormone treatment [138], spontaneous development [139], transgenic prostate-specific oncogene expression [140], and knockout of CaP-tumor suppressor genes [141]. However, these mod els are largely inadequate in recapitulating the progression of human disease as bone metastasis, [142] the major cause of chnical morbidity attributable to CaP. Despite pitfalls, the mouse transgenic TRAMP model has been useful for studying the development and progression of prostatic adenocarcinoma. TRAMP mice, generated by expressing SV40-T antigen specifically in prostatic epithehum [140], develop prostatic intraepithelial neoplasia (PIN) by 10-12 weeks of age and eventually progress to adenocarcinoma with metastasis to lymph nodes and lungs [143]. As in human disease, androgen ablation therapy in these mice contributes to the emergence of androgen-independent disease with a poorly differentiated phenotype [144]. C. Xenograft Models of Human Prostate Cancer As for lung cancer, investigators have chosen a number to utilize xenograft models of CaP. Unfortunately, CaP xenografts are far more fas tidious than lung cancer xenografts, and the generation of models that are representative of typical human disease has only recently been accomplished. Until recently, the majority of research conducted for CaP relied on the cell lines PC-3, DU145, and LNCaP. Among these, only LNCaP cells exhibit androgen responsiveness and express the prostate-specific antigen (PSA) and androgen receptor (AR). Thus, the relevance of DU-145 and PC-3 cells to clinical CaP has been questioned. To overcome the shortage of represen tative models of human CaP, a number of investigators began establishing xenografts in immune-deficient scid/scid mice using samples obtained directly from patients [145-149]. These xenografts offered the following advantages: (1) the expansion of small amounts of starting clinical material, (2) the enrich ment of relatively homogeneous cell populations from heterogeneous tumor cell populations, (3) the ability to investigate progression to metastasis and androgen independence [145, 146, 148], and (4) representative diversity that provided a more realistic picture of the heterogeneous nature of this disease. Investigators at UCLA established six distinct CaP xenografts from patients with locally advanced or metastatic diseases into scid/scid mice. Two of these xenografts, LAPC-4 and LAPC-9, have been maintained continuously for more than 2 years by serial passage in scid/scid mice [145, 146], and LAPC-4 has also been successfully established as a cell line in tissue culture to enable correlation with investigations performed in vitro, [145]. LAPC-4 and LAPC-9 offer several advantages over previous models; both express the wild-type androgen receptor (AR), both xenografts have intact AR-signal transduction pathways, and both secrete high levels of the androgen-dependent protein PSA. Accordingly, they grow as androgen-dependent cancers in male scid mice 18. Utility of Ad Vectors in Animal Models I: Cancer 5 4 9 and respond to androgen ablation treatment, but interestingly, they eventually progress to a hormone-refractory, androgen-independent state [145, 146]. LAPC-4 and LAPC-9 can be implanted subcutaneously, orthotopically into the mouse prostate, or intratibially. Orthotopic tumors metastasize reproducibly to regional lymph nodes and lung, providing an opportunity to study prostate cancer metastasis. Intratibial injection results in the formation of osteoblastic tumors typical of human CaP where bony metastasis is the major cause of morbidity. From a research standpoint, the generation of these xenografts has provided significant dividends. Given the inability to culture CaP by other means, the xenografts have been used to identify chromosomal abnormalities and to pinpoint the genes important to the pathogenesis of CaP. For example, loss of chromosome lOq w âs a frequently observed genetic defect in prostate cancer. Recently, the PTEN/MMAC tumor suppressor gene v^as identified and mapped to chromosome 10^23.3 [150, 151]. PTEN encodes a protein/lipid phosphatase w^hich has been clearly established to function as a negative regulator of the PI3-kinase/Akt signaling pathw^ay [152-158]. Loss of PTEN leads to constitutive activation of PI3-kinase, and in turn the Akt-signaling pathway [158]. PI3-kinase is also a downstream target of several growth factors implicated in CaP pathogenesis including epidermal growth factor receptor (EGFR), insulin-like growth factor receptor (IGFR) and Her2/neu, and it is possible that deregulation of this pathway in PTEN-deficient cells may indeed be responsible for the cancer phenotype. Of note, knockout mice lacking PTEN as a consequence of targeted deletion develop multiple cancers, including prostatic hyperplasia and prostatic intraepithelial neoplasia [141, 159]. Correspondingly, 50-60% of all prostate cancer xenografts established contain deletions, mutations, or absent expression of PTEN [160,161], making the xenografts a relevant and valuable source for biological and therapeutic discovery. Prostate cancer gene therapy approaches that specifically target this pathway are now underway in these models. In addition to modeling the abnormalities of the PTEN/MMAC pathway, xenografts are important in delineating the role of androgens and androgen receptor (AR) signaling in CaP. Prostate epithelial cells utilize androgen as a growth and differentiation factor and are dependent on androgen for survival. Once transformed, androgen deprivation is associated with a transition of CaP cells through a range of diminishing androgen-dependence, and ultimately androgen independence. Although not well understood, this process likely involves perturbations in AR signaling of cellular growth control. Potential AR-related perturbations may involve (1) AR mutation or gene amplification, (2) cross-talk between AR and other signal pathways, and/or (3) alterations in transcriptional coregulators. Greater than 80% of clinical CaP specimens have confirmed AR expression, even in advanced androgen-independent dis eases [162, 163]. Among these, AR-gene mutation or amplification has been 5 5 0 Batra ef al. documented in 20 -40% of CaP cases [164-166]. Both LNCaP and the CWR22 xenografts bear AR mutations that enable the receptor to be acti vated by nonandrogenic steroid hormones such as progesterone and estrogen. In addition, in a patient who had failed androgen ablation, it was recently demonstrated that his CaP-cells possessed a mutated AR with altered lig- and affinity. Essentially, the mutant AR functioned as a high-affinity Cortisol receptor, enabling the CaP cells to circumvent the androgen requirement for growth [167]. Another emergent theme is that some hormone refractory can cers have activated the AR signaling pathway through a ligand-independent mechanism. For example, in LAPC-4 cells expressing wild-type AR, the overex- pression of Her-2/neu has been shown to activate AR [168]. Not surprisingly, the LAPC-4 xenograft progresses to androgen-independence after androgen ablation and differential gene expression studies reveal a consistent increase in Her-2/neu protein expression in androgen-independent tumors. Further more, forced overexpression of Her-2/neu in androgen-dependent CaP cells is sufficient to confer androgen-independent growth in vitro and to accelerate androgen-independent growth in castrated animals. Thus, Her-2/neu overex pression activates the AR signaling pathway in the absence of ligand and enhances the magnitude of AR response in the presence of low levels of andro gen. Last, reconstitution experiments in a heterologous cell type expressing low levels of endogenous AR suggest that these effects of Her-2/neu on the AR pathway require AR-expression [168]. Although the point where Her-2/neu and AR pathway intersects is still undefined, nuclear receptor coactivators might be potential targets since amplification of steroid receptor coactivator, AIBl, is documented in breast and ovarian cancer [169]. Cross-talk between Her-2/neu and AR signaling pathways should provide a novel mechanistic insight into the development of androgen independence. D. Gene Therapy Approaches with Adenovectors in Prostate Cancer Recombinant Ad vectors are most commonly used for CaP because they have demonstrated the capacity to deliver genes intraprostatically in animal models [170]. Hence, several ongoing human CaP clinical gene therapy trials are using Ad [171, 172]. With respect to these applications, several groups are developing transcriptionally targeted prostate-specific Ad [172-175]. These strategies are beneficial in gene therapy applications in that they potentially restrict the expression of cytotoxic therapeutic genes to the malignant cells. Most commonly, the kallikrein-protease prostate specific antigen (PSA) gene regulatory regions have been used to direct prostate-specific expression because prostate epithelia, normal or malignant, specifically express the PSA [176]. Unfortunately, the transcriptional output from the native PSA enhancer and promoter (as from most highly regulated tissue-specific promoters) is much lower than from strong constitutive viral promoters such as CMV. For example. 18. Utility of Ad Vectors in Animal Models I: Cancer 5 5 1 our studies suggest that the native PSA enhancer and promoter inserted into Ad can direct tissue-specific and androgen-inducible expression in LNCaP cells, but the transcriptional activity is 50-fold lower than the constitutive CMV promoter [Wu et al.^ unpubhshed data]. By exploiting the known properties of the native PSA control regions, we have improved the activity and specificity of the prostate-specific PSA enhancer (Wu et al. unpublished data). Previous studies had established that AR molecules bound cooperatively to AREs in the PSA enhancer core (—4326 to —3935) act synergistically with AR bound to the proximal promoter to regulate transcriptional output [177, 178]. To exploit the synergistic nature of AR action, we generated chimeric enhancer constructs by (1) insertion of a synthetic element containing four tandem copies of the proximal PSA promoter AREI (ARE4) element or (2) duplication of enhancer core and (3) removal of intervening sequences (—3744 to —2875) between the enhancer and the promoter. Each of these three strategies augments activity and androgen inducibility and retained a high degree of tissue discriminatory ability. As a result of these combined approaches, the two most active constructs are termed PSE-BC (duplication of core) and PSE-BAC (insertion of core and ARE4) are approximately 20-fold higher in activity than native PSA enhancer/promoter construct, PSE, composed of the PSA enhancer (-5322 to —2855) fused to the proximal promoter (—541 to +12). Most importantly, the enhanced activity and specificity of the new PSA-enhancer/promoter constructs are retained in an adenoviral vector. The recently developed human CaP xenografts should be excellent models to refine and evaluate this novel prostate-targeted gene therapy because their AR pathways are intact and their growth regulatory pathways bear close resemblance to clinical disease. IV. Summary and Discussion We have presented for discussion a broad-based review of the utility of adenoviral vectors in animal models of lung cancer. Since this entire compi lation is devoted to Ad-gene therapy, we have particularly embellished the sections on "animal models" of disease, especially as they pertain to lung and prostate cancer. These examples illustrate that the development of our approaches may need to be disease specific, especially with respect to targeting and mode of delivery. From this review, it is evident that to realize the full potential of cancer gene therapy, advances need to be made on a number of fronts. Not only do we need to construct better Ad-vectors or more rele vant animal models, we also need to incorporate emerging technologies to a useful purpose within the experimental design. For example, the pathway to
human clinical trials may be better paved by an improved ability to gather interim surrogate measures of gene transfer and expression in animal models. 5 5 2 Batra et al. The implementation of a quantitative and noninvasive method capable of monitoring transgene expression in living animals repetitively w^ould be useful toward validating the efficacy of any gene therapy strategy. In this respect, a number of investigators, including those at UCLA, are developing sensitive technologies for imaging transgene expression using positron emission tomog raphy (PET) and optical measurements. PET is a noninvasive, tomographic imaging modality that already has clinical applications for the diagnosis and management of several diseases including cancer. New^er high-resolution ani mal microPET technology developed at UCLA, is allow^ing for the study of smaller animal systems (mice, rats, small primates) previously difficult to image v^ith a resolution approaching 2 mm [179]. With relevance to gene therapy for cancer, the herpes simplex virus 1 thymidine kinase (HSVl-tk) gene has been demonstrated to be an excellent "PET reporter gene" by virtue of trapping positron-emitting 8-[18F] fluoroganciclovir (FGCV) specifically only in cells expressing HSVl-tk[180]. Using FGCV, repetitive PET imaging of adenovirus- directed hepatic expression of the HSVl-tk reporter gene in living mice has been achieved [180-182]. More importantly direct correlation between the retained PET reporter probe and the levels of HSVl-tk gene expression in the targeted organ have also been demonstrated [180-182]. Thus, PET is a sensitive and quantitative modality to image the location and magnitude of adenoviral vector-mediated gene expression in living animals which could be translated to clinical gene therapy apphcation. Similarly, a charge-coupled device (CCD) camera is a highly sensitive camera for measuring photons. Advances in CCD technology can now enable investigators to quantitatively and reliably image low levels of luminescence (from the heterologous expres sion of the firefly luciferase gene) arising from within living animals [183]. Although tomographic images are not possible, and the signal is dependent on the depth of tissue from which the light source emanates, it is possible to get reproducible and semiquantitative images. The simplicity and minimal background signal of optical CCD luciferase approach may complement the detailed tomographic imaging of MicroPET and the newer confocal microscopy techniques and, ultimately, be more predictive of gene transfer strategies in the treatment of human disease. AcknovNfledgments We thank Drs. Steven M. Dubinett and Charles L. Sawyers in the Department of Medicine, Dr. Robert E. Reiter in the Department of Urology, and Dr. Sanjiv Gambhir in the Department of Molecular and Medical Pharmacology at the UCLA School of Medicine for thoughtful advice. This project has been supported by the Veterans Administration-Career Development Av^ard and Medical Research Funds (R.K.B.), NIH-R01-CA78654 (R.K.B.), Cahfornia Cancer Research Program (L.W.), Department of Army (L.W.), the UCLA-Jonsson Comprehensive Cancer Center, and the UCLA-Gene Medicine Program. 18. Utilify of Ad Vectors in Animal Models 1: Cancer 5 5 3 References 1. Malkinson, A. M. (1998). Molecular comparison of human and mouse pulmonary adeno carcinomas. Exp. Lung Res. 24, 541. 2. Sellers, T. A., Bailey-Wilson, J. E., Elston, R. C , Wilson, A. F., Elston, G. Z., Ooi, W. L., and Rothschild, H. (1990). Evidence for mendelian inheritance in the pathogenesis of lung cancer. / . Natl. Cancer Inst. 82, 1272. 3. Schwartz, A. G., Yang, P., and Swanson, G. M. (1996). Famihal risk of lung cancer among nonsmokers and their relatives. Am. J. Epidemiol. 144, 554. 4. Carbone, D. (1997). The biology of lung cancer. Semin. Oncol. 24, 388. 5. Salgia, R., and Skarin, A. T. (1998). Molecular abnormalities in lung cancer./. Clin. Oncol. 16, 1207. 6. Dubinett, S. M., Miller, P. W., Sharma, S., and Batra., R. K. (1998). Gene therapy for lung cancer. Hematol. Oncol. Clin. North Am. 12, 569. 7. Sethi, T. (1997). Science, medicine, and the future. Lung cancer. Br. Med. J. 314, 652. 8. Shopland, D. R., Eyre, H. J., and Pechacek., T. F. (1991). Smoking-attributable cancer mor tality in 1991: Is lung cancer now the leading cause of death among smokers in the United States? / . Natl. Cancer Inst. 83, 1142. 9. Sozzi, G., Miozzo, M., Pastorino, U., Pilotti, S., Donghi, R., Giarola, M., De Gregorio, L., Manenti, G., Radice, P., Minoletti, F., et al. (1995). Genetic evidence for an independent origin of multiple preneoplastic and neoplastic lung lesions. Cancer Res. 55, 135. 10. Mao, L., Lee, J. S., Kurie, J. M., Fan, Y. H., Lippman, S. M., Lee, J. J., Ro, J. Y., Brox- son. A., Yu, R., Morice, R. C., Kemp, B. L., Khuri, F. R., Walsh, G. L., Hittelman, W. N., and Hong., W. K. (1997). Clonal genetic alterations in the lungs of current and former smokers. / . Natl. Cancer Inst. 89, 857. 11. Wistuba, II, Lam, S., Behrens, C., Virmani, A. K., Fong, K. M., LeRiche, J., Samet, J. M., Srivastava, S., Minna, J. D., and Gazdar., A. F. (1997). Molecular damage in the bronchial epithelium of current and former smokers. / . Natl. Cancer Inst. 89, 1366. 12. Batra, R., Sharma, S., and Dubinett., S. (2000). New gene and cell-based therapies for lung cancer. Semin. Resp. Med. 21, 463. 13. Slebos, R., Kibbelaar, R., Dalesio, O., Kooistra, A., Stam, J., Meijer, C., Wagenaar, S., Van- derschueren, R., van Zandwijk, N., Mooi, W., et al. (1990). K-ras oncogene activation as a prognostic marker in adenocarcinoma of the lung. N. Engl. J. Med. 323, 561. 14. Mitsudomi, T., Steinberg, S. M., Nau, M. M., Carbone, D., D'Amico, D., Bodner, S., Oie, H. K., Linnoila, R. I., Mulshine, J. L., Minna, J. D., et al. (1992). p53 gene mutations in non-small-cell lung cancer cell lines and their correlation with the presence of ras mutations and clinical features. Oncogene 7, 171. 15. Kamb, A., Shattuck-Eidens, D., Eeles, R., Liu, Q., Gruis, N. A., Ding, W., Hussey, C , Tran, T., Miki, Y.,Weaver-Feldhaus, J., et al. (1994). Analysis of the p l6 gene (CDKN2) as a candidate for the chromosome 9p melanoma susceptibility locus. Nat. Genet. 8, 23. 16. Shapiro, G. I., Edwards, C. D.,Kobzik, L., Godleski, J., Richards, W., Sugarbaker, D. J., and Rollins., B. J. (1995). Reciprocal Rb inactivation and pl6INK4 expression in primary lung cancers and cell lines. Cancer Res. 55, 505. 17. Sozzi, G., Veronese, M. L., Negrini, M., Baffa, R., CotticelU, M. G., Inoue, H., TornieUi, S., Pilotti, S., De Gregorio, L., Pastorino, U., Pierotti, M. A., Ohta, M., Huebner, K., and Croce., C. M. (1996). The FHIT gene 3pl4.2 is abnormal in lung cancer. Cell 85, 17. 18. Pezzella, F., Turley, H., Kuzu, I., Tungekar, M. F., Dunnill, M. S., Pierce, C. B., Harris, A., Gatter, K. C , and Mason., D. Y. (1993). bcl-2 protein in non-small-cell lung carcinoma. N. Engl. J. Med. 329, 690. 19. Kern, J. A., Schwartz, D. A., Nordberg, J. E., Weiner, D. B., Greene, M. I., Torney, L., and Robinson., R. A. (1990). pl85neu expression in human lung adenocarcinomas predicts shortened survival. Cancer Res. 50, 5184. 5 5 4 Batra ef al. 20. Sundaresan, V., Ganly, P., Hasleton, P., Rudd, R., Sinha, G., Bleehen, N. M., and Rab- bitts., P. (1992). p53 and chromosome 3 abnormalities, characteristic of maUgnant lung tumours, are detectable in preinvasive lesions of the bronchus. Oncogene 7, 1989. 21. Marchetti, A., Pellegrini, S., Bertacca, G., Buttitta, F., Gaeta, P., CarniceUi, V., Nardini, V., Griseri, P., Chella, A., Angeletti, C. A., and G. Bevilacqua. (1998). FHIT and p53 gene abnormalities in bronchioloalveolar carcinomas. Correlations with clinicopathological data and K-ras mutations./. Pathol. 184, 240. 22. Kerr, K. M., Carey, F. A., King, G., and Lamb., D. (1994). Atypical alveolar hyperplasia: relationship v^ith pulmonary adenocarcinoma, p53, and c-erbB-2 expression./. Pathol. 174, 249. 23. Westra, W. H., Baas, I. O., Hruban, R. H., Askin, F. B., Wilson, K., Offerhaus, G. J., and Slebos., R. J. (1996). K-ras oncogene activation in atypical alveolar hyperplasias of the human lung. Cancer Res. 56, 2224. 24. Cooper, C. A., Carby, F. A., Bubb, V. J., Lamb, D., Kerr, K. M., and Wyllie, A. H. (1997). The pattern of K-ras mutation in pulmonary adenocarcinoma defines a new pathway of tumour development in the human lung. / . Pathol. 181, 401. 25. Mao, L., Hruban, R. H., Boyle, J. O., Tockman, M., and Sidransky., D. (1994). Detection of oncogene mutations in sputum precedes diagnosis of lung cancer. Cancer Res. 54, 1634. 26. Yesner, R. (1993). Pathogenesis and pathology. Clin. Chest Med. 14, 17. 27. Tuveson, D. A., and Jacks, T. (1999). Modeling human lung cancer in mice: Similarities and shortcomings. Oncogene 18, 5318. 28. Witschi, H. (1998). Tobacco smoke as a mouse lung carcinogen. Exp. Lung Res. 24, 385. 29. Malkinson, A., and Belinsky, S. (1996). The use of animal models in prechnical studies. In "Lung Cancer: Principles and Practice" (Pass, H., Mitchell, J., Johnson, D., and Turrisi, A., Eds.). Lippincott-Raven, Philadelphia. 30. Stoner, G. D. (1998). Introduction to mouse lung tumorigenesis. Exp. Lung Res. 24, 375. 31. Shimkin, M. B., and Stoner., G. D. (1975). Lung tumors in mice: Application to carcinogen esis bioassay. Adv. Cancer Res. 21, 1. 32. Malkinson, A. M. (1992). Primary lung tumors in mice: An experimentally manipulable model of human adenocarcinoma. Cancer Res. 52, 2670s. 33. Sharma, S., Miller, P., Stolina, M., Zhu, L., Huang, M., Paul, R., and Dubinett., S. (1997). Multi-component gene therapy vaccines for lung cancer: Effective eradication of estabhshed murine tumors in vivo with Interleukin 7 / Herpes Simplex Thymidine Kinase-transduced autologous tumor and ex t^/Vo-activated dendritic cells. Gene Ther. 4, 1361. 34. Miller, P. W., Sharma, S., Stolina, M., Chen, K., Zhu, L., Paul, R. W., and Dubinett., S. M. (1998). Dendritic cells augment granulocyte-macrophage colony-stimulating factor (GM- CSF)/herpes simplex virus thymidine kinase-mediated gene therapy of lung cancer. Cancer Gene Ther. 5, 380. 35. Sharma, S., Stolina, M., Lin, Y., Gardner, B., Miller, P. W., Kronenberg, M., and Dubi nett., S. M. (1999). T cell-derived IL-10 promotes lung cancer growth by suppressing both T cell and APC function. / . Immunol. 163, 5020. 36. Sharma, S., Stolina, M., Luo, J., Strieter, R. M., Burdick, M., Zhu, L. X., Batra, R. K., and Dubinett., S. M. (2000). Secondary lymphoid tissue chemokine mediates T cell-dependent antitumor responses in vivo. / . Immunol. 164, 4558. 37. Miller, P. W., S. Sharma, Stolina, M., Butterfield, L. H., Luo, J., Lin, Y., Dohadwala, M., Batra, R. K., Wu, L., Economou, J. S., and Dubinett., S. M. (2000). Intratumoral adminis tration of adenoviral interleukin 7 gene-modified dendritic cells augments specific antitumor immunity and achieves tumor eradication. Hum. Gene Ther. 11, 53. 38. Stolina, M., Sharma, S., Lin, Y., Dohadwala, M., Gardner, B., Luo, J., Zhu, L., Kronen berg, M., Miller, P., Lee, J., and Dubinett., S. (2000). Specific inhibition of cyclooxygenase 2 restores antitumor immunity by altering the balance of IL-10 and IL-12 synthesis. / . Immunol. 164, 361. 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 5 5 39. Herzog, C. R., Lubet, R. A., and You., M. (1997). Genetic alterations in mouse lung tumors: Implications for cancer chemoprevention./. Cell Biochem. (Suppl. 28-29), 49. 40. Chen, B.,Johanson, L., Wiest,J. S., Anderson, M. W., and You., M. (1994). The second intron of the K-ras gene contains regulatory elements associated with mouse lung tumor susceptibility. Proc. Natl Acad. Set. USA 91, 1589. 41. You, M., Candrian, U., Maronpot, R. R., Stoner, G. D., and Anderson., M. W. (1989). Activation of the Ki-ras protooncogene in spontaneously occurring and chemically induced lung tumors of the strain A mouse. Proc. Natl. Acad. Set. USA 86, 3070. 42. Herzog, C. R., Wiseman, R. W., and M. You. (1994). Deletion mapping of a putative tumor suppressor gene on chromosome 4 in mouse lung tumors. Cancer Res. 54, 4007. 43. Wiseman, R. W., C. Cochran, Dietrich, W., Lander, E. S., and Soderkvist., P. (1994). Allelo- typing of butadiene-induced lung and mammary adenocarcinomas of B6C3F1 mice: Frequent losses of heterozygosity in regions homologous to human tumor-suppressor genes. Proc. Natl. Acad. Sci. USA 91, 3759. 44. Horio, Y., Chen, A., Rice, P., Roth, J. A., Malkinson, A. M., and Schrump., D. S. (1996). Ki- ras and p53 mutations are early and late events, respectively, in urethane-induced pulmonary carcinogenesis in A/J mice. Mol. Carcinog. 17, 217. 45. Hecht, S. S., Morse, M. A., Amin, S., Stoner, G. D., Jordan, K. G., Choi, C. I., and Chung., F. L. (1989). Rapid
single-dose model for lung tumor induction in A/J mice by 4-(methylnitrosamino)-l-(3-pyridyl)-l-butanone and the effect of diet. Carcinogenesis 10, 1901. 46. Kim, S. H., and Lee., C. S. (1996). Induction of benign and malignant pulmonary tumours in mice with benzo(a)pyrene. Anticancer Res. 16, 465. 47. Batra, R., Olsen, J., Pickles, R., Hoganson, S., and Boucher., R. (1998). Transduction of non-small cell lung cancer cells by adenoviral and retroviral vectors. Am. J. Respir. Cell Mol. Biol. 18, 402. 48. Bergelson, J. M., Cunningham, J. A., Droguett, G., Kurt-Jones, E. A., Krithivas, A., Hong, J. S., Horwitz, M. S., Crowell, R. L., and Finberg., R. W. (1997). Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science 275, 1320. 49. Hutchin, M. E., Pickles, R. J., and Yarbrough., W. G. (2000). Efficiency of adenovirus- mediated gene transfer to oropharyngeal epithelial cells correlates with cellular differentiation and human coxsackie and adenovirus receptor expression. Hum. Gene Ther. 11, 2365. 50. Compere, S. J., Baldacci, P., and Jaenisch., R. (1988). Oncogenes in transgenic mice. Biochim. Biophys. Acta 948, 129. 51. Kao, C , Huang, J., Wu, S. Q., Hauser, P., and Reznikoff., C. A. (1993). Role of SV40 T antigen binding to pRB and p53 in multistep transformation in vitro of human uroepithelial cells. Carcinogenesis 14, 2297. 52. Levine, A. J., and Momand., J. (1990). Tumor suppressor genes: the p53 and retinoblastoma sensitivity genes and gene products. Biochim. Biophys. Acta 1032, 119. 53. Wikenheiser, K., J. Clark, Linnoila, R., Stahlman, M., and Whitsett., J. (1992). Simian virus 40 large T antigen directed by transcriptional elements of the human surfactant protein C gene produces pulmonary adenocarcinomas in transgenic mice. Cancer Res. 52, 5342. 54. Wikenheiser, K., and Whitsett., J. (1997). Tumor progression and cellular differentiation of pulmonary adenocarcinomas in SV40 large T antigen transgenic mice. Am. J. Respir. Cell Mol. Biol. 16, 713. 55. Sandmoller, A., R. Halter, Suske, G., Paul, D., and Beato,, M. (1995). A transgenic mouse model for lung adenocarcinoma. Cell Growth Differ. 6, 97. 56. Magdaleno, S., Wang, G., Mireles, V., Ray, M., Finegold, M., and Demayo., F. (1997). Cyclin-dependent kinase inhibitor expression in pulmonary clara cells transformed with SV40 large t antigen in transgenic mice. Cell Groivth Differ. 8, 145. 57. Gabrilovich, D. I., Chen, H. L., Girgis, K. R., Cunningham, H. T., Meny, G. M., Nadaf, S., Kavanaugh, D., and Carbone., D. P. (1996). Production of vascular endothehal growth 5 5 6 Batra ef aL factor by human tumors inhibits the functional maturation of dendritic cells. Nature Med. 2, 1096. 58. Rygaard, J., and Povlsen., C. O. (1969). Heterotransplantation of a human malignant tumour to "Nude" mice. Acta Pathol. Microbiol. Scand. 77, 758. 59. Pantelouris, E. M. (1968). Absence of thymus in a mouse mutant. Nature 217, 370. 60. Povlsen, C. 0.,Visfeldt, J., Rygaard, J., and Jensen., G. (1975). Growth patterns and chro mosome constitutions of human malignant tumours after long-term serial transplantation in nude mice. Acta Pathol. Microbiol. Scand. [A] 83, 709. 61. Shimosato, Y., Kameya, T., and Hirohashi., S. (1979). Growth, morphology, and function of xenotransplanted human tumors. Pathol. Annu. 14(2), 215. 62. Fidler, I. J. (1986). Rationale and methods for the use of nude mice to study the biology and therapy of human cancer metastasis. Cancer Metastasis Rev. 5, 29. 63. Bepler, G., and Neumann., K. (1990). Nude mouse xenografts as in vivo models for lung carcinomas. In Vivo 4, 309. 64. Kyriazis, A. P.,DiPersio, L., Michael, J. G., and Pesce., A. J. (1979). Influence of the mouse hepatitis virus (MHV) infection on the growth of human tumors in the athymic mouse. Int. ]. Cancer 23, 402. 65. Reed, N. D., Manning, J. K., Baker, P. J., and Ulrich., J. T. (1974). Analysis of 'thymus- independent' immune responses using nude mice. In "Proceedings of the First International Workshop on Nude Mice" (J. Rygaard and C O . Povlsen, Eds.), pp. 95-103. Verlag, Stuttgart. 66. Hanna, N. (1982). Role of natural killer cells in control of cancer metastasis. Cancer Metastasis Rev. 1, 45. 67. Hanna, N., and Burton., R. C. (1981). Definitive evidence that natural killer (NK) cells inhibit experimental tumor metastases in vivo. / . Immunol. 127, 1754. 68. Talmadge, J. E., Meyers, K. M., Prieur, D. J., and Starkey., J-. R. (1980). Role of NK cells in tumour growth and metastasis in beige mice. Nature 284, 622. 69. Bosma, G. C., Custer, R. P., and Bosma., M. J. (1983). A severe combined immunodeficiency mutation in the mouse. Nature 301, 527. 70. Bosma, M. J., and Carroll., A. M. (1991). The SCID mouse mutant: definition, characteri zation, and potential uses. Annu. Rev. Immunol. 9, 323. 71. Reddy, S., Piccione, D., Takita, H., and Bankert., R. B. (1987). Human lung tumor growth established in the lung and subcutaneous tissue of mice with severe combined immunodefi ciency. Cancer Res. 47, 2456. 72. Williams, S. S., Alosco, T. R., Croy, B. A., and Bankert, R. B. (1993). The study of human neoplastic disease in severe combined immunodeficient mice. Lab. Anim. Sci. 43, 139. 73. Croy, B. A., Percy, D. H., and Smith., A. L. (1993). What are scid mice and why is it timely to devote a special topic issue to them? Lab. Anim. Sci. 43, 120. 74. Mak, T. W., Rahemtulla, A., Schilham, M., Koh, D. R., and Fung-Leung., W. P. (1992). Generation of mutant mice lacking surface expression of CD4 or CD8 by gene targeting. / . Autoimmun. 5 (Suppl A), SS. 75. KoUer, B. H., and Smithies., O. (1992). Altering genes in animals by gene targeting. Annu. Rev. Immunol. 10, 705. 76. Hoganson, D., Matsui, H., Batra, R., and Boucher., R. (1998). Toxin gene-mediated growth inhibition of lung adenocarcinoma in an animal model of pleural malignancy. Hum. Gene Ther.9, 1143. 77. Roth, J. A., Nguyen, D., Lawrence, D. D., Kemp, B. L., Carrasco, C. H., Person, D. Z., Hong, W. K., Komaki, R., Lee, J. J., Nesbitt, J. C , Pisters, K. M., Putnam, J. B., Schea, R., Shin, D. M., Walsh, G. L., Dolormente, M. M., Han, C. I., Martin, F. D., Yen, N., Xu, K., Stephens, L. C , McDonnell, T. J., Mukhopadhyay, T., and Cai., D. (1996). Retrovirus- mediated wild-type p53 gene transfer to tumors of patients with lung cancer. Nat. Med. 2, 985. 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 5 7 78. Qazilbash, M., Xiao, X., Cowan, K., and Walsh., C. (1997). Cancer gene therapy using a novel adeno-associated virus vector expressing human wild-type p53. Gene Ther. 4, 675. 79. Takahashi, T., Carbone, D., Takahashi, T., Nau, M., Hida, T., Linnoila, I., Ueda, R., and Minna., J. (1992). Wild-type but not mutant p53 suppresses the growth of human lung cancer cells bearing multiple genetic lesions. Cancer Res. 52, 2340. 80. Freeman, S. M., Abboud, C. N., Whartenby, K. A., Packman, C. H., Koeplin, D. S., Moolten, F. L., and Abraham., G. N. (1993). The "bystander effect": Tumor regression when a fraction of the tumor mass is genetically modified. Cancer Res. 53, 5274. 81. Nishizaki, M., Fujiwara, T., Tanida, T., Hizuta, A., Nishimori, H., Tokino, T., Naka- mura, Y., Bouvet, M., Roth, J. A., and Tanaka., N. (1999). Recombinant adenovirus express ing wild-type p53 is antiangiogenic: A proposed mechanism for bystander effect. Clin. Cancer Res. 5, 1015. 82. Chen, H., and Carbone., D. (1997). p53 as a target for anti-cancer immunotherapy, Mol. Med. Today 3, 7. 83. Vierboom, M. P., Nijman, H. W., Offringa, R., van der Voort, E. I., van Hall, T., van den Broek, L., Fleuren, G. J., Kenemans, P., Kast, W. M., and Melief., C. J. (1997). Tumor eradication by wild-type p53-specific cytotoxic T lymphocytes./, Exp. Med. 186, 695. 84. Swisher, S. G., Roth, J. A., Nemunaitis, J., Lawrence, D. D., Kemp, B. L., Carrasco, C. H., Connors, D. G., El-Naggar, A. K,, Fossella, F., Glisson, B. S., Hong, W. K., Khuri, F. R., Kurie, J. M., Lee, J. J., Lee, J. S., Mack, M., Merritt, J. A., Nguyen, D. M., Nesbitt, J. C , Perez-Soler, R., Pisters, K. M., Putnam, J. B., Jr., Richli, W. R., Savin, M., Waugh, M. K,, and et al. (1999). Adenovirus-mediated p53 gene transfer in advanced non-small-cell lung cancer. / . Natl. Cancer Inst. 91, 763. 85. Bischoff, J. R., Kirn, D. H., Wilhams, A., Heise, C , Horn, S., Muna, M., Ng, L., Nye, J. A., Sampson-Johannes, A., Fattaey, A., and McCormick., F. (1996). An adenovirus mutant that replicates selectively in p53-deficient human tumor cells. Science 274, 7. 86. Heise, C , Sampson-Johannes, A., Williams, A., McCormick, F., Von Hoff, D., and Kirn., D. (1997). ONYX-015, an ElB gene-attenuated adenovirus, causes tumor-specific cytolysis and antitumoral efficacy that can be augmented by standard chemotherapeutic agents. Nat. Med. 3, 639. 87. Hall, A. R., Dix, B. R., S. J.O'Carroll, and Braithwaite,, A. W. (1998). p53-dependent cell death/apoptosis is required for a productive adenovirus infection. Nat. Med. 4, 1068. 88. Harada, J. N., and Berk., A. J. (1999). p53-Independent and -dependent requirements for ElB-55 K in adenovirus type 5 replication. / . Virol. 73, 5333. 89. Rothmann, T., A. Hengstermann, Whitaker, N. J., Scheffner, M., and zur Hansen., H. (1998). Replication of ONYX-015, a potential anticancer adenovirus, is independent of p53 status in tumor cells. / . Virol. 72, 7. 90. Fearon, E., Pardoll, D., Itaya, T,, Golumbek, P., Levitsky, H., Simons, J., Karasuyama, H., Vogelstein, B., and Frost., P. (1990). Interleukin-2 production by tumor cells bypasses T helper function in the generation of an antitumor response. Cell 60, 397. 91. Alhone, A., Consalvo, M., Nanni, P., Lollini, P. L,, Cavallo, F., GiovareUi, M., Forni, M., Guhno, A., Colombo, M. P., Dellabona, P., Hock, H., Blankenstein, T., Rosenthal, F. M., Gansbacher, B., Bosco, M. C , Musso, T., Gusella, L., and Forni., G. (1994), Immunizing and curative potential of replicating and nonreplicating murine mammary adenocarcinoma cells engineered with interleukin (IL)-2, IL-4, IL-6, IL-7, IL-10, tumor necrosis factor alpha, granulocyte-macrophage colony-stimulating factor, and gamma-interferon gene or admixed with conventional adjuvants. Cancer Res. 54, 6022. 92. Bottazzi, B., Walter, S., Govoni, D., Colotta, F., and Mantovani., A. (1992). Monocyte chemotactic cytokine gene transfer modulates macrophage infiltration, growth, and suscep tibility to IL-2 therapy of a murine melanoma. / . Immunol. 148, 1280. 5 5 8 Batra et aL 93. Colombo, M. P., Ferrari, G., Stoppacciaro, A., Parenza, M., Rodolfo, M., Mavilio, F., and Parmiani., G. (1991). Granulocyte colony-stimulation factor (G-CSF) gene transfer suppress tumorigenicity of a murine adenocarcinoma in vivo. / . Exp. Med. 173, 889. 94. Heike, Y., Takahashi, M., Kanegae, Y., Sato, Y., Saito, L, and Saijo., N. (1997). Interleukin- 2 gene transduction into freshly isolated lung adenocarcinoma cells with adenoviral vectors. Hum. Gene Ther. 8, 1. 95. Zitvogel, L., Tahara, H., Robbins, P., et al. (1995). Cancer immunotherapy of established tumors v^ith IL-12: effective delivery by genetically engineered fibroblasts. / . Immunol. 155, 1393. 96. Dranoff, G., Jaffee, E., Lazenby, A., Golumbek, P., Levitsky, H., Brose, K., Jackson, V., Hamada, H., PardoU, D., and Mulligan., R. C. (1993). Vaccination with irradiated tumor cells engineered to secrete murine granulocyte-macrophage colony-stimulating factor stimu lates potent, specific, and long-lasting anti-tumor immunity. Proc. Natl. Acad. Sci. USA 90, 3539. 97. Sharma, S., Wang, J., Huang, M., Paul, R., Lee, P., McBride, W., Economou, J., Roth, M., Kiertscher, S., and Dubinett., S. (1996). Interleukin-7 gene transfer in non-small cell lung cancer decreases tumor proliferation, modifies cell surface molecule expression, and enhances antitumor reactivity. Can. Gene Ther. 3, 302. 98. Sica, D., Rayman, P., Stanley, J., Edinger, M., Tubbs, R. R., Klein, E., Bukowski, R., and Finke., J. H. (1993). Interleukin 7 enhances the proliferation and effector function of tumor- infiltrating lymphocytes from renal-cell carcinoma. Int. J. Cancer 53, 941. 99. Yoshino, L, Goedegebuure, P. S., Peoples, G. E., Parikh, A. S., DiMaio, J. M., Lyerly, H. K., Gazdar, A. F., and Eberlein., T.J. (1994). HER2/neu-derived peptides are shared antigens among human non-small cell lung cancer and ovarian cancer. Cancer Res. 54, 3387. 100. Restifo, N. P., Esquivel, F., Kawakami, Y., Yewdell, J. W., Mule, J. J., Rosenberg, S. A., and Bennink, J. R. (1993). Identification of human cancers deficient in antigen processing./. Exp. Med. 177, 265. 101. Huang, A. Y. C , Golumbek, P., Ahmadzadeh, M., Jaffee, E., PardoU, D., and Levitsky., H. (1994). Role of bone marrow-derived cells in
presenting MHC class Lrestricted tumor antigens. Science 264, 961. 102. Caux, C , Liu, Y., and Banchereau., J. (1995). Recent advances in the study of dendritic cells and follicular dendritic cells. Immunol. Today 16, 2. 103. Steinman, R. M. (1991). The dendritic cell system and its role in immunogenicity. Annu. Rev. Immunol. 9, 271. 104. Hsu, F., Benike, C , Fagnoni, F., Files, T., Czerwinski, D., Taidi, B., Fugleman, E., and Levy., R. (1996). Vaccination of patients with B-cell lymphoma using autologous antigen- pulsed dendritic cells. Nat. Med. 2, 52. 105. Nestle, F., Alijagic, S., Gilliet, M., Sun, Y., Grabbe, S., Dummer, R., Burg, G., and Schaden- dorf., D. (1998). Vaccination of melanoma patients with peptide- or tumor lysate-pulsed dendritic cells. Nat. Med. 4, 328. 106. Ribas, A., Butterfield, L., McBride, W., Jilani, S., Bui, L., VoUmer, C , Lau, R., Dissette, V., Hu, B., A. Chen, Glaspy, J., and Economou., J. (1997). Genetic immunization for the melanoma antigen MART-1/Melan-A using recombinant adenovirus-transduced murine dendritic cells. Cancer Res. 57, 2865. 107. Arthur, J., Butterfield, L., Roth, M., Bui, L., Kiertscher, S., Lau, R., Dubinett, S., Glaspy, J., McBride, W., and Economou., J. (1997). A comparison of gene transfer methods in human dendritic cells. Cancer Gene Ther. 4, 17. 108. Bolon, L, Devouassoux, M., Robert, C , Moro, D., Brambilla, C , and Brambilla., E. (1997). Expression of urokinase-type plasminogen activator, stromelysin 1, stromelysin 3, and matrilysin genes in lung carcinomas. Aw. / . Pathol. 150, 1619. 18. Utility of Ad Vectors in Animal Models I: Cancer 5 5 9 109. Garbisa, S., Scagliotti, G., Masiero, L., Di Francesco, C., Caenazzo, C., Onisto, M., Micela, M., Stetler-Stevenson, W., and Liotta., L. (1992). Correlation of serum metallo- proteinase levels with lung cancer metastasis and response to therapy. Cancer Res. 52, 4548. 110. Kawano, N., Osawa, H., Ito, T., Nagashima, Y., Hirahara, F., Inayama, Y., Nakatani, Y., Kimura, S., Kitajima, H., Koshikawa, N., Miyazaki, K., and Kitamura., H. (1997). Expres sion of gelatinase A, tissue inhibitor of metalloproteinases-2, matrilysin, and trypsin(ogen) in lung neoplasms: An immunohistochemical study. Hum. Pathol. 28, 613. 111. Mari, B., Anderson, I., Mari, S., Ning, Y., Lutz, Y., Kobzik, L., and Shipp., M. (1998). Stromelysin-3 is induced in tumor/stroma cocultures and inactivated via a tumor-specific and basic fibroblast grov^th factor-dependent mechanism./. Biol. Chem. 273, 618. 112. DeClerck, Y., Perez, N., Shimada, H., Boone, T., Langley, K., and Taylor., S. (1992). Inhi bition of invasion and metastasis in cells transfected with an inhibitor of metalloproteinases. Cancer Res. 52, 701. 113. Noel, A., Lefebvre, O., Maquoi, E., VanHoorde, L., Chenard, M., Mareel, M., Foidart, J., Basset, P., and Rio., M. (1996). Stromelysin-3 expression promotes tumor take in nude mice. / . Clin. Invest. 97, 1924. 114. Skobe, M., Rockwell, P., Goldstein, N., Vosseler, S., and Fusenig., N. (1997). Halting angio- genesis suppresses carcinoma cell invasion. Nat. Med. 3, 1222. 115. Folkman, J. (1995). Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat. Med. 1, 27. 116. Fontanini, G., Vignati, S., Lucchi, M., Mussi, A., Calcinai, A., Boldrini, L., Chine, S., ilvestri, V., Angeletti, C , Basolo, F., and Bevilacqua., G. (1997). Neoangiogenesis and p53 protein in lung cancer: Their prognostic role and their relation with vascular endothelial growth factor (VEGF) expression. Br. J. Cancer 75, 1295. 117. O'Reilly, M. S., Holmgren, L., Shing, Y., Chen, C , Rosenthal, R. A., Moses, M., Lane, W. S., Cao, Y., Sage, E. H., and Folkman., J. (1994). Angiostatin: A novel angiogenesis inhibitor that mediates the suppression of metastases by a Lewis lung carcinoma. Cell 79, 315. 118. O'Reilly, M. S., Boehm, T., Shing, Y., Fukai, N., Vasios, G., Lane, W. S., Flynn, E., Birk- head, J. R., Olsen, B. R., and Folkman., J. (1997). Endostatin: An endogenous inhibitor of angiogenesis and tumor growth. Cell 88, 277. 119. Cyster, J. (1999). Chemokines and cell migration in secondary lymphoid organs. Science 286, 2098. 120. Ohta, Y., Watanabe, Y., Murakami, S., Oda, M., Hayashi, Y., Nonomura, A., Endo, Y., and Sasaki., T. (1997). Vascular endothehal growth factor and lymph node metastasis in primary lung cancer. Br. } . Cancer 76, 1041. 121. Arenberg, D., Polverini, P., Kunkel, S., Shanafelt, A., Hesselgesser, J., Horuk, R., and Stri cter., R. (1997). The role of CXC chemokines in the regulation of angiogenesis in non-small cell lung cancer. / . Leukocyte Biol. 62, 554. 122. Arenberg, D., Kunkel, S., Polverini, P., Glass, M., Burdick, M., and Stricter., R. (1996). Inhibition of Interleukin-8 reduces tumorigenesis of human non-small cell lung cancer in SCID mice. / . Clin. Invest. 97, 2792. 123. Hynes, R. (1992). Integrins: Versatility, modulation, and signaling in cell adhesion. Cell 69, 11. 124. Leavesley, P., Schwartz, M., Rosenfeld, M., and Cheresh., D. (1993). Integrin bl- and b3- mediated endothelial cell migration is triggered through distinct signaling mechanisms. / . Cell Biol. 121,163. 125. Brooks, P., Montgomery, A., Rosenfeld, M., Reisfeld, R., Hu, T., Klier, G., and Cheresh., D. (1994). Integrin avb3 antagonists promote tumor regression by inducing apoptosis of angiogenic blood vessels. Cell 79, 1157. 126. Arap, W.,Pasqualini, R., and Ruoslahti., E. (1998). Cancer treatment by targeted drug delivery to tumor vasculature in a mouse model. Science 279, 377. 5 6 0 Batra ef a/. 127. Wang, C. -Y., Mayo, M. W., and Baldwin., A. S. J. (1996). TNF- and cancer therapy-induced apoptosis: Potentiation by inhibition of NF-kB. Science 274, 784. 128. Batra, R. K., Guttridge, D. C , Brenner, D. A., Dubinett, S. M., Baldwin, A. S., and Boucher., R. C. (1999). IkappaBalpha gene transfer is cytotoxic to squamous-cell lung cancer cells and sensitizes them to tumor necrosis factor-alpha-mediated cell death. Am. ]. Respir. Cell Mol. Biol. 21, 238. 129. Kim, J. H., Kim, S. H., Brown, S. L., and Freytag., S. O. (1994). Selective enhancement be an antiviral agent of the radiation-induced cell killing of human glioma cells transduced with HSV-tk gene. Cancer Res. 54, 6053. 130. McBride, W., and Dougherty., G. (1995). Radiotherapy for genes that cause cancer. Nat. Med. 1, 1215. 131. Hanna, N., Mauceri, H., Wayne, J., Hallahan, D., Kufe, D., and Weichselbaum., R. (1997). Virally directed cytosine deaminase/5-fluorocytosine gene therapy enhances radiation res ponse in human cancer xenografts. Cancer Res. 57, 4205. 132. Mcllwrath, A., Vasey, P., Ross, G., and Brown., R. (1994). Cell cycle arrests and radiosen- sitivity of human tumor cell lines: Dependence on wild-type p53 for radiosensitivity. Cancer Res. 54,3718. 133. Gallardo, D., Drazen, Z. E., and McBride., W. H. (1996). Adenovirus-based Transfer of Wild-Type p53 Gene Increases Ovarian Tumor Radiosensitivity. Cancer Res. 56, 4891. 134. Nguyen, D., Spitz, F., Yen, N., Cristiano, R., and Roth., J. (1996). Gene therapy for lung cancer: enhancement of tumor suppression by a combination of sequential systemic cisplatin and adenovirus-mediated p53 gene transfer./. Thorac. Cardiovasc. Surg. 112, 1372. 135. Douglas, J. T., Rogers, B. E., Rosenfeld, M. E., Michael, S. I., Feng, M., and Curiel., D. T. (1996). Targeted gene delivery by tropism-modified adenoviral vectors. Nat. Biotechnol. 14, 1574. 136. Wickham, T., Roelvink, P., Brough, D., and Kovesdi., I. (1996). Adenovirus targeted to heparan-containing receptors increases its gene delivery efficiency to multiple cell types. Nat. Biotechnol. 14, 1570. 137. Jones, G. W., Mettlin, C., Murphy, G. P., Guinan, P., Herr, H. W., Hussey, D. H., Chmiel, J. S., Fremgen, A. M., Clive, R. E., Zuber-Ocwieja, K. E., et al. (1995). Patterns of care for carcinoma of the prostate gland: Results of a national survey of 1984 and 1990. / . Am. Coll. Surg. 180, 545. 138. Noble, R. L. (1977). The development of prostatic adenocarcinoma in Nb rats following prolonged sex hormone administration. Cancer Res. 37, 1929. 139. Voigt, W., and Dunning, W. F. (1974). In vivo metabohsm of testosterone-3 H in R-3327, an androgen-sensitive rat prostatic adenocarcinoma. Cancer Res. 34, 1447. 140. Greenberg, N. M., DeMayo, F., Finegold, M. J., Medina, D., Tilley, W. D., Aspinall, J. O., Cunha, G. R., Donjacour, A. A., Matusik, R. J., and Rosen., J. M. (1995). Prostate cancer in a transgenic mouse. Proc. Natl. Acad. Sci. USA 92, 3439. 141. Podsypanina, K., Ellenson, L. H., Nemes, A., Gu, J., Tamura, M., Yamada, K. M., Cordon- Cardo, C., Catoretti, G., Fisher, P. E., and Parsons., R. (1999). Mutation of Pten/Mmacl in mice causes neoplasia in multiple organ systems. Proc. Natl. Acad. Sci. USA 96, 1563. 142. Zhau, H. E., Li, C. L., and Chung., L. W. (2000). Establishment of human prostate carci noma skeletal metastasis models. Cancer 88, 2995. 143. Gingrich, J. R., Barrios, R. J., Morton, R. A., Boyce, B. F., DeMayo, F. J., Finegold, M. J., Angelopoulou, R., Rosen, J. M., and Greenberg., N. M. (1996). Metastatic prostate cancer in a transgenic mouse. Cancer Res. 56, 4096. 144. Gingrich, J. R., Barrios, R. J., Kattan, M. W., Nahm, H. S., Finegold, M. J., and Green berg., N. M. (1997). Androgen-independent prostate cancer progression in the TRAMP model. Cancer Res. 57, 4687. 145. Klein, K. A., Reiter, R. E., Redula, J., Moradi, H., Zhu, X. L., Brothman, A. R., Lamb, D. J., Marcelh, M., Belldegrun, A., Witte, O. N., and Sawyers., C. L. (1997). Progression of 18. Utility of Ad Vectors in Animal Models I: Cancer 5 6 1 metastatic human prostate cancer to androgen independence in immunodeficient SCID mice. Nat. Med. 3, 402. 146. Craft, N., Chhor, C , Tran, C , Belldegrun, A., DeKernion, J., Witte, O. N., Said, J., Reiter, R. E., and Sawyers., C. L. (1999). Evidence for clonal outgrowth of androgen- independent prostate cancer cells from androgen-dependent tumors through a two-step process. Cancer Res. 59, 5030. 147. Elhs, W. J., Vessella, R. L., Buhler, K. R., Bladou, F., True, L. D., Bigler, S. A., Curtis, D., and Lange., P. H. (1996). Characterization of a novel androgen-sensitive, prostate-specific antigen-producing prostatic carcinoma xenograft: LuCaP 23. Clin. Cancer Res. 2, 1039. 148. Wainstein, M. A., He, F., Robinson, D., Kung, H. J., Schwartz, S., Giaconia, J. M., Edge- house, N. L., Pretlow, T. P., Bodner, D. R., Kursh, E. D., et al. (1994). CWR22: Androgen- dependent xenograft model derived from a primary human prostatic carcinoma. Cancer Res. 54, 6049. 149. van Weerden, W. M., de Ridder, C. M., Verdaasdonk, C. L., Romijn, J. C , van der Kwast, T. H., Schroder, F. H., and van Steenbrugge., G. J. (1996). Development of seven new human prostate tumor xenograft models and their histopathological characterization. Am. J.Pathol. 149, 1055. 150. Li, J., Yen, C , Liaw, D., Podsypanina, K., Bose, S., Wang, S. I., Puc, J., Miliaresis, C , Rodgers, L., McCombie, R., Bigner, S. H., Giovanella, B. C , Ittmann, M., Tycko, B., Hib- shoosh, H., Wigler, M. H., and Parsons., R. (1997). PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science 275, 1943. 151. Steck, P. A., Pershouse, M. A., Jasser, S. A., Yung, W. K., Lin, H., Ligon, A. H., Langford, L. A., Baumgard, M. L., Hattier, T., Davis, T., Frye, C , Hu, R., Swedlund, B., Teng, D. H., and Tavtigian., S. V. (1997). Identification of a candidate tumour suppressor gene, MMACl, at chromosome 10q233 that is mutated in multiple advanced cancers. Nat. Genet. 15, 356. 152. Davies, M. A., Lu, Y., Sano, T., Fang, X., Tang, P., LaPushin, R., Koul, D., Bookstein, R., Stokoe, D., Yung, W. K., Mills, G. B., and Steck., P. A. (1998). Adenoviral transgene expres sion of MMAC/PTEN in human glioma cells inhibits Akt activation and induces anoikis. Cancer Res. 58, 5285. 153. Furnari, F. B., Huang, H. J., and Cavenee., W. K. (1998). The phosphoinositol phosphatase activity of PTEN mediates a serum-sensitive Gl growth arrest in glioma cells. Cancer Res. 58, 5002. 154. Haas-Kogan, D., Shalev, N., Wong, M., Mills, G., Yount, G., and Stokoe., D. (1998). Protein kinase B (PKB/Akt) activity is elevated in glioblastoma cells due to mutation of the tumor suppressor PTEN/MMAC. Curr. Biol. 8, 1195. 155. Myers, M. P.,Pass, I., Batty, L H., Van der Kaay, J., Stolarov, J. P., Hemmings, B. A., Wigler, M.H. , Downes, C. P., and Tonks., N. K. (1998). The lipid phosphatase activity of PTEN is critical for its tumor suppressor function. Proc. Natl. Acad. Sci. USA 95, 13,513. 156. Stambolic, V., Suzuki, A., de la Pompa, J. L., Brothers, G. M., Mirtsos, C , Sasaki, T., Ruland, J., Penninger, J. M., Siderovski, D. P., and Mak., T. W. (1998).
Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell 95, 29. 157. Sun, H., Lesche, R., Li, D. M., J. Liliental, Zhang, H., Gao, J., Gavrilova, N., Mueller, B., Liu, X., and Wu., H. (1999). PTEN modulates cell cycle progression and cell survival by regulating phosphatidylinositol 3,4,5,-trisphosphate and Akt/protein kinase B signaling pathway. Proc. Natl. Acad. Sci. USA 96, 6199. 158. Wu, X., Senechal, K., Neshat, M. S., Whang, Y. E., and Sawyers., C. L. (1998). The PTEN/MMAC 1 tumor suppressor phosphatase functions as a negative regulator of the phosphoinositide 3-kinase/Akt pathway. Proc. Natl. Acad. Sci. USA 95, 15,587. 159. Di Cristofano, A., Pesce, B., Cordon-Cardo, C , and Pandolfi., P. P. (1998). Pten is essential for embryonic development and tumour suppression. Nat. Genet. 19, 348. 5 6 2 Batra ef of. 160. Vlietstra, R. J., van Alewijk, D. C , Hermans, K. G., G. J.van Steenbrugge, and Trapman., J. (1998). Frequent inactivation of PTEN in prostate cancer cell lines and xenografts. Cancer Res. 58, 2720. 161. Whang, Y. E., Wu, X., Suzuki, H., Reiter, R. E., Tran, C., Vessella, R. L., Said, J. W., Isaacs, W. B., and Sawyers., C. L. (1998). Inactivation of the tumor suppressor PTEN/MMACl in advanced human prostate cancer through loss of expression. Proc. Natl. Acad. Sci. USA 95, 5246. 162. Trapman, J., and Brinkmann., A. O. (1996). The androgen receptor in prostate cancer. Pathol. Res. Pract. 192, 752. 163. Hobisch, A., Culig, Z., Radmayr, C., Bartsch, G., Klocker, H., and A. Hittmair. (1995). Distant metastases from prostatic carcinoma express androgen receptor protein. Cancer Res. 55,3068. 164. Gaddipati, J. P., McLeod, D. G., Heidenberg, H. B., Sesterhenn, I. A., Finger, M. J., Moul, J. W., and Srivastava., S. (1994). Frequent detection of codon 877 mutation in the androgen receptor gene in advanced prostate cancers. Cancer Res. 54, 2861. 165. Taplin, M. E., Bubley, G. J., Shuster, T. D., Frantz, M. E., Spooner, A. E., Ogata, G. K., Keer, H. N., and Balk., S. P. (1995). Mutation of the androgen-receptor gene in metastatic androgen-independent prostate cancer. N. Engl. ]. Med. 332, 1393. 166. Visakorpi, T., Hyytinen, E., Koivisto, P., Tanner, M., Keinanen, R., Palmberg, C., Palotie, A., Tammela, T., Isola, J., and O. P. Kallioniemi. (1995). In vivo amplification of the androgen receptor gene and progression of human prostate cancer. Nat. Genet. 9, 401. 167. Zhao, X. Y., Malloy, P. J., Krishnan, A. V., Swami, S., Navone, N. M., Peehl, D. M., and Feldman., D. (2000). Glucocorticoids can promote androgen-independent growth of prostate cancer cells through a mutated androgen receptor. Nat. Med. 6, 703. 168. Craft, N., Shostak, Y., Carey, M., and Sawyers., C. L. (1999). A mechanism for hormone- independent prostate cancer through modulation of androgen receptor signaUng by the HER-2/neu tyrosine kinase. Nat. Med. 5, 280. 169. Anzick, S. L., Kononen, J., Walker, R. L., Azorsa, D. O., Tanner, M. M., Guan, X. Y., Sauter, G., Kallioniemi, O. P., Trent, J. M., and P. S. Meltzer. (1997). AIBl, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277, 965. 170. Steiner, M. S., Zhang, Y., Carraher, J., and Lu., Y. (1999). In vivo expression of prostate- specific adenoviral vectors in a canine model. Cancer Gene Ther. 6, 456. 171. Herman, J. R., Adler, H. L., Aguilar-Cordova, E., Rojas-Martinez, A., Woo, S., Timme, T. L., Wheeler, T. M., Thompson, T. C , and Scardino., P. T. (1999). In situ gene therapy for adenocarcinoma of the prostate: a phase I clinical trial. Hum. Gene Ther. 10, 1239. 172. Rodriguez, R., Schuur, E. R., Lim, H. Y., Henderson, G. A., Simons, J. W., and Hender son., D. R. (1997). Prostate attenuated replication competent adenovirus (ARCA) CN706: A selective cytotoxic for prostate-specific antigen-positive prostate cancer cells. Cancer Res. 57,2559. 173. Gotoh, A., Ko, S. C , Shirakawa, T., Cheon, J., Kao, C , Miyamoto, T., Gardner, T. A., Ho, L. J., Cleutjens, C. B., Trapman, J., Graham, F. L., and Chung., L. W. (1998). Devel opment of prostate-specific antigen promoter-based gene therapy for androgen-independent human prostate cancer. / . JJrol. 160, 220. 174. Yu, D. C , Sakamoto, G. T., and Henderson., D. R. (1999). Identification of the transcrip tional regulatory sequences of human kallikrein 2 and their use in the construction of calydon virus 764, an attenuated replication competent adenovirus for prostate cancer therapy. Cancer Res. 59, 1498. 175. Latham, J. P., Searle, P. F., Mautner, V., and James., N. D. (2000). Prostate-specific antigen promoter/enhancer driven gene therapy for prostate cancer: Construction and testing of a tissue-specific adenovirus vector. Cancer Res. 60, 334. 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 6 3 176. AumuUer, G.,Seitz, J., Lilja, H., Abrahamsson, P. A., von der Kammer, H., and Scheit., K. H. (1990). Species- and organ-specificity of secretory proteins derived from human prostate and seminal vesicles. Prostate 17, 31. 177. Huang, W., Shostak, Y., Tarr, P., Sawyers, C , and Carey., M. (1999). Cooperative assembly of androgen receptor into a nucleoprotein complex that regulates the prostate-specific antigen enhancer./. Biol. Chem. 274, 25756. 178. Reid, K. J., Hendy, S. C , Saito, J. L., Sorensen, P., and Nelson., C. C. (2000). Two classes of androgen receptor elements mediate cooperativity through allosteric interactions. / . Biol. Chem. 60, 24. 179. Shao, Y., Cherry, S. R., Farahani, K., Meadors, K., Siegel, S., Silverman, R. W., and Mars- den., P. K. (1997). Simultaneous PET and MR imaging. Phys. Med. Biol. 42, 1965. 180. Gambhir, S. S.,Barrio, J. R., Wu, L., Iyer, M., Namavari, M., Satyamurthy, N., Bauer, E., Parrish, C , MacLaren, D. C , Borghei, A. R., Green, L. A., Sharfstein, S., Berk, A. J., Cherry, S. R., Phelps, M. E., and Herschman., H. R. (1998). Imaging of adenoviral-directed herpes simplex virus type 1 thymidine kinase reporter gene expression in mice with radiolabeled ganciclovir./. Nucl. Med. 39, 2003. 181. MacLaren, D. C , Gambhir, S. S., Satyamurthy, N., Barrio, J. R., Sharfstein, S., Toyokuni, T., Wu, L., Berk, A. J., Cherry, S. R., Phelps, M. E., and Herschman., H. R. (1999). Repetitive, non-invasive imaging of the dopamine D2 receptor as a reporter gene in living animals. Gene Ther. 6, 785. 182. Gambhir, S. S., Barrio, J. R., Phelps, M. E., Iyer, M., Namavari, M., Satyamurthy, N., Wu, L., Green, L. A., Bauer, E., MacLaren, D. C , Nguyen, K., Berk, A. J., Cherry, S. R., and H. R. Herschman. (1999). Imaging adenoviral-directed reporter gene expression in living animals with positron emission tomography. Proc. Natl. Acad. Sci. USA 96, 2333. 183. Contag, P. R.,01omu, I. N., Stevenson, D. K., and Contag., C. H. (1998). Bioluminescent indicators in living mammals. Nat. Med. 4, 245. C H A P T E R Utility of Adenoviral Vectors in Animal Models of Human Disease II: Genetic Disease Raymond John Pickles Cystic Fibrosis/Pulmonary Research and Treatment Center University of North Carolina at Chapel Hill Chapel Hill, North Carolina I. Introduction A disease at the forefront of gene therapy research over the past decade is cystic fibrosis (CF). This hereditary, single-gene-defect disease, ahhough affecting epithefial cells of multiple organs of the body, results most often in mortality due to complications associated with the lung. Cystic fibrosis lung disease has been considered as a prototypic disease state for "proof-of-concept" gene-therapy strategies. The lack of an alternative long-term treatment for the pulmonary manifestations of this disease, the accessibility of the lung via the airway lumen, and the fact that viruses known to infect the lung were being developed into nonreplicating gene transfer vectors led investigators to believe that administration of gene transfer vectors to the lung could potentially result in an effective treatment of this disease. Shortly after the cloning of the gene responsible for CF pathophysiology, two groundbreaking observations made gene therapy for CF lung disease appear imminent. First, isolated epithelial cells cultured from the airway epithelium of CF patients could be phenotypically "corrected" by transferring into the cells the cDNA corresponding to the CF gene [1-5]. Second, adenoviral (Ad) vectors engineered to express the CF gene were administered to the airways of experimental animals and transgene expression observed in cells that were considered to require "correction" [6]. These initial observations produced a flurry of scientific activity and excitement in both the gene therapy and CF ADENOVIRAL VECTORS FOR GENE THERAPY 5 6 5 Copyright 2002, Elsevier Science (USA). All rights reserved. 5 6 6 Raymond John Pickles scientific communities and within 3 years of these observations the first clinical trials describing successful Ad-mediated gene transfer to the airway epithelium of CF patients in vivo were reported [7]. These promising early observations have unfortunately not withstood further investigation. After approximately 20 gene therapy clinical trials for CF lung disease (of which greater than 70% utilized Ad) it has become apparent that gene transfer to airway epithelium in vivo is not a simple procedure. The difficulty lies in the evolution of the respiratory epithelium as an effective barrier to invading pathogens entering the lung (e.g., viruses). The epithelium achieves this "barrier function" by presentation of a host of innate and cell-mediated immune systems, which for gene transfer vectors culminate in reduced uptake and expression of the transgene. In this chapter, I describe the evidence that led investigators to believe that Ad would be useful in CF lung disease, why subsequently this simplistic approach failed, and how increasing knowledge of lung biology and viral bioengineering has and will allow novel strategies to be tested. In light of this emphasis on basic research, new strategies and models will need to be tested and successful demonstration of efficiency and safety will be required before we once again enter the clinic with Ad for CF lung disease gene therapy. II. Pathophysiology of Cystic Fibrosis (CF) Lung Disease Cystic fibrosis is a multifaceted disease with major morbidity and mor tality resulting from chronic decline of lung function. This disease is the most common fatal inherited disease in Caucasians with 1 in 2500 live births affected [8]. Although CF is most devastating to the lung (accounting for 90% of mortality), resulting in chronic repetitive infections, chronic obstructive pul monary disease, and respiratory failure, other tissues are also affected, including the liver, pancreas, the gastrointestinal tract, and the sweat glands. The abnor mal CF gene (250 kb) encodes an mRNA of 6,5 kb which translates into an 180-kDa protein that has been extensively characterized as a cAMP-activated chloride ion channel, named the cystic fibrosis transmembrane conductance regulator (CFTR) [3, 9]. In the lung, CFTR is normally expressed in the respi ratory epithelium and although the specific functions of CFTR are complex, is predominately involved in maintenance of ionic homeostasis in this tissue. Over 900 different mutations of CFTR have now been reported, resulting in a range of clinical manifestations and differing severity of the disease. Flowever, 70% of these mutations are due to a three-base-pair deletion leading to the absence of phenylalanine (F) at position 508 (AF508) [10]. This particular mutation leads to misfolded CFTR being retained within the endoplasmic recticulum 19. Utility of Ad Vectors in Animal Models II: Genetic Disease 5 6 7 of cells, so reducing CFTR function at the plasma membrane [11]. Currently, although the specific localization and functional capacity of AF508 CFTR in the different affected organs is a matter of controversial debate [12] and other mutations can display partial CFTR function, for CF patients, expres sion of abnormal CFTR in the airway epithelium generally results in reduced chloride ion secretion, hyperabsorption of sodium ions, increased viscosity of airw^ay secretions, impaired mucociliary clearance, chronic bacterial infection, bronchiectasis, and premature death [8, 13]. Given that all of these effects are likely primary or secondary to loss of CFTR function, the most efficacious w ây to treat the broad range of effects w^ould be to replace the defective CFTR gene w îth a normal copy. Gene therapy for CF lung disease therefore seeks to replace normal CFTR in the airv^ay epithelial cells to hopefully "correct" lung epithelium function. III. Trials and Tribulations with Adenoviral Vectors for CF Lung Disease Clinical gene transfer trials v\Aith CF patients investigating the safety and efficacy of gene transfer vectors (predominately adenoviral and liposomal vectors) have been performed in both the United States and United Kingdom. Details of these trials and the background preclinical studies have been com prehensively reviewed
in a recent review^ [14]. Although preclinical data have been largely promising for lung-directed gene transfer, the trials performed to date have show^n, at best, only partial "correction" (<20%) of the CF bioelectrical defect [7, 15-18]. This relatively low^ degree of correction is most likely due to inefficient transfer of the CFTR cDNA to the airway epithelial cells, i.e., a low efficiency of gene transfer, and is most likely not sufficient to be of benefit to CF patients although long-term reversal of disease symptoms were not monitored in this studies. The gene transfer efficiency required for physiological correction of CF lung disease has been a matter of recent debate. While Johnson and colleagues have shown that "correction" of ^^10% of CF cells restores normal chloride secretory function to an epithelium, this degree of "correction" was insufficient to correct the hyperabsorption of sodium [19]. Since "correction" of the sodium defect is likely to be necessary for resolving CF lung disease, then transduction of a higher proportion of epithelial cells will be required [1, 20]. Indeed, it has been suggested that greater than 80% of epithelial cells will have to express CFTR to restore the normal sodium transporting capabilities of the epithelium [20]. With regards to efficiency of gene expression on a per cell basis, it appears that CFTR is normally expressed at levels as low as 10 copies per cell and heterozygotes for the CF gene although expressing only 5 6 8 Raymond John Pickles 50% of normal CFTR show no disease symptoms. This suggests that the level of expression per cell does not need to be high in order to correct function. On the other hand, overexpression of CFTR has been shown to have deleterious effects on cell function although the effects on polarized airway epithelial cells are not documented [21]. Issues of safety have arisen due to elicitation of inflammatory responses after Ad instillation in both animal and human experiments [22-29]. These effects have often been due to the large "loads" of vector that has been administered. A current hypothesis is that improvements in gene transfer efficiency may allow smaller quantities of Ad to be administered, possibly circumventing much of the inflammatory response. IV. The Ainvay Epithelium: Cellular Targets for CF Gene Therapy Airway epithelial cells are present throughout the conducting airways of the lung, including the nasal, tracheal, bronchial, and bronchiolar regions. In the upper airway, the surface epithelium lines these structures and is continuous with the tubulo-acinar submucosal mucus-secreting glands that invaginate from the airway surface. Airway epithelial cell-type composition is dependent both on the regional location and on the particular species studied and the reader is referred to comprehensive reviews that describe species- specific epithelial cell distribution in more detail [30, 31]. The epithefial cell types present in the lung are numerous and include ciliated cells, mucus- secreting cells (goblet), serous cells, clara cells, and basal cells. The cell types of the alveolar structures of the lung (alveolar Types I and II cells) are not thought to participate in the pathophysiology of CF lung disease. In human airways, the upper airway regions (nasal, tracheal, bronchial) are composed of a pseudostratified mucociliary epithelium in which ciliated cells predominate with interspersed mucus-secreting goblet cells. The columnar cells overlie intermediary differentiated cells and basal cell layers which interface with the basement membrane. In addition, the human upper airways contain numerous submucosal glands. In the human lower airways, the bronchioles are lined with a simple cubiodal ciliated epithelium containing few mucus-secreting cells, no basal cells, and an absence of submucosal glands. An important morphological difference between the upper airways of human and mice, the most common animal model for investigating airway administration of gene transfer vectors, is that for the mouse upper airway (excluding the nasal cavity epithelium) the columnar cells are roughly an equal distribution of ciliated and clara cells, compared to the predominance of ciliated cells in the human upper airway [32]. Clara cells are a nonciliated bronchiolar mucus-secreting cell type with distinct 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 6 9 properties from ciliated cells. Clara cells, although present in human airway, are located only in the distal airways and account for only a fraction of the cells present in that region [32]. The airway basal cells, or at least a subpopulation, are considered to be stem cell precursors for all other airway epithelial cells in the upper airway regions. Basal cells can differentiate into mucus or ciliated cell phenotypes [33]. Whereas mucus cells may also be able to differentiate into ciliated cells, the ciliated cell is considered as a terminally redifferentiated cell type. An important observation with regard to experimental models of human airway epithelial cells is that isolation of upper airway epithelial cells for tissue culture purposes results initially in a predominately basal cell-like culture since isolated basal cells proliferate at a greater rate than isolated ciliated and mucus cells. Furthermore, for cells isolated from CF airways, the rate of proliferation of basal cells is even greater than that in normal airway, probably reflecting responses to ongoing inflammatory processes [34]. Therefore, morphological differences need to be considered when designing models to study the interactions of gene transfer vectors with airway cells that are presumed to represent the cells in the lung that are exposed to lumenally delivered vectors. Although CF is a disease of the respiratory epithelium, the exact airway region where CF lung disease initiates is still a matter of debate. It does appear that the first signs of pathology occur in the distal airways with findings of bronchiolitis and mucus plugging in the small airways and although the exact nature of how the CFTR defect initiates the disease is not totally resolved, it does appear that hydration of the periciliary fluid layer in these regions may be a major cause [35, 36]. Currently, both the airway surface columnar cells lining the lumen of the small bronchiolar airways and the serous cells of the submucosal glands are candidates for the location for the onset of the disease. The cell type that is believed to be predominately involved in the onset of disease and therefore the specific target for gene transfer is the ciliated cell since these cells exhibit all of the ion and fluid transporting functions of CFTR and display abnormal function in patients with CF [37]. However, the submucosal gland serous cell is the highest CFTR-expressing cell type in the lung, suggesting that these cells may also be an important target for gene replacement [38]. Ultimately, it will be important to determine the location of disease initiation since it is likely that for a lumenal gene therapy to be successful, administration of vector will have to occur early in the life of a CF patient. Later in life, when the airways possess overwhelming mucus plugging and associated bacterial colonization and inflammation, delivery of genes to the target cells will likely become restricted. The current thrust for CF gene therapy strategies is to deliver transgenes to target cell types before such other barriers to treatment are present. 5 7 0 Raymond John Pickles V. Adenoviral Vectors as Gene Transfer Vectors in the Lung A. Animal Models for CF Airway Gene Transfer Studies The generation of CF mouse models was an important step for under standing the physiology of CF disease. There have now been over 10 different mouse models produced displaying a range of CF-associated genetic muta tions [39]. Although most of the models reflect the most common human mutation, either a complete gene knockout or a AF508 mutation of the mouse CFTR, other models with less common human mutations (e.g., G551D) have also been reported. The multiorgan pathophysiology associated with the different models has been recently reviewed [39]. Interestingly, although the gastrointestinal phenotype of CF mice is similar to that observed in CF patients, there is no CF-like pathology associated with the CF mouse lung. A comparison of bioelectrical measurements between CF human and CF murine airways has revealed that both species exhibit, relative to normals, hyperabsorption of sodium and an absent or reduced cAMP-induced chlo ride secretory response. However, it has been deduced that the ion transport defects in the CF mouse airway do not lead to CF-like lung pathology because CF murine airways compensate for the loss of CFTR activity by upregulat- ing an alternative chloride secretory channel that is regulated by changes in intracellular calcium [40]. However, from a practical standpoint, the ability to measure the "bioelectrical defect" in CF mouse airways makes the model useful in terms of monitoring "bioelectrical correction" with gene transfer strategies, but the ability to monitor inhibition or reversal of CF-like pathology induced by transfer of normal CFTR is not possible in these current mod els. Therefore, the current gold standard for success in CF gene transfer to mouse lung in vivo is correction of the chloride (and sodium) ion transport defects. Most gene delivery strategies to murine airways have focused on the epithelium of the nasal mucosa and trachea mainly because of accessibility to these regions but also because these regions are similar to those targeted for human CF gene-therapy trials. Unfortunately, baseline bioelectric mea surements of murine trachea indicate that these tissues not display sodium hyperabsorption [41], a key indicator for the human disease, and one that will likely need to be corrected for a treatment to be successful. In contrast, the epithelium of the CF mouse nasal cavity and freshly isolated CF murine nasal mucosa both display sodium hyperabsorption and reduced cAMP-induced chloride secretory activity providing an ideal model for study [42]. A fur ther difficulty with murine airways (excluding nasal epithelium) is the large proportion of clara cells that are present throughout the upper airway. The 19. Utility of Ad Vectors in Animal Models II: Genetic Disease 5 7 1 distribution of this cell-type in the mouse may be misleading when compar ing gene transfer efficiency between mouse and human upper airways (see below). The murine nasal mucosa, however, has few clara cells and exists as a pseudostratified mucociliary epithelium with a cell-type distribution similar to human nasal mucosa, again demonstrating the usefulness of this tissue for gene transfer studies. Therefore, in conclusion, the CF murine models do not display sponta neous or induced pathological signs of human CF lung disease. However, CF murine airways do display bioelectric abnormalities associated with human CF and correction of these parameters by gene transfer can be measured both in vitro and in vivo. Given these considerations, since most clinical trials have focused on studying gene transfer to the nasal mucosa, the CF mouse nose is considered a good model for studying these strategies. In addition, since the epithelial cell-type distribution in human nose is similar to that of the human trachea and bronchus the nasal epithelium would appear to be a good model for a large proportion of the human airway epithelium. B. Success and Limitations of Ad 1. Efficiency of Gene Transfer a. Cell Types The major cell types that support wild-type Ad infection in the lung are the epithelial cells of the respiratory mucosa lining the airway passages. The tropism of Ad to the respiratory epithelium established this vector as an obvious candidate for delivering transgenes to the lung. Indeed, Ad-mediated gene transfer to airway epithelial cells grown under standard culture conditions in vitro is highly efficient [43, 44], with cellular transduction efficiencies of 90-100% and when the transgene is CFTR, full correction of the spectrum of CF bioelectrical defects is obtained [1]. In contrast, observations from in vivo epithelial cell models derived from cartilaginous (upper airway) regions of the airways of rodents and nonhuman and human primates show that transgenes are expressed after in vivo dosing in less than 20% of the surface epithelial cells, an efficiency unlikely to benefit to the defective physiology of a CF airway [43, 45]. Although the efficiency of gene transfer can be enhanced by prolonging the contact time of Ad with the epithelium for 12-24 h, it is difficult to envision this strategy as being practical in a cfinical scenario [46, 47]. In the case of intralumenal delivery of Ad to the lower airways of rodents, gene transfer to 10-80% of the airway epithelial cells has been reported with apparently no cell-type-specific selectivity [48, 49], although, in a
detailed study of Ad administration to murine airways, only the nonciliated bronchiolar epithelial cells (i.e., Clara cells) were observed to express transgenes [50]. Clara cells are not thought to require correction in the CF lung and this observation casts a shadow on the use of murine airway epithelium as a model for Ad-mediated gene transfer to the human airway epithelium where Clara cells 572 R a y m o n d John Pickles are less common. Therefore, it appears that lumenal-facing well-differentiated airway epithelial cells in vivo^ at least in the upper airway regions, are resistant to efficient Ad-mediated gene transfer. How can we envision that the airway epithelial cells facing the lumen of the airway are not transduced by Ad given the large body of clinical data that shows that these cells are targeted in wild-type infections? In a series of studies using human tracheal epithelium ex vivo and murine trachea in vivo it was discovered that injury to the epithelium by physical abrasion of the columnar cells revealed epithelial cell types that are susceptible to efficient Ad-transduction, as depicted in Fig. 1 [43, 51, 52]. This cell-type-specific variable efficiency led to the finding that underlying basal cell-like cells were efficiently transduced by Ad. These cells, as precursors to columnar cells could, once transduced, over time proliferate and differentiate into transgene-expressing columnar epithelial cells. Since the epithelial basal cells are probably stimulated to proliferate and differentiate upon injury these susceptible cells were described as ''basal cell-like cells" or the poorly differentiated (PD) airway epithelial cells, i.e., injured or regenerating cells, and this cellular phenotype is similar to that displayed by airway epithelial cells grown on plastic that are also highly transducible by Ad [43, 44]. One consideration when comparing wild-type Ad infection to Ad vectors is that the latter rely on delivering many virus particles to a target tissue Figure 1 Increased susceptibility of injured epithelium to Ad-mediated gene transfer. Exposure of Ad vectors to intact pseudostratified columnar cells (CC) results in low gene transfer efficiency. Physical abrasion of columnar cells before Ad exposure results in efficient gene transfer to the underlying basal cells (BC). Upper figures show schematic of intact and injured pseudostratified columnar respiratory epithelium and lower figures are intact and abraded human tracheal epithelium exposed to AdLacZ ex vivo. Reprinted with permission from [20]. 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 7 3 whereas wild-type Ad needs only access to a small number of cells from which Ad replication and spread can then occur. Therefore, wild-type Ad may be able to take advantage of regions of the airway in which epithelium integrity is compromised or injured. Initiation of wild-type infection in injured regions would then be able to spread as a "basal cellitus" effectively beneath the resistant superficial columnar cells. b. Receptors The differences in the gene transfer efficiencies for the two cellular phenotypes of airway epithelial cells, the PD and well-differentiated (WD) columnar cells, suggests that an early step in the virus-cell interaction is deficient for the WD cells. Adenovirus enters epithelial cells by a two-step process: (1) initial attachment of the viral fiber-knob protein to a high-affinity receptor, the human Coxsackie B and adenovirus 2 and 5 receptor (hCAR)) [53, 54]; and (2) translocation of the virus into the cell cytoplasm via clathrin-coated pit internalization processes, in part mediated by an interaction of the viral penton base with ayPs/s integrins [55]. Since quantitative studies of the interactions of Ad with the airway epithelium in vivo are difficult and prone to considerable variation, specialized cell culture models have been generated to aid characterization of the interac tion of Ad with both PD and WD cell types. These models have been shown by a number of groups to reproduce: (1) the well-differentiated (ciliated) and poorly differentiated cellular phenotypes and (2) the relative resistance of WD and permissiveness of PD cells to Ad-mediated gene transfer as observed in vivo [56., 57]. In addition, although these models were originally generated to ask specific questions regarding gene transfer strategies, they have subsequently become valuable in a whole series of studies where quantitative and qualitative measurement of events in the airway epithelium are difficult to perform in vivo [35, 36, 58-63]. Using these models of human airway epithelium, immunofluorescent and functional analyses of the interactions of Ad with human airway epithelial cells have shown that decreased gene transfer efficiency to WD compared to PD cultures is due to limited entry (penetration) of Ad across the apical membrane of WD cultures, which reflects a reduced specific Ad-attachment due to the absence of hCAR and ayPs/s integrins from the apical surface. Interestingly, columnar cells and basal cell-like cells express all the necessary receptors to efficiently allow Ad entry but for columnar cells these processes are segregated and limited to the basolateral membranes as depicted in Fig. 2. In these culture models systems. Ad has been shown to efficiently transduce epithelial cells when applied to the basolateral epithehal surfaces [56, 57, 64, 65]. It appears that the most significant Ad-cell interaction in determin ing efficiency is that of the Ad-hCAR interaction. Many cell types usually resistant to Ad infection have been shown to be efficiently transduced after heterologous expression of hCAR, although the status of integrin expression 574 R a y m o n d John Pickles Figure 2 Schematic of polarized epithelial cells displaying resistance of the lumenal surface to adenovirus attachment and entry. The receptors required for Ad entry are located on basolateral membranes and excluded from the apical membrane by the tight junctional complexes. Reprinted with permission from [144]. in these cell-types is not always clear [56, 66]. Earlier observations had sug gested that inefficient Ad-mediated gene transfer to a bronchial xenograft model of human in vivo-like ciliated airway epithelial cells reflected the absence of avP3/5 integrins from the lumenal membrane of the epithelium [65]. However, ayPs/i integrins may not alone account for decrements in gene transfer efficiency. In support of this hypothesis, Ad mutants lacking penton base RGD sequences (normally required for Ad-ayPs/j integrin interactions) are able to efficiently transduce human epithelial cells although the rate of internalization is reduced [67]. In addition, in a P5 integrin-knockout mouse model, airway epithelial cells were equally susceptible to Ad-mediated gene transfer as were wild-type airway cells [68], again suggesting that ayPs/s inte grins may be facilitative rather than necessary for efficient vector entry into the cell. These observations are important for the design of targeted vectors that attempt to increase gene transfer efficiency to normally unsusceptible cell types [69, 70]. Retargeted vectors attached via nonspecific interactions or to noninternalizing receptors will probably depend on nonspecific uptake pathways to enter cells and while this approach is useful for PD cells in vitro, increasing Ad-attachment to WD cultures that do not exhibit these pathways is unlikely to improve gene transfer efficiency [56]. c. The Innate Immune System of the Lung Despite the progress on the cell biological aspects of vector-cell interactions, surprisingly little atten tion has been devoted to another fundamental component of innate airway defense that will almost certainly impact on the efficiency of lumenally 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 7 5 delivered vectors, the barrier/shielding function of epithelial surfaces by the carbohydrate-rich cell surface glycocalyx. Expression of hCAR, engineered to be expressed at the apical surface of polarized epithelia by incorporation of a glycosylphosphatidylinositol-linker (GPI-CAR), identified glycocalyx com ponents as barriers for lumenally applied Ad, accessing these receptors as depicted in Fig. 3 [71]. Electron micrographs demonstrate a "fuzzy coat" on the cell surface [72, 73], termed the glycocalyx, and on epithelial cell apical surfaces it is composed of several families of carbohydrate-rich molecules, including glycoproteins (most notably the mucins), proteoglycans, and glycol- ipids. Glycoconjugates are variably modified by sialic acid and sulfate that impart a strong anionic charge to the cell surface. A major component of the airway glycocalyx w îll likely be the "tethered" mucins and the molecular biologic advances in the mucin field have revealed that the MUCl and MUC4 are highly expressed in airway epithelium and have transmembrane anchoring (tethering) domains [74-82]. With respect to airway gene transfer, sialogly- coconjugates (including MUCl) comprising the glycocalyx on MDCK cells, appear to inhibit Ad gene transfer, presumably due, in part, to their negative charge since neuraminidase treatment to selectively remove sialic acid can circumvent the glycocalyx barrier in these cell types [83, 84]. Although apical surface mucins expressed on WD cells are also restrictive to Ad, neuraminidase alone is not sufficient to allow Ad permeation through the glycocalyx, and Figure 3 Schematic of polarized epithelial cell expressing reengineered Ad receptors at the apical surface. These studies revealed that the apical surface glycocalyx was an effective barrier to Ad accessing receptors located on the apical surface. 5 7 6 Raymond John Pickles more stringent proteolytic treatments are required [116, 117]. Presumably, the mucins, including both tethered and secreted mucins, may also be present in the mucus layer in the airway and may act as false attachment sites for Ad, thus effectively reducing the amount of Ad that ultimately reaches the epithelial surface. The reported rheological properties of CF mucus producing a more viscous, more dehydrated and immobile barrier suggest that this obstacle to gene transfer v îll be even more pronounced in the CF lung. Other components of the innate immune system, not studied in specialized cell culture models, may also have barrier effects on gene transfer efficiency. Ordinarily, such barriers occur in the lung as primary defense mechanisms and may be aggravated in the CF lung w^here airway lumens are inflamed. For example, alveolar macrophages have been reported to sequester up to 70% of Ad genomes within 24 h following tracheal administration to mouse airways [85]. In a mouse nasal model of CF lung bacterial colonization, Pseudomonas infection (PAOl strain) was shown to inhibit Ad gene transfer by 10-fold relative to noninfected control nasal airways [86]. In conclusion, there appear to be numerous potential barriers to Ad gene transfer in the lung especially in the CF lung that exhibits an overactive inflammatory milieu, and strategies to circumvent these barriers will likely need to be designed. However, even if all of these barriers are circumvented the major cause of low efficiency gene transfer is the lack of entry of Ad into the target cells. Strategies to improve the transduction efficiency will therefore be crucial to proving that the concept of gene transfer into the airway may actually be a feasible one. In summary, human WD cultures are resistant to Ad-mediated gene transfer because of decreased specific attachment sites and reduced nonspecific entry paths that can internalize a fraction of a large vector load typical of CF gene therapy protocols using Ad. To circumvent the inefficiency of Ad-mediated gene transfer to the respiratory epithelium, either alterations of the host will be required, i.e., ability to access Ad receptors expressed on basolateral cell surfaces, or Ad will require retargeting to receptor types that are present in sufficient number on the airway epithelial lumenal surface which allow for efficient uptake of Ad into the cell. 2. Safety Initial attempts to improve efficiency of Ad gene transfer to the airway epithelium in vivo have mostly involved delivery of greater doses of Ad to the lung. These doses can represent a relatively large protein load and the subsequent gene expression (even in nonepithelial cells) can produce an unusually high level of transgene in an organ that is designed for monitoring invading pathogen assaults. It is therefore not surprising that inflammatory and immune responses are observed when Ad is delivered to the lung and numerous studies have reported Ad-induced lung inflammation. In general. Ad induces 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 7 7 an acute nonspecific mixed cellular inflammatory response and a late specific, dose-related, lymphocyte-predominant, cell-mediated immune response in all species so far studied [22, 23, 25-27, 29, 87-90]. The acute response is nonspecific and likely induced by cytokine production in response to the protein load. It has also been suggested that neurogenic inflammation results after administration of Ad in rat airways, an effect shown to be partially due to vector gene expression but also to the viral proteins of the capsid coat [91]. The
later, specific immune response to Ad is mediated by major histocompatibility complex (MHC) class I-restricted cytotoxic (CDS) T lymphocytes directed against viral gene products and transgene proteins in expressing cells. The subsequent destruction of these cells leads to loss of persistence of transgene expression and so reduces efficiency of gene transfer [28, 92, 93]. The use of second-generation and high-capacity "gutless" vectors aims to limit the amount of viral gene expression to decrease the effects of this late immune response and these approaches are the topics of other chapters [94, 95]. In addition to cellular immune responses. Ad also elicits humoral immune responses with the production of mucosal and neutralizing antibodies [25, 87, 90, 96-98]. These responses have been shown to be against the viral capsid proteins and are secondary to a helper (CD4~ )̂ T lymphocyte response. The production of such an antibody response results in neutralization of subsequent readministration of Ad, resulting in loss of gene transfer, assuming that the same Ad serotype is used (see below). Therefore, in addition to the innate immunity of the lung (receptor localization, glycocalyx, macrophages, mucus) reducing the efficiency of gene transfer, the cellular and humoral immune systems also respond to Ad delivery into the airway and as a result reduce the efficiency of gene transfer and the persistence of expression in the target epithelial cells. C. Overcoming the Limitations of Ad 1. Efficiency The localization of entry pathways for Ad to the basolateral surfaces of airway epithelial cells suggests that a delivery strategy to access these regions would be beneficial to improving gene transfer efficiency. This approach may also allow targeting of the epithelial stem cells (basal cells), resulting in transgene expression in the lung for the lifetime of the individual. This is an important consideration for gene transfer to the airway epithelium since fully differentiated lumenal facing cells (e.g., ciliated cells) have a relatively short lifetime, on the order of 40-100 days, and targeting these cell types specifically will require regular readministration of vectors. Access to basal cells/basolateral surfaces may possibly be achieved by intravenous administration of vectors if penetration of the blood vessel wall, the connective tissue, and the basal lamina of the basement membrane were 5 7 8 Raymond John Pickles achievable. Unfortunately, studies that have attempted intravenous delivery strategies have not been successful since vectors do not appear to gain access to sufficient lung epitheHal cells to make this approach feasible [99-102]. Barriers functions provided by the blood vessel endothelial cells and connective tissue surrounding the airv^ay passages seems unpenetratable by Ad. Indeed, the particle permeability of the basal lamina alone is thought to exclude inert particles of greater than 10 nm, which would certainly be restrictive to particles the size of Ad (100 nm). In an in vivo experimental mouse model where Ad was externally administered directly to the tracheal basement membrane, efficient gene transfer to the connective tissue fibroblasts adjacent to the basement membrane was observed without gene transfer to the epithelial cells of the juxtaposed epitheHum [51]. To date, two main strategies to improve intralumenal delivery of Ad vectors have been focused on. One approach is to access the basolateral surfaces of the epithelial cells by disruption of the epithelial "tight" junctions, and the other is to retarget Ad vectors to nonviral receptors that are present on the apical surface of lumenal epithelial cells that allow for entry of Ad into these cell types. Retargeting has so far been achieved by chemically, immunologically, or genetically modifying the Ad capsid coat by incorporating new receptor ligands that can target candidate receptors. a. Modification of the Host by Opening Tight Junctions Epithelial cell "tight" junctions (zonulae occludens) are collar-like structures composed of a diverse number of proteins that separate the apical and basolateral domains of the lumenal columnar epithelial cells. As well as functioning as a restrictive barrier to mixing of apical and basolateral membrane components, these intercellular junctions limit the transepithelial transport of solutes across the epithelium. A number of disease states have been shown to alter tight junction permeability (e.g., asthma) and reagents to increase the permeability of the junction are available. The key to successful disruption of tight junctions to allow Ad access to basolateral epithelial cell surfaces will be to use a reagent that opens tight junctions sufficiently for Ad to pass through but that is rapidly reversible to limit the passage of other lumenal contents (e.g., bacteria) or serosal fluid into the airway lumen. A property exploited for this purpose is the calcium ion dependency of the structural integrity of the junction. Walters et al.^ have successfully shown that treatment of the apical surface of human WD airway cells with the calcium chelator EGTA or hypotonic solutions (e.g., water) allow for improvements in Ad-mediated gene transfer presumably by allowing Ad access to basolateral receptors [64,103]. The slow reversibility of this effect, however, is problematic; tight junction reformation takes a least a couple of hours, a time period that would be unacceptable in a clinical setting. In vivo studies in mouse airways have confirmed that these treatments improve gene transfer efficiency although parameters of safety were not assessed fully [104, 105]. 19. Utility of Ad Vectors in Animal Models II: Genetic Disease 5 7 9 More specific reagents are available for studying tight junction perme ability and the effect on Ad-gene transfer. Parsons et al. used a detergent, polidocanol, in murine airways in vivo to enhance Ad-mediated gene transfer, an effect shown to be due to the ability of this reagent to transiently open tight junctions 186]. The short-chain fatty acid sodium caprate, has also been used to increase Ad-mediated gene transfer to human WD cultures and results in full correction of CF cultures when AdCFTR is subsequently applied to the apical surface. This result is exciting since the effect is rapidly reversible effect and has previously been used clinically for enhancing pharmaceutics absorp tion across the GI tract, again presumably by an effect on tight junctional permeability. These studies although fraught with inherent safety issues are beginning to establish that this strategy for delivering transgenes to the lung may be a viable option. The possibility of targeting the basal stem cells by this procedure is reason enough to continue pursuing the usefulness of these strategies. b. Targeted Ad to Increase Gene Transfer Efficiency Targeted Ad directed against specific receptors have been used to successfully transduce cell types that are usually refractory to Ad infection. The epidermal growth factor receptor, stem cell factor receptor, fibroblast growth factor receptor, ay integrins, and T-cell receptors (CD 3), have all been used as surrogate recep tors for Ad entry in a variety of cell types [106-109]. Given the lack of Ad receptors at the apical surface of lumenal airway epithelial cells, a retargeting strategy to receptors known to present on the airway lumen may allow for gene transfer efficiency to be improved. However, a successful targeting strategy to the lung epithelium will require the identification of target molecules that allow for attachment and internalization of AdV across the apical membrane of columnar airway epithelial cells. The identification of target receptors to which to redirect Ad tropism on the lumen of airway epithelium is difficult because most receptors and entry mechanisms occur on the basolateral surfaces of the cells. Certain members of a specific seven-transmembrane-spanning G-protein-coupled receptor family (i.e., P2Y2-purinoceptors, B2-kinin receptors, and adenosine type 2b receptors) have been identified as putative utile target receptors for redirecting Ad tropism to the surface epithelium of the lung. These receptors have been shown to be present on the lumenal surface of human airway epithelium and internalized into clathrin-coated pits when activated by their respective agonists [110]. The utilization of clathrin-coated pit internalization pathways for native Ad receptors, suggests that the G-protein coupled receptors may provide an ideal surrogate entry pathway for Ad. The high potency of P2Y2 agonists (e.g., ATP, UTP) combined with the low affinity of these agonists for the receptor suggests that the P2Y2 purinoceptors are abundant in number on the lumenal surface of the human respiratory epithelium [111]. Since pharmacological 5 8 0 Raymond John Pickles activation of airway epithelial P2Y2 receptors do not result in untoward effects in human airways, this receptor is an ideal target receptor to redirect Ad tropism. However, since the only available ligands for this receptor are low affinity, small organic molecules, certain technical difficulties are associated with conjugating these molecules to Ad. Other receptor types suitable for Ad retargeting exist on the airway, although specific retargeting data for Ad is lacking. The urokinase plasminogen activator receptor, uPA-R and the SEC- 2 receptor have also been proposed as target receptors for Ad and AAV, respectively [112, 113]. /. Immunologically modified targeted vectors One immunological app roach for targeting gene transfer vectors is using bispecific antibodies linking Ad directly to non-Ad-receptor-types present on the cell surface [108,114]. For example, chemically conjugated antibodies, one of which is directed against an epitope-tagged Ad coat protein and the other against oty integrin membrane proteins have been reported to increase gene transfer efficiency by seven- to ninefold compared to that of nonmodified Ad, indicating that increased Ad-attachment results in increased gene transfer efficiency [114]. In a similar approach. Ad was retargeted to nonviral receptor types in conjunction with ablation of the natural Ad tropism using an anti-fiber-knob protein antibody conjugated to folate [115]. Folate-conjugated antibody was the ligand of choice since the folate receptor is reported to be upregulated on the surface of malignant cells, thus providing a targeted vector for a variety of cancers. Retargeting Ad to cells expressing folate-receptors was shown to be specific and successful with significant increases in gene transfer efficiency. As "proof of concept" studies, a hemaggluttin (HA)-epitope-tagged P2Y2 receptor expressed at the apical surface of human WD cultures and tar geted with bispecific antibodies consisting of antibodies to Ad fiber-knob protein/HA-tag has been shown to facilitate Ad entry into these cell types, shown schematically in Fig. 4 [116, 117]. This effect is enhanced by coad ministration of exogenous ATP to activate the receptor, an effect that can be reduced by desensitization of the P2Y2 receptors prior to addition of tar geted Ad. Importantly, the apical surfaces of the HA tagged-P2Y2 expressing cultures required a brief exposure to specific proteases before targeting was effective suggesting that the apical surface glycocalyx hindered access of the targeted vector to the target receptors [116]. This approach also relied on the expression of a HA-tagged receptor that may be overexpressed relative to the endogenously expressed P2Y2 receptors in the culture system. The number of target receptors and the affinity of the targeting ligand are both likely to be critical parameters for the success of such a targeting strategy. //. Chemically modified targeted vectors Since antibodies to the external domains of P2Y2 receptors are not currently available, a strategy to target Ad to the endogenous P2Y2 receptor was to chemically conjugate small molecule agonists (DTP) to the proteins of the Ad capsid coat. Using chemically reactive 19. Utility of Ad Vectors in Animal Models II: Genetic Disease 581 Figure 4 Schematic of targeting strategy used to redirect Ad tropism to P2Y2 receptors on the apical surface of human airway epithelial ceils. Bispecific antibodies against the virus and the receptor were used as a targeting link and activation of the receptor results in receptor internalization and entry of Ad with subsequent gene transfer. biotin derivatives, biotin v^as coupled to the Ad capsid coat predominately via hexon protein. This strategy is reported to couple 2-300 biotins to a single Ad particle and does not significantly alter the fiber-knob-hCAR interac tion. By using commercially available biotin-linked UTP in combination v^ith streptavidin as a "bridge" linking biotin-Ad to biotin-UTP, these molecular conjugates v^ere shown to mediate gene transfer by an interaction specifically v^ith endogenous P2Y2 receptors on the apical surface of WD cultures [110]. Again, the effectiveness of this approach w âs reduced by the presence of apical surface glycocalyx since gene transfer was only observed in cultures pretreated with agents that degrade this barrier. Regardless, gene transfer efficiency using these conjugates was still inefficient, probably due to the clumsiness of the "streptavidin bridge" and the low affinity of UTP for this receptor. Future experiments using this targeting strategy will require the identification of receptor agonists with
higher affinity in addition to improved methods to directly couple the agonist ligands to the Ad capsid coat. 5 8 2 Raymond John Pickles Another method for chemically conjugating receptor ligands to Ad is by the use of polyethylene glycol (PEG) that can be covalently linked directly to the Ad capsid coat. A number of groups have now shown that PEG conjugated viruses can be used to target Ad [112, 118]. For example, Ad conjugated to a 12-amino-acid peptide, identified from phage display assays on the apical surfaces of human WD cultures, resulted in a 10-fold increase in gene transfer efficiency to these cell types [118]. Similarly, Ad conjugated via PEG to a peptide that binds to uPA-R has been shown to target Ad to this receptor type and enhance gene transfer to polarized airway epithelia [112]. An additional bonus of using PEG-conjugated Ad is that these vectors appear to be less immunogenic that non-PEG-conjugated Ad. This effect is due to the masking of antigenic Ad capsid proteins (mainly hexon) from neutralizing antibodies ([119], see below). ///. Genetically modified targeted vectors The ideal targeted vector would be one in which the target ligand could be incorporated into the capsid coat with minimal disruption of the physical and biological properties of Ad. For targeting strategies in which a peptide ligand is used, the most desirable method would be to generate an Ad vector genetically modified to express a functional peptide ligand on the viral surface. Such an approach for targeting vectors has been reported, where the Ad viral coat has been genetically modified to express multiple polylysine groups on the C-terminus of the Ad fiber-knob protein [70]. This redirects Ad tropism to heparan sulfate moieties that are present on the surfaces of most mammalian cells. With certain nonepithelial cell types, which lack hCAR, this modified vector has been shown to increase gene transfer efficiency 10- to 300-fold in comparison to nonmodified Ad. However, the modified vector will likely not be useful for gene transfer to the airway epithelium since heparan sulfate is not expressed at the apical surface of airway epithelial cells [120]. Targeted Ad in which the fiber-knob protein (responsible for Ad attachment to the hCAR) has been modified to express novel ligands that can interact with other receptor-types are being developed and the feasibility of this approach has now been reported by a number of groups [107, 121, 122]. A recent development in this type of approach was reported by Krasnykh et al. [123], who hypothesized that the HI loop region of the fiber-knob structure can withstand the insertion of heterologous peptide sequences without significantly compromising the tertiary structure of the fiber-knob protein or the production and infectivity of the modified Ad. These authors incorporated the FLAG octapeptide marker sequence into the HI loop region and were able to produce functional Ad. Importantly, they also showed that the sequence contained within intact virions was accessible to a FLAG-specific antibody, suggesting that sequences inserted into this region are capable of interacting with other target substrates such as cell-surface receptors. A significant technical advance in Ad targeting strategies evolved from studies that deduced the viral sequences in fiber-knob protein that interact 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 8 3 with hCAR. Genetic ablation of these sequences from Ad vectors led to the generation of Ad that no longer binds to hCAR and no longer transduces cells that are permissive for normal Ad transduction [124]. The broad cellular tropism of Ad vectors can nov^ be reduced, and by the addition of targeting moieties to these Ad vectors specific cell-type targeting is possible. Reduced Ad interactions with nontarget cells will lessen the potential for adverse effects with these vectors. In the lung however, the significance of natural tropism ablation is unclear since most of the epithelial cells targeted with delivery strategies do not express Ad receptors at the lumenal surface. However, the loss of transduction to other cell-types that may interact with Ad delivered to the lung (e.g., macrophages, dendritic cells) may benefit from the hCAR-binding ablation mutant. Recent developments in immunologically, chemically, and genetically modified targeted Ad suggests that "designer" gene transfer vectors will one day be available. Although Ad vectors, in their present form, may not be ideal for a number of gene transfer target tissues, notably the lung epithelium, this vector clearly remains at the forefront of gene therapy research since it is still one of the most efficacious gene transfer vectors available, and will continue to be useful at least in proof-of-concept studies. iv. Screening with other adenoviral subtypes Although over 51 different serotypes of wild-type Ad exist, the predominant serotypes used for gene transfer experiments are serotypes 2 and 5. The reason for this is largely historical since these two serotypes have been extensively studied over the past 30 years and understanding of the viral genome has allowed the manipulations necessary to evolve these viruses into gene transfer vectors. With regard to the airway epithelium, other serotypes have been suggested to be efficacious at delivering transgenes to human WD cultures. Serotypes 17 and 12 have been shown to bind/deliver transgenes 10-fold over Ad2 vectors [125]. However, as of yet no conclusive results have been presented that suggest that the improvements warrant future investigations with these vectors. One approach to determining if any of the other serotypes may be more efficacious in the lung epithelium could be envisioned using a recently reported system of generating an Ad5 capsid-expressing fiber proteins from the other serotypes [126]. This system was used to screen vascular endothelial and smooth muscle cells and the efficiency of gene transfer compared against the efficiency of gene transfer with Ad5. This screening procedure identified Ad5 with Adl6 fibers as being significantly more efficient at gene transfer than Ad5 in these particular cell types. It will be of interest to screen these serotypes on human WD cultures relative to Ad5 to determine whether other Ad serotypes may be of benefit to airway epithelial cell gene transfer. A serotype which may be of particular interest is Ad37, since it has been reported that Ad37 utilizes sialic acid residues that are present on the extracellular surfaces of most cells [127]. An abundance of sialic acid residues on the lumenal surface of airway epithelial 5 8 4 Raymond John Pickles cells as components of glycoconjugates may allow for improved gene transfer. Whether attachment of Ad37 to sialic acid residues located on the airway lumen leads to efficient entry and gene transfer awaits further study. V. Other methods to increase gene transfer efficiency Nonspecific meth ods to enhance Ad-mediated gene transfer to airway epithelial cells have been reported [128, 129]. Calcium phosphate coprecipitation has been used to pre cipitate aggregates of Ad and other vectors to increase gene transfer to airway epithelia both in vitro and in vivo. It has been suggested that in vivo these aggregates increase the rate of nonspecific endocytosis of Ad across the apical membrane of polarized epithelial cells. The possible effects of this technique on cellular and paracellular permeability have not been investigated. Another method to both improve both the delivery and efficiency of Ad to the lung epithelium in vivo is using the inert perfluorochemicals (PFCs). These compounds are liquid in nature but due to high oxygen saturation capacities can be instilled into the lung for periods of time with maintenance of passive oxygen diffusion. Several studies have now shown that administration of gene transfer vectors (including Ad) with PFC results in increased gene transfer to rodent and nonhuman primate lungs [130-132]. The improvements in gene transfer are predominately localized to the alveolar regions with only modest improvements in the efficiency of gene transfer to the respiratory epithelium. The exact mechanism by which PFCs produce these effects remains to be determined, but may be due to prolonged contact time for the vector on the cells and reduced ingestion of Ad by macrophages and/or due to some nonspecific effect on the paracellular permeability. Nonetheless, this method provides an example of a new strategy to deliver transgenes to the lung without the need for direct instillation or aerosolization, which are both inefficient methods for airway epithelium delivery. 2. Safety Strategies that improve gene transfer efficiency, as described above, will allow for lower doses of Ad to be administered to the lung. This achievement alone will be beneficial in reducing the inflammatory responses seen with Ad administration. However, attempts have also been made to reduce the inflammation produced by expression of viral genes that produce the cell- mediated immune responses described above. The identification of specific viral genes that initiate or amplify the immune response has led to the reengineering of Ad vectors to ablate the specific gene expression. For example, vectors deleted of E2a and E4 have been reported to display reduced immune responses and improve persistence of transgene expression [92, 93]. The ultimate vector is one that contains no viral genes and the high-capacity "gutless" vectors have been generated and appear to blunt the immune response considerably [133-135]. In contrast, several viral genes have been identified that have evolved to subvert the immune response and the inclusion of these genes into new vectors may be desirable (e.g., E3) [136]. 19. Utility of Ad Vectors in Animal Models II: Genetic Disease 5 8 5 Strategies to circumvent the humoral immune response have also been considered. Since this arm of the immune system results in the inability of readministration of specific Ad serotypes, serotype switching has been proposed as a method to allow repeat administration. Indeed, Ad5 administration but not Ad4 or Ad30 has been reported to prevent the gene transfer obtained with subsequent Ad5 administration the lung [97]. However, in addition to this being a somewhat limited procedure, it is not yet clear whether these different serotypes are as inefficient for gene transfer to the airway epithelium as Ad5. Transient immunosuppression has also been suggested to reduced the inhibitory effects of neutralizing antibodies. Intratracheal administration of immunosuppressive factors (IL-12, gamma interferon, antibodies to CD40, corticosteroids and cyclophosphamide) at the time of vector administration have all shown a reduction in generation of neutralizing antibodies [137-141]. The longer-term effects of administering these factors to lung have not been reported. Finally, covalent conjugation of PEG to the Ad capsid coat that permits addition of targeting moieties is also a strategy for the virus to elude neutralizing antibodies by masking capsid coat proteins, especially hexon protein. Although PEGylation of Ad leads to some loss of viral titer and aggregation the ability of this procedure to develop targeted vectors combined with reduction in immune response makes this a promising method for future study [119]. VI . Other Vectors The focus of this review has been on Ad vectors for use in CF lung disease. Flowever, a number of other vectors have been suggested as candidates for CF lung gene transfer vectors. Adeno-associated virus (AAV), retrovirus, lentivirus, and liposomal vectors have all shown promise in preclinical studies in the lung and some have been tested in clinical trials. The general observation is that all of these vectors, like Ad, do not appear to display the efficiency of gene transfer in WD airway epithelial cells as they do in nonpolarized cells, suggesting that these vectors confront similar barriers in the airways as do Ad vectors. Strategies to improve gene transfer efficiency for these other vectors have followed the progression of experiments with Ad, i.e., tight junction modulation, targeting, serotype switching, and immune response reduction, and all have been shown as for Ad to improve efficiency to some to degree. Whether efficiency can ever be improved to a point that shows efficacy in the lungs of CF patients remains to be determined. Meanwhile, other viruses (sendai virus [142] and lentiviruses pseudotyped with filovirus coat proteins [143]) may show promise for gene delivery to the airway and preliminary reports suggest that these viruses or components thereof may one day provide us with a method to deliver transgenes to the lung in an efficient and safe manner. 5 8 6 Raymond John Pickles VII. Conclusion It is clear that the evolution of gene therapy has been aided by many different aspects of basic biological and medical research efforts and the possibility of a gene therapy for CF lung disease will
only take time and a continuation of these efforts. These findings will not only be beneficial to the treatment of CF lung disease but also other disease states, which are continually being brought closer to a treatment and perhaps a cure by this new and exciting biomedical technology. Ackno>vledgments The author especially thanks Dr. Ashley Henderson of the UNC Pulmonary Division for useful discussions and critical review of the manuscript and Jennifer Nank for help w îth both manuscript and figure production. References 1. Johnson, L. G., Boyles, S. E., Wilson, J., and Boucher, R. C. (1995). Normalization of raised sodium absorption and raised calcium-mediated chloride secretion by adenovirus-mediated expression of cystic fibrosis transmembrane conductance regulator in primary human cystic fibrosis airway epithelial cells./. Clin. Invest. 95, 1377-1382. 2. Drumm, M. L., Pope, H. A., Cliff, W. H., Rommens, J. M., Marvin, S. A., Tsui, L. C , Collins, F. S., Frizzell, R. A., and Wilson, J. M. (1990). Correction of the cystic fibrosis defect in vitro by retrovirus- mediated gene transfer. Cell 62, 1227-1233. 3. Rommens, J. M., lannuzzi, M. C , Kerem, B., Drumm, M. L., Melmer, G., Dean, M., Rozmahel, R., Cole, J. L., Kennedy, D., Hidaka, N., et al. (1989). Identification of the cystic fibrosis gene: chromosome walking and jumping. Science 245, 1059-1065. 4. Stutts, M. J., Canessa, C. M., Olsen, J. C , Hamrick, M., Cohn, J. A., Rossier, B. C , and Boucher, R. C. (1995). CFTR as a cAMP-dependent regulator of sodium channels. Science 269, 847-850. 5. Boucher, R. C , Stutts, M. J., Knowles, M. R., Cantley, L., and Gatzy, J. T. (1986). Na-f transport in cystic fibrosis respiratory epitheha. Abnormal basal rate and response to adenylate cyclase activation./. Clin, Invest. 78, 1245-1252. 6. Rosenfeld, M. A., Yoshimura, K., Trapnell, B. C , Yoneyama, K., Rosenthal, E. R., Dale- mans, W., Fukayama, M., Bargon, J., Stier, L. E., Stratford-Perricaudet, L., et al. (1992). In vivo transfer of the human cystic fibrosis transmembrane conductance regulator gene to the airway epithefium. Cell 68, 143-155. 7. Zabner, J., Couture, L. A., Gregory, R. J., Graham, S. M., Smith, A. E., and Welsh, M. J. (1993). Adenovirus-mediated gene transfer transiently corrects the chloride transport defect in nasal epithelia of patients with cystic fibrosis. Cell 75, 207-216. 8. Boat, T., Welsh, MJ, and Beaudet, AL. (1989). Cystic fibrosis. In "The Metabolic Basis of Inherited Disease" (E. R. Scriver, A. L. Beaudet, W. S. Sly, and D. Valle, eds.), pp. 2649-2680. McGraw-Hill, New York. 9. Riordan, J. R., Rommens, J. M., Kerem, B., Alon, N., Rozmahel, R., Grzelczak, Z., Zielen- ski, J., Lok, S., Plavsic, N., Chou, J. L., et al. (1989). Identification of the cystic fibrosis gene: Cloning and characterization of complementary DNA. Science 14S, 1066-1073. 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 8 7 10. Welsh, M. J., and Smith, A. E. (1993). Molecular mechanisms of CFTR chloride channel dysfunction in cystic fibrosis. Cell 73, 1251-1254. 11. Cheng, S. H., Gregory, R. J., Marshall, J., Paul, S., Souza, D. W., White, G. A., O'Riordan, C. R., and Smith, A. E. (1990). Defective intracellular transport and processing of CFTR is the molecular basis of most cystic fibrosis. Cell 63, 827-834. 12. Kalin, N., Claass, A., Sommer, M., Puchelle, E., and Tummler, B. (1999). DeltaF508 CFTR protein expression in tissues from patients with cystic fibrosis. / . Clin. Invest. 103, 1379-1389. 13. Quinton, P. M. (1990). Cystic fibrosis: A disease in electrolyte transport. FASEB J. 4, 2709-2717. 14. Johnson, L., and B. RC. (1997). Towards correction of the genetic defect in cystic fibrosis. In "Gene Therapy for Diseases of the Lung" (B. KL, Ed.) Vol. 104, pp. 239-265. Dekker, New York. 15. Crystal, R. G., McElvaney, N. G., Rosenfeld, M. A., Chu, C. S., Mastrangefi, A., Hay, J. G., Brody, S. L., Jaffe, H. A., Eissa, N. T., and Danel, C. (1994). Administration of an aden ovirus containing the human CFTR cDNA to the respiratory tract of individuals with cystic fibrosis. Nat. Genet. 8, 4 2 - 5 1 . 16. Knowles, M. R., Hohneker, K. W., Zhou, Z., Olsen, J. C , Noah, T. L., Hu, P. C , Leigh, M. W., Engelhardt, J. F., Edwards, L. J., Jones, K. R., et al. (1995). A controlled study of adenoviral-vector-mediated gene transfer in the nasal epithelium of patients with cystic fibrosis. N. Engl. J. Med. 333, 823-831. 17. Caplen, N. J., Kinrade, E., Sorgi, F., Gao, X., Gruenert, D., Geddes, D., Coutelle, C , Huang, L., Alton, E. W., and Williamson, R. (1995). In vitro liposome-mediated DNA transfection of epithelial cell lines using the cationic liposome DC-Chol/DOPE. Gene Ther. 2, 603-613. 18. Gill, D. R., Southern, K. W., Mofford, K. A., Seddon, T., Huang, L., Sorgi, F., Thomson, A., MacVinish, L. J., Ratcliff, R., Bilton, D., Lane, D. J., Littlewood, J. M., Webb, A. K., Mid- dleton, P. G., Colledge, W. H., Cuthbert, A. W., Evans, M. J., Higgins, C. F., and Hyde, S. C. (1997). A placebo-controlled study of liposome-mediated gene transfer to the nasal epithelium of patients with cystic fibrosis. Gene Ther. 4, 199-209. 19. Johnson, L. G., Olsen, J. C , Sarkadi, B., Moore, K. L., Swanstrom, R., and Boucher, R. C. (1992). Efficiency of gene transfer for restoration of normal airway epithelial function in cystic fibrosis. Nat. Genet. 2, 21-25 . 20. Boucher, R. C. (1996). Current status of CF gene therapy. Trends Genet. 12, 81-84. 21. Teramoto, S., Johnson, L. G., Huang, W., Leigh, M. W., and Boucher, R. C. (1995). Effect of adenoviral vector infection on cell proliferation in cultured primary human airway epithelial cells. Hum. Gene Ther. 6, 1045-1053. 22. Dong, J. Y., Wang, D., Van Ginkel, F. W., Pascual, D. W., and Frizzell, R. A. (1996). Sys tematic analysis of repeated gene delivery into animal lungs with a recombinant adenovirus vector. Hum. Gene Ther. 7, 319-331. 23. Ginsberg, H. S., Lundholm-Beauchamp, U., Horswood, R. L., Pernis, B., Wold, W. S., Chanock, R. M., and Prince, G. A. (1989). Role of early region 3 (E3) in pathogenesis of adenovirus disease. Proc. Natl. Acad. Sci. USA 86, 3823-3827. 24. Ginsberg, H. S., and Prince, G. A. (1994). The molecular basis of adenovirus pathogenesis. Infect. Agents Dis. 3, 1-8. 25. Kaplan, J. M., St George, J. A., Pennington, S. E., Keyes, L. D., Johnson, R. P., Wadsworth, S. C , and Smith, A. E. (1996). Humoral and cellular immune responses of nonhuman primates to long-term repeated lung exposure to Ad2/CFTR-2. Gene Ther. 3, 117-127. 26. Look, D. C , and Brody, S. L. (1999). Engineering viral vectors to subvert the airway defense response. Am.]. Respir. CellMol. Biol. 20, 1103-1106. 27. St. George, J. A., Pennington, S. E., Kaplan, J. M., Peterson, P. A., Kleine, L. J., Smith, A. E., and Wadsworth, S. C. (1996). Biological response of nonhuman primates to long-term repeated lung exposure to Ad2/CFTR-2. Gene Ther. 3, 103-116. 5 8 8 Raymond John Pickles 28. Yang, Y., Nunes, F. A,, Berencsi, K., Gonczol, E., Engelhardt, J. F., and Wilson, J. M. (1994). Inactivation of E2a in recombinant adenoviruses improves the prospect for gene therapy in cystic fibrosis. Nat. Genet. 7, 362-369. 29. Yei, S., Mittereder, N., Wert, S., Whitsett, J. A., Wilmott, R. W., and Trapneli, B. C. (1994). In vivo evaluation of the safety of adenovirus-mediated transfer of the human cystic fibrosis transmembrane conductance regulator cDNA to the lung. Hum. Gene Ther. 5, 731-744. 30. Jeffery, P. (1990). Form and function of airv^ay epithelium. In "Epithelia: Advances in Cell Physiology and Cell Culture" (C. J. Jones, Ed.), pp. 195-220. Kluw^er Academic, London. 31. Harkema, J., Mariassy, A., St. George, J., Hyde, D. M., and Plopper, C. G. (1994). Epithelial cells of the conducting airways: A species comparison. In "The Airv^ay Epithelium" (S. G. Farmer and D. W. P. Hay, Eds.), Vol. 55, pp. 3-39. Dekker, New York. 32. Mercer, R. R., Russell, M. L., Roggli, V. L., and Crapo,J. D. (1994). Cell number and distribution in human and rat airways. Am. ]. Respir. Cell Mol. Biol. 10, 613-624. 33. Randell, S. H. (1992). Progenitor-progeny relationships in airway epithelium. Chest 101, 11S-16S. 34. Leigh, M. W., Kylander, J. E., Yankaskas, J. R., and Boucher, R. C. (1995). Cell prolifera tion in bronchial epithelium and submucosal glands of cystic fibrosis patients. Am. ]. Respir. Cell Mol. Biol. 12,605-612. 35. Matsui, H., Randell, S. H., Peretti, S. W., Davis, C. W., and Boucher, R. C. (1998). Coordi nated clearance of pericifiary liquid and mucus from airway surfaces. / . Clin. Invest. 102, 1125-1131. 36. Matsui, H., Grubb, B. R., Tarran, R., Randell, S. H., Gatzy, J. T., Davis, C. W., and Boucher, R. C. (1998). Evidence for periciliary liquid layer depletion, not abnormal ion composition, in the pathogenesis of cystic fibrosis airways disease. Cell 95, 1005-1015. 37. Cotton, C. U., Stutts, M. J., Knowles, M. R., Gatzy, J. T., and Boucher, R. C. (1987). Abnor mal apical cell membrane in cystic fibrosis respiratory epithelium. An in vitro electrophysio logic analysis./. Clin. Invest. 79, 80-85. 38. Engelhardt, J. F., Yankaskas, J. R., Ernst, S. A., Yang, Y., Marino, C. R., Boucher, R. C , Cohn, J. A., and Wilson, J. M. (1992). Submucosal glands are the predominant site of CFTR expression in the human bronchus. Nat. Genet. 2, 240-248. 39. Grubb, B., and Boucher, R. C. (1999). Pathophysiology of Gene-targeted mouse models for cystic fibrosis. Physiol. Rev. 79, S193-S214. 40. Clarke, L. L., Grubb, B. R., Yankaskas, J. R., Cotton, C. U., McKenzie, A., and Boucher, R. C. (1994). Relationship of a non-cystic fibrosis transmembrane conductance regulator- mediated chloride conductance to organ-level disease in Cftr(-/-) mice. Proc. Natl. Acad. Sci. USA 91, 479-483. 41. Grubb, B. R., Paradiso, A. M., and Boucher, R. C. (1994). Anomalies in ion transport in CF mouse tracheal epithelium. Am. J. Physiol. 267, C293-C300. 42. Grubb, B. R., Vick, R. N., and Boucher, R. C. (1994). Hyperabsorption of Na+ and raised Ca(2+)-mediated CI- secretion in nasal epithelia of CF mice. Am. } . Physiol. 266, C1478-C1483. 43. Grubb, B. R., Pickles, R. J., Ye, H., Yankaskas, J. R., Vick, R. N., Engelhardt, J. F., Wil son, J. M., Johnson, L. G., and Boucher, R. C. (1994). Inefficient gene transfer by adenovirus vector to cystic fibrosis airway epithelia of mice and humans. Nature 371, 802-806. 44. Mittereder, N., Yei, S., Bachurski, C , Cuppoletti, J., Whitsett, J. A., Tolstoshev, P., and Trapneli, B. C. (1994). Evaluation of the efficacy and safety of in vitro, adenovirus-mediated transfer of the human cystic fibrosis transmembrane conductance regulator cDNA. Hum. Gene Ther. 5, 717-729. 45. Engelhardt, J. F., Yang, Y., Stratford-Perricaudet, L. D., Allen, E. D., Kozarsky, K., Perri- caudet, M., Yankaskas, J. R., and Wilson, J. M. (1993). Direct gene transfer of human CFTR into human bronchial epithelia of xenografts with El-deleted adenoviruses. Nat. Genet. 4, 27-34. 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 8 9 46. Jiang, C , Akita, G. Y., Colledge, W. H., Ratcliff, R. A., Evans, M. J., Hehir, K. M., St George, J. A., Wadsworth, S. C., and Cheng, S. H. (1997). Increased contact time improves adenovirus-mediated CFTR gene transfer to nasal epithelium of CF mice. Hum. GeneTher.S,671-6S0. 47. Zabner, J., Zeiher, B. G., Friedman, E., and Welsh, M. J. (1996). Adenovirus-mediated gene transfer to ciliated airway epithelia requires prolonged incubation time. / . Virol. 70, 6994-7003. 48. Mastrangeli, A., Danel, C., Rosenfeld, M. A., Stratford-Perricaudet, L., Perricaudet, M., Pavirani, A., Lecocq, J. P., and Crystal, R. G. (1993). Diversity of airway epithelial cell targets for in vivo recombinant adenovirus-mediated gene transfer. / . Clin. Invest. 91, 225-234. 49. Hansen, S. H., Sandvig, K., and van Deurs, B. (1992). Internalization efficiency of the transferrin receptor. Exp. Cell Res. 199, 19-28. 50. St. George, J., Sacks, C. R., Lukason, M. J., Nichols, M., Peterson, P. A., Vaccaro, C , Bai ley, S., Johnson, J., Pratt, P., and Wadsworth, S. C. (1995). Efficacy of adenoviral vectors in airway epithelium. Pediatr. Pulmonol. (Suppl.) 12, 151. 51. Pickles, R. J., Barker, P. M., Ye, H., and Boucher, R. C. (1996). Efficient adenovirus- mediated gene transfer to basal but not columnar cells of cartilaginous airway epithelia. Hum. Gene Ther. 7, 921-931. 52. Dupuit, F., Zahm, J. M., Pierrot, D., Brezillon, S.,
Bonnet, N., Imler, J. L., Pavirani, A., and Puchelle, E. (1995). Regenerating cells in human airway surface epithelium represent preferential targets for recombinant adenovirus. Hum. Gene Ther. 6, 1185-1193. 53. Bergelson, J. M., Cunningham, J. A., Droguett, G., Kurt-Jones, E. A., Krithivas, A., Hong, J. S., Horwitz, M. S,, Crowell, R. L., and Finberg, R. W. (1997). Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science 275, 1320-1323. 54. Tomko, R. P., Xu, R., and Philipson, L. (1997). HCAR and MCAR: The human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses. Proc. Natl. Acad. Sci. USA 94, 3352-3356. 55. Wickham, T. J., Mathias, P., Cheresh, D. A., and Nemerow, G. R. (1993). Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but not virus attachment. Cell 73, 309-319. 56. Pickles, R. J., McCarty, D., Matsui, H., Hart, P. J., Randell, S. H., and Boucher, R. C. (1998). Limited entry of adenovirus vectors into well-differentiated airway epithelium is responsible for inefficient gene transfer. / . Virol. 72, 6014-6023. 57. Zabner, J., Freimuth, P., Puga, A., Fabrega, A., and Welsh, M. J. (1997). Lack of high affinity fiber receptor activity explains the resistance of ciliated airway epithelia to adenovirus infection./. Clin. Invest. 100, 1144-1149. 58. Matsui, H., Davis, C. W., Tarran, R., and Boucher, R. C. (2000). Osmotic water perme abilities of cultured, well-differentiated normal and cystic fibrosis airway epithelia. / . Clin. Invest. 105, 1419-1427. 59. Walters, R. W., Yi, S., Keshavjee, S., Brown, K. E., Welsh, M. J., Chiorini, J. A., and Zab ner, J. (2001). Binding of Adeno-associated virus type 5 to 2,3-linked sialic acid is required for gene transfer. / . Biol. Chem. 21 , 21. 60. Jepsen, M., Graham, S., Karp, P. H., and Zabner, J. (2000). Effect of topical nasal pharma ceuticals on sodium and chloride transport by human airway epithelia. Am. J. Rhinol. 14, 405-409. 61. Zabner, J., Seller, M. P., Launspach, J. L., Karp, P. H., Kearney, W. R., Look, D. C , Smith, J. J., and Welsh, M. J. (2000). The osmolyte xylitol reduces the salt concentration of airway surface liquid and may enhance bacterial killing. Proc. Natl. Acad. Sci. USA 97, 11,614-11,619. 5 9 0 Raymond John Pickles 62. Wang, G., Zabner, J., Deering, C , Launspach, J., Shao, J., Bodner, M., Jolly, D. J., David son, B. L., and McCray, P. B., Jr. (2000). Increasing epithelial junction permeability enhances gene transfer to airway epithelia in vivo. Am. J. Respir. Cell Mol. Biol. 22, 129-138. 63. Wang, G., Davidson, B. L., Melchert, P., Slepushkin, V. A., van Es, H. H., Bodner, M., Jolly, D. J., and McCray, P. B., Jr. (1998). Influence of cell polarity on retrovirus-mediated gene transfer to differentiated human airw^ay epithelia. / . Virol. 72, 9818-9826. 64. Walters, R. W., Grunst, T., Bergelson, J. M., Finberg, R. W., Welsh, M. J., and Zabner, J. (1999). Basolateral localization of fiber receptors limits adenovirus infection from the apical surface of airway epithelia./. Biol. Chem. 274, 10,219-10,226. 65. Goldman, M. J., and Wilson, J. M. (1995). Expression of alpha v beta 5 integrin is necessary for efficient adenovirus-mediated gene transfer in the human airway./. Virol. 69,5951-595S. 66. Hidaka, C., Milano, E., Leopold, P. L., Bergelson, J. M., Hackett, N. R., Finberg, R. W., Wickham, T. J., Kovesdi, I., Roelvink, P., and Crystal, R. G. (1999). CAR-dependent and CAR-independent pathways of adenovirus vector-mediated gene transfer and expression in human fibroblasts./. Clin. Invest. 103, 579-587. 67. Freimuth, P. (1996). A human cell line selected for resistance to adenovirus infection has reduced levels of the virus receptor. / . Virol. 70, 4081-4085. 68. Griffiths, M., Huang, X. Z., Wu, J. F., Driscoll, R., and Sheppard, D. (1997). Inactivation of the beta5 integrin subunit gene does not prevent expression of adenovirus genes in mouse airway epithelium. Respir. Crit. Care Med. 155, A549. 69. Fasbender, A., Zabner, J., Chillon, M., Moninger, T. O., Puga, A. P., Davidson, B. L., and Welsh, M. J. (1997). Complexes of adenovirus with polycationic polymers and cationic lipids increase the efficiency of gene transfer in vitro and in vivo. / . Biol. Chem. 272, 6479-6489. 70. Wickham, T. J., Roelvink, P. W., Brough, D. E., and Kovesdi, I. (1996). Adenovirus targeted to heparan-containing receptors increases its gene delivery efficiency to multiple cell types. Nat. Biotechnol. 14, 1570-1573. 71. Pickles, R., Fahrner, J. Petrella, J., Boucher, R., and Bergelson, J. (2000). Retargeting the coxsackievirus and adenovirus receptor to the apical surface of polarised epithelial cells reveals the glycocalyx as a barrier to adenovirus mediated gene transfer. / . Virol. 74, 6050-6057. 72. Rambourg, A., Neutra, M., and Leblond, C. P. (1966). Presence of a "cell coat" rich in carbohydrate at the surface of cells in the rat. Anat. Rec. 154, 4 1 - 7 1 . 73. Bennett, H. S. (1963). Morphological aspects of extracellular polysaccharides./. Histochem. Cytochem. 11, 23. 74. Bernacki, S. H., Nelson, A. L., Abdullah, L., Sheehan, J. K., Harris, A., Davis, C. W., and Randell, S. H. (1999). Mucin gene expression during differentiation of human airway epithelia in vitro. Am. J. Respir. Cell Mol. Biol. 20, 595-604. 75. Buisine, M. P., Devisme, L., Copin, M. C , Durand-Reville, M., Gosselin, B., Aubert, J. P., and Porchet, N. (1999). Developmental mucin gene expression in the human respiratory tract. Am. J. Respir. Cell Mol. Biol. 20, 209-218. 76. Chambers, J. A., Hollingsworth, M. A., Trezise, A. E., and Harris, A. (1994). Developmental expression of mucin genes MUCl and MUC2. / . Cell Sci. 107(2), 413-424. 77. Braga, V. M., Pemberton, L. F., Duhig, T., and Gendler, S. J. (1992). Spatial and temporal expression of an epithelial mucin, Muc-1, during mouse development. Development 115, 427-437. 78. Pemberton, L., Taylor-Papadimitriou, J., and Gendler, S. J. (1992). Antibodies to the cyto plasmic domain of the MUCl mucin show conservation throughout mammals. Biochem. Biophys. Res. Commun. 185, 167-175. 79. Porchet, N., Nguyen, V. C , Dufosse, J., Audie, J. P., Guyonnet-Duperat, V., Gross, M. S., Denis, C , Degand, P., Bernheim, A., and Aubert, J. P. (1991). Molecular cloning and chro mosomal localization of a novel human tracheo-bronchial mucin cDNA containing tandemly repeated sequences of 48 base pairs. Biochem. Biophys. Res. Commun. 175, 414-422. 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 9 1 80. McNeer, R. R., Huang, D., Fregien, N. L., and Carraway, K. L. (1998). Sialomucin complex in the rat respiratory tract: A model for its role in epithelial protection. Biochem. J. 330(2), 737-744. 81. Sheng, Z., Wu, K., Carraway, K. L., and Fregien, N. (1992). Molecular cloning of the transmembrane component of the 13762 mammary adenocarcinoma sialomucin complex. A new member of the epidermal growth factor superfamily./. Biol. Chem. 267,16,341-16,346. 82. Wu, K., Fregien, N., and Carraway, K. L. (1994). Molecular cloning and sequencing of the mucin subunit of a heterodimeric, bifunctional cell surface glycoprotein complex of ascites rat mammary adenocarcinoma cells./. Biol. Chem. 269, 11,950-11,955. 83. Arcasoy, S. M., Latoche, J., Gondor, M., Watkins, S. C , Henderson, R. A., Hughey, R., Finn, O. J., and Pilewski, J. M. (1997). MUCl and other sialoglycoconjugates inhibit adenovirus-mediated gene transfer to epithelial cells. Am. J. Respir. Cell Mol. Biol. 17y 422-435. 84. Arcasoy, S. M., Latoche, J. D., Gondor, M., Pitt, B. R., and Pilewski, J. M. (1997). Polyca- tions increase the efficiency of adenovirus-mediated gene transfer to epithelial and endothelial cells in vitro. Gene Ther. 4, 32-38. 85. Worgall, S., Leopold, P. L., Wolff, G., Ferris, B., Van Roijen, N., and Crystal, R. G. (1997). Role of alveolar macrophages in rapid elimination of adenovirus vectors administered to the epithelial surface of the respiratory tract. Hum. Gene Ther. 8, 1675-1684. 86. Parsons, D. W., Grubb, B. R., Johnson, L. G., and Boucher, R. C. (1998). Enhanced in vivo airway gene transfer via transient modification of host barrier properties with a surface-active agent. Hum. Gene Ther. 9, 2661-2672. 87. Otake, K., Ennist, D. L., Harrod, K., and Trapnell, B. C. (1998). Nonspecific inflammation inhibits adenovirus-mediated pulmonary gene transfer and expression independent of specific acquired immune responses. Hum. Gene Ther. 9, 2207-2222. 88. Van Ginkel, F. W., Liu, C , Simecka, J. W., Dong, J. Y., Greenway, T., Frizzell, R. A., Kiyono, H., McGhee, J. R., and Pascual, D. W. (1995). Intratracheal gene delivery with adenoviral vector induces elevated systemic IgG and mucosal IgA antibodies to adenovirus and beta-galactosidase. Hum. Gene Ther. 6, 895-903. 89. Simon, R. H., Engelhardt, J. F., Yang, Y., Zepeda, M., Weber-Pendleton, S., Grossman, M., and Wilson, J. M. (1993). Adenovirus-mediated transfer of the CFTR gene to lung of nonhuman primates: Toxicity study. Hum. Gene Ther. 4, 771-780. 90. Yei, S., Mittereder, N., Tang, K., O'Sullivan, C , and Trapnell, B. C. (1994). Adenovirus- mediated gene transfer for cystic fibrosis: Quantitative evaluation of repeated in vivo vector administration to the lung. Gene Ther. 1, 192-200. 91. Piedimonte, G., Pickles, R. J., Lehmann, J. R., McCarty, D., Costa, D. L., and Boucher, R. C. (1997). Replication-deficient adenoviral vector for gene transfer potentiates airway neurogenic inflammation. Am. J. Respir. Cell Mol. Biol. 16, 250-258. 92. Goldman, M. J., Litzky, L. A., Engelhardt, J. F., and Wilson, J. M. (1995). Transfer of the CFTR gene to the lung of nonhuman primates with El-deleted, E2a-defective recombinant adenoviruses: a preclinical toxicology study. Hum. Gene Ther. 6, 839-851. 93. Engelhardt, J. F., Litzky, L., and Wilson, J. M. (1994). Prolonged transgene expression in cotton rat lung with recombinant adenoviruses defective in E2a. Hum. Gene Ther. 5, 1217-1229. 94. Lieber, A., He, C. Y., Kirillova, I., and Kay, M. A. (1996). Recombinant adenoviruses with large deletions generated by Cre-mediated excision exhibit different biological properties compared with first- generation vectors in vitro and in vivo. / . Virol. 70, 8944-8960. 95. Morsy, M. A., Gu, M., Motzel, S., Zhao, J., Lin, J., Su, Q., Allen, H., Franlin, L., Parks, R. J., Graham, F.L., Kochanek, S., Bett, A. J., and Caskey, C. T. (1998). An adenoviral vector deleted for all viral coding sequences results in enhanced safety and extended expression of a leptin transgene. Proc. Natl. Acad. Sci. USA 95, 7866-7871. 5 9 2 Raymond John Pickles 96. Mack, C. A., Song, W. R., Carpenter, H., Wickham, T. J., Kovesdi, I., Harvey, B. G., Magovern, C. J., Isom, O. W., Rosengart, T., Falck-Pedersen, E., Hackett, N. R., Crystal, R. G., and Mastrangeli, A. (1997). Circumvention of anti-adenovirus neutralizing immunity by administration of an adenoviral vector of an alternate serotype. Hum. Gene Ther. 8, 99-109. 97. Mastrangeli, A., Harvey, B. G., Yao, J., Wolff, G., Kovesdi, I., Crystal, R. G., and Falck- Pedersen, E. (1996). "Sero-switch" adenovirus-mediated in vivo gene transfer: Circum vention of anti-adenovirus humoral immune defenses against repeat adenovirus vector administration by changing the adenovirus serotype. Hum. Gene Ther. 7, 79-87. 98. Scaria, A., St. George, J. A., Gregory, R. J., Noelle, R. J., Wadsworth, S. C , Smith, A. E., and Kaplan, J. M. (1997). Antibody to CD40 ligand inhibits both humoral and cellular immune responses to adenoviral vectors and facilitates repeated administration to mouse airway. Gene Ther. 4, 611-617. 99. Griesenbach, U., Chonn, A., Cassady, R., Hannam, V., Ackerley, C , Post, M., Tansv^ell, A. K., Olek, K., O'Brodovich, H., and Tsui, L. C. (1998). Comparison between intratracheal and intravenous administration of liposome-DNA complexes for cystic fibrosis lung gene therapy. Gene Ther. 5, 181-188. 100. Liu, P., Qi, H., Huang, L., and Liu, D. (1997). Factors controlling the efficiency of cationic lipid-mediated transfection in vivo via intravenous administration. Gene Ther. 4, 517-523. 101. Lemarchand, P., Jaffe, H. A., Danel, C , Cid, M. C , Kleinman, H. K., Stratford-Perricaudet, L. D., Perricaudet, M., Pavirani, A., Lecocq, J. P., and Crystal, R. G. (1992). Adenovirus- mediated transfer of a recombinant human alpha 1-antitrypsin cDNA to human endothelial cells. Proc. Natl. Acad. Sci. USA 89, 6482-6486. 102. Lemarchand, P., Jones, M., Danel, C , Yamada, L, Mastrangeli, A., and Crystal, R. G. (1994). In vivo adenovirus-mediated gene transfer to lungs via pulmonary artery. / . Appl. Physiol. 76, 2840-2845. 103. Coyne, C. B., Kelly, M. M., Boucher, R. C , and Johnson, L. G. (2000). Enhanced epithehal gene transfer by modulation of tight junctions with sodium caprate. Am. J. Respir. Cell Mol. Biol. 23, 602-609. 104. Chu, Q.,
St. George, J. A., Lukason, M., Cheng, S. H., Scheule, R. K., and Eastman, S. J. (2001). Egta enhancement of adenovirus-mediated gene transfer to mouse tracheal epithelium in vivo. Hum. Gene Ther. 12, 455-467. 105. Wang, G., Zabner, J., Deering, C , Launspach, J., Shao, J., Bodner, M., Jolly, D. J., David son, B. L., and McCray, P. B., Jr. (2000). Increasing epithelial junction permeability enhances gene transfer to airway epithelia In vivo. Am. J. Respir. Cell Mol. Biol. 22, 129-138. 106. Watkins, S. J., Mesyanzhinov, V. V., Kurochkina, L. P., and Hawkins, R. E. (1997). The "adenobody" approach to viral targeting: Specific and enhanced adenoviral gene delivery. Gene Ther. 4, 1004-1012. 107. Wickham, T. J., Carrion, M. E., and Kovesdi, I. (1995). Targeting of adenovirus penton base to new receptors through replacement of its RGD motif with other receptor-specific peptide motifs. Gene Ther. 2, 750-756. 108. Wickham, T. J., Lee, G. M., Titus, J. A., Sconocchia, G., Bakacs, T., Kovesdi, I., and Segal, D. M. (1997). Targeted adenovirus-mediated gene delivery to T cells via CD3. / . Virol. 71, 7663-7669. 109. Hoganson, D. K., Sosnowski, B. A., Pierce, G. F., and Doukas, J. (2001). Uptake of adenovi ral vectors via fibroblast growth factor receptors involves intracellular pathways that differ from the targeting ligand. Mol. Ther. 3, 105-112. 110. Kreda, S. M., Pickles, R. J., Lazarowski, E. R., and Boucher, R. C. (2000). G-protein- coupled receptors as targets for gene transfer vectors using natural small-molecule ligands. Nat. Biotechnol. 18, 635-640. 19. Utility of Ad Vectors in Animal Models II: Genetic Disease 5 9 3 111. Mason, S. J., Paradiso, A. M., and Boucher, R. C. (1991), Regulation of transepithelial ion transport and intracellular calcium by extracellular ATP in human normal and cystic fibrosis airway epithehum. Br. J. Pharmacol. 103, 1649-1656. 112. Drapkin, P. T., O'Riordan, C. R., Yi, S. M., Chiorini, J. A., Cardella, J., Zabner, J., and Welsh, M. J. (2000). Targeting the urokinase plasminogen activator receptor enhances gene transfer to human airway epithelia. / . Clin. Invest. 105, 589-596. 113. Ziady, A., K. R., F. T., and Davies, P. (1999). Serpin enzyme complex receptor targeted DNA complexes deliver genes to airway epithelia. Fediatr. Pulmonol. 19, 233. 114. Wickham, T. J., Segal, D. M., Roelvink, P. W., Carrion, M. E., Lizonova, A., Lee, G. M., and Kovesdi, I. (1996). Targeted adenovirus gene transfer to endothelial and smooth muscle cells by using bispecific antibodies. / . Virol. 70, 6831-6838. 115. Douglas, J. T., Rogers, B. E., Rosenfeld, M. E., Michael, S. I., Feng, M., and Curiel, D. T. (1996). Targeted gene delivery by tropism-modified adenoviral vectors. Nat. Biotechnol. 14, 1574-1578. 116. Pickles, R., Johnson, L. G., Olsen, J. C., Gerard, R., Segal, D., and Boucher, R. C. (1999). Correction of the CF bioelectric defect in human CF well-differentiated airway epithelial cells by retargeting adenoviral vectors to luminal P2Y2 purinoceptors. Fediatr. Fulmonol. 19, 222. 117. Pickles, R., Kreda, S., Olsen, J., Johnson, L., Gerard, R., Segal, D., and Boucher, R. (1998). High efficiency gene transfer to polarised epithelial cells by retargeting adenoviral vectors to P2Y2 purinoceptors with bispecific antibodies. Fediatr. Fulmonol. 17, 261. 118. Romanczuk, H., Galer, C , Zabner, J., Barsomian, G., Wadsworth, S., and O'Riordan, C. (1999). Modification of an adenoviral vector with biologically selected peptides: A novel strategy for gene delivery to cells of choice. Hum. Gene Ther. 10, 2615-2626. 119. O'Riordan, C , Lachapelle, A., Delgado, C , Parkes, V., Wadsworth, S., Smith, A., and Fran cis, G. (1999). PEGylation of adenovirus with retention of infectivity and protection from neutralizing antibody in vitro and in vivo. Hum. Gene Ther. 10, 1349-1358. 120. Summerford, C , and Samulski, R. J. (1998). Membrane-associated heparan sulfate proteo glycan is a receptor for adeno-associated virus type 2 virions. / . Virol. 72, 1438-1445. 121. Krasnykh, V. N., Mikheeva, G. V., Douglas, J. T., and Curiel, D. T. (1996). Generation of recombinant adenovirus vectors with modified fibers for altering viral tropism. / . Virol. 70, 6839-6846. 122. Michael, S., Hong, J., Curiel, D., and Engler, J. (1995). Addition of a short peptide ligand to the adenovirus fibre protein. Gene Ther. 2, 660-668. 123. Krasnykh, V., Dmitriev, I., Mikheeva, G., Miller, C. R., Belousova, N., and Curiel, D. T. (1998). Characterization of an adenovirus vector containing a heterologous peptide epitope in the HI loop of the fiber knob. / . Virol. 72, 1844-1852. 124. Roelvink, P. W., Mi Lee, G., Einfeld, D. A., Kovesdi, L, and Wickham, T. J. (1999). Iden tification of a conserved receptor-binding site on the fiber proteins of CAR-recognizing adenoviridae. Science 286, 1568-1571. 125. Zabner, J., Chillon, M., Grunst, T., Moninger, T. O., Davidson, B. L., Gregory, R., and Armentano, D. (1999). A chimeric type 2 adenovirus vector with a type 17 fiber enhances gene transfer to human airway epithelia. / . Virol. 73, 8689-8695. 126. Havenga, M. J., Lemckert, A. A., Grimbergen, J. M., Vogels, R., Huisman, L. G., Vale- rio, D., Bout, A., and Quax, P. H. (2001). Improved adenovirus vectors for infection of cardiovascular tissues./. Virol. 75, 3335-3342. 127. Arnberg, N., Edlund, K., Kidd, A. H., and Wadell, G. (2000). Adenovirus type 37 uses sialic acid as a cellular receptor. / . Virol. 74, 42-48 . 128. Fasbender, A., Lee, J. H., Walters, R. W., Moninger, T. O., Zabner, J., and Welsh, M. J. (1998). Incorporation of adenovirus in calcium phosphate precipitates enhances gene transfer to airway epitheUa in vitro and in vivo. / . Clin. Invest. 102, 184-193. 5 9 4 Raymond John Pickles 129. Lee, J. H., Zabner, J., and Welsh, M. J. (1999). Delivery of an adenovirus vector in a calcium phosphate coprecipitate enhances the therapeutic index of gene transfer to airway epithelia. Hum. Gene Ther. 10, 603-613. 130. Weiss, D.J., Strandjord, T. P., Liggitt, D., and Clark,]. G. (1999). Perflubron enhances adenovirus-mediated gene expression in lungs of transgenic mice with chronic alveolar filling. Hum. Gene Ther. 10, 2287-2293. 131. Weiss, D.J., Strandjord, T. P., Jackson, J. C , Clark, J. G., and Liggitt, D. (1999). Perflu orochemical liquid-enhanced adenoviral vector distribution and expression in lungs of spontaneously breathing rodents. Exp. Lung Res. 25, 317-333. 132. Weiss, D. J., Bonneau, L., Allen,]. M., Miller, A. D., and Halbert, C. L. (2000). Perfluo rochemical liquid enhances adeno-associated virus-mediated transgene expression in lungs. Mol. Ther. 2, 624-630. 133. Kochanek, S., Clemens, P. R., Mitani, K., Chen, H. H., Chan, S., and Caskey, C. T. (1996). A new adenoviral vector: Replacement of all viral coding sequences with 28 kb of DNA independently expressing both full-length dystrophin and beta-galactosidase. Proc. Natl. Acad. Sci. VSA 93, 5731-5736. 134. Mitani, K., Graham, F. L., Caskey, C. T., and Kochanek, S. (1995). Rescue, propagation, and partial purification of a helper virus- dependent adenovirus vector. Troc. Natl. Acad. Sci. USA 92, 3854-3858. 135. Clemens, P. R., Kochanek, S., Sunada, Y., Chan, S., Chen, H. H., Campbell, K. P., and Caskey, C. T. (1996). In vivo muscle gene transfer of full-length dystrophin with an aden oviral vector that lacks all viral genes. Gene Ther. 3, 965-972. 136. Bruder, J. T., Jie, T., McVey, D. L., and Kovesdi, L (1997). Expression of gpl9 K increases the persistence of transgene expression from an adenovirus vector in the mouse lung and liver./. Virol. 71, 7623-7628. 137. Wilson, C. B., Embree, L. J., Schowalter, D., Albert, R., Aruffo, A., HoUenbaugh, D., Lins- ley. P., and Kay, M. A. (1998). Transient inhibition of CD28 and CD40 ligand interactions prolongs adenovirus-mediated transgene expression in the lung and faciUtates expression after secondary vector administration./. Virol. 72, 7542-7550. 138. Yang, Y., Su, Q., Grewal, L S., Schilz, R., Flavell, R. A., and Wilson, J. M. (1996). Transient subversion of CD40 ligand function diminishes immune responses to adenovirus vectors in mouse liver and lung tissues./. Virol. 70, 6370-6377. 139. Jooss, K., Yang, Y., and Wilson, J. M. (1996). Cyclophosphamide diminishes inflammation and prolongs transgene expression following delivery of adenoviral vectors to mouse liver and lung. Hum. Gene Ther. 7, 1555-1566. 140. Yang, Y., Greenough, K., and Wilson, J. M. (1996). Transient immune blockade prevents formation of neutralizing antibody to recombinant adenovirus and allows repeated gene transfer to mouse liver. Gene Ther. 3, 412-420. 141. Yang, Y., Trinchieri, G., and Wilson, J. M. (1995). Recombinant IL-12 prevents formation of blocking IgA antibodies to recombinant adenovirus and allows repeated gene therapy to mouse lung. Nat. Med. 1, 890-893. 142. Yonemitsu, Y., Kitson, C , Ferrari, S., Farley, R., Griesenbach, U., Judd, D., Steel, R., Scheid, P., Zhu, J., Jeffery, P. K., Kato, A., Hasan, M. K., Nagai, Y., Masaki, L, Fukumura, M., Hasegawa, M., Geddes, D. M., and Alton, E. W. (2000). Efficient gene transfer to airway epithelium using recombinant Sendai virus. Nat. Biotechnol. 18, 970-973. 143. Kobinger, G. P., Weiner, D. J., Yu, Q. C , and Wilson, J. M. (2001). Filovirus-pseudotyped lentiviral vector can efficiently and stably transduce airway epithelia in vivo. Nat. Biotechnol. 19,225-230. 144. Boucher, R. C. (1999). Status of gene therapy for cystic fibrosis lung disease./. Clin. Invest. 103,441-445. C H A P T E R Utility of Adenoviral Vectors in Animal Models of Human Disease III: Acquired Diseases Erik Lubberts University Medical Center St. Radboud Niimegen Center for Molecular Life Science Nijmegen, The Netherlands Jay K. Kolls^ Department of Medicine and Pediatrics Louisiana State University Health Sciences Center New Orleans, Louisiana I. Adenoviral Vectors for Infectious Disease Recombinant adenoviral vectors for infectious diseases can generally be categorized into three general approaches. The first is the use of a vector-based vaccine where the vector encodes for proteins to achieve an immune response. In fact, adenoviruses have been used in the U.S. military for vaccines [1]. The second approach is to use adenoviral vectors, which encode immunostimula- tory genes to achieve in vivo immunotherapy. Last, these vectors can be used to provide critical accessory molecules for T- or B-cell activation for patients that are deficient in these molecules or theoretically direct anti-infectious genes such as anti-bacterial peptides. These general paradigms hold true for most gene-therapy approaches with adenoviral-based vector systems regardless if the targets are infectious disease, an inherited immune deficiency sate, or cancer. In this chapter we focus on these paradigms in the context of specific disease enti ties that may be candidates for treatment with adenovirus-based vector systems. ^ Corresponding author. ADENOVIRAL VECTORS FOR GENE THERAPY 5 9 5 Copyright 2002, Elsevier Science (USA). All rights reserved. 5 9 6 Lubberts and Kolls A. Tuberculosis Mycobacterium tuberculosis the etiologic agent of tuberculosis (TB), is a facultative intracellular pathogen which remains the foremost cause of death from a single infectious agent among adults [2]. It has been estimated that approximately one-third of the world's population in 1990 (1.7 billion individuals) were infected with M. tuberculosis^ affecting mostly people living in developing countries, and that with the global control measures in place at that time, 30 million people were expected to die due to tuberculosis by the year 2000 [2]. The most effective vaccine against tuberculosis in man is the BCG vaccine, an attenuated substrain of Mycobacterium bovis^ which has been used for more than 50 years worldwide. However, this vaccine is very erratic in conferring protection, varying as much as 0 -80% in separate clinical trials [3]. In countries with a lower incidence of tuberculosis, such as the United States, the emergence of multidrug-resistant strains threatens control measures with anti-mycobacterial drugs. It is apparent that current immunotherapeutic and chemotherapeutic approaches for the control of tuberculosis need to be improved. After inhalation, the organism replicates within the lung macrophage. The protective response to infection with intracellular bacteria is cell-mediated [4]. Protective immunity in the mouse model of tuberculosis is mediated by T lymphocytes that secrete gamma interferon (IFNy), which activates infected macrophages to control intracellular bacilli in a manner believed to be similar to the protective response in man. Several subpopulations of T lymphocytes contribute to the protective response in the lungs of infected mice [5]. Most of this protection is conferred by a short-lived population of rapidly dividing, IFNy-secreting CD4+ T lymphocytes [6] which peak within 3 weeks of infec tion, a time which correlates with the control of further mycobacterial growth in the host [7]. The pivotal role of IFNy in protective immunity to M. tuberculosis was unequivocally demonstrated using IFNy knockout (KO) mice. The
single gene encoding IFNy was disrupted, and these mice were originally shown to: (a) be incapable of IFNy production, (b) poorly express class II MHC, (c) be deficient in the production of reactive oxygen and reactive nitrogen radicals, and (d) be very susceptible to M. bovis BCG [8]. IFNy KO mice succumbed to infection with M. tuberculosis fairly rapidly whether the virulent bacilli were delivered intravenously at moderate [9] to high doses [10] or via a low-dose aerosol [9]. There is also an absolute requirement for interleukin (IL)-12 in the protective response against TB. This has been demonstrated using IL-12p40 KO mice. These mice do not produce the heavy chain of the IL-12 heterodimer and therefore do not make the bioactive p70 form of IL-12, which results in a poor cell-mediated response to antigen [11]. Recently, it was shown that IL- 12p40 KO succumbed to an intravenous infection with M. tuberculosis within 50 days [12]. Whereas wild-type controls contained the infection and strongly 20. Utility of Ad Vectors in Animal Models ill: Acquired Diseases 597 expressed genes encoding IFNy, tumor necrosis factor (TNF), and inducible nitric oxide synthase (iNOS) in infected tissues, these KO mice produced no IFNy message and delayed TNF and iNOS message. As protective cytokines, which play a pivotal role in protection against tuberculosis, IFNy and IL-12 represent attractive targets for cytokine-based therapy approaches designed to enhance protective cell-mediated immu nity [13]. Recently, a replication-deficient adenoviral vector designed to deliver IFNy (AdIFN) vv̂ as delivered intratracheally into the lungs of BALB/c mice, v^hich w êre subsequently challenged, v^ith a sublethal aerosol of M. tubercu losis. Prior pharmacokinetic analyses of adenoviral-mediated expression of IFNy in BALB/c mice had indicated that transfected mice expressed increased IFNy in the lungs for as long as 21 days follov^ing delivery of the vector. Other mice w êre transfected with a control virus expressing lacZ (AdLacZ) shortly before the low-dose aerosol exposure to M. tuberculosis. AdIFN-treated mice initially contained the infection in the lungs much better than the control nontransfected mice or AdLacZ-treated mice (Fig. 1). The protective effect in the lungs paralleled the local production of IFNy by the vector and, thus, was relatively short-lived, such that the load of viable bacilli in AdIFNy-treated lungs reached levels similar to the controls by 30 days of infection. There was no protective effect on the control of mycobacterial dissemination or growth in other primary target organs. Similar AdIFNy-mediated control of bacterial growth in the lungs was not seen in mice, which already had established chronic M. tuberculosis infection. Based on these preclinical data, several clinical trial have been initiated for both multidrug-resistant M. tuberculosis and persistent mycobacteria avium CSU46 AdIFN AdLacZ p < 0.05 Figure 1 AdIFN reduces growth of Mycobacterium tuberculosis in the lung. Mice were pretreated with AdIFN, AdLacZ, or vehicle and then challenged with CSU 46, a clinical isolate of M. tuberculosis, and lung organism burden was quantified by quantitative organ culture serially after aerosol challenge (data provided by Dr. Elizabeth Rhoades and Dr. Ian Orme, Colorado State University). 5 9 8 Lubberts and Kolls complex (MAC) infection in non-HIV-infected hosts. Williams and colleagues, from our group, recently reported on a Phase I trial of aerosolized IFNy to patients with persistent MAC infection [14]. All patients tolerated the aerosol well and three of eight had sputum acid-fast bacilli (AFB) smears convert to negative. Condos and colleagues have recently reported on five patients in New York City with multidrug-resistant tuberculosis who received 500 \|JLg of IFNy aerosolized three times a week for 1 month [15]. Again the aerosol form of the drug was well-tolerated and all patients had sputum smears for AFB convert to negative and the time to positive culture increased (from 17 to 24 days, not significant), suggesting a reduction in organism burden. Moreover, patient weight increased or stabilized, and there were objective decreases in the size of cavitary lesions in all patients 2 months after treatment had ended. It is important to note that data to date suggest that IFN, whether in protein or vector form needs to be provided for a relatively long time to control M. tuberculosis growth. Thus it is possible that newer generations of adenoviral-based or other vector systems may achieve longer-term control of infection. B. Pneumonia Pneumonia and influenza infection remain the sixth leading cause of death in the United States [16]. Drug-resistant organisms are increasingly isolated from infected patients, presumably due to the broad use of antibiotics. As mentioned above, several biological response modifiers such as granulocyte colony stimulating factor (G-CSF) and IFNy have been investigated in patients as protein-based therapies. However, due to pharmacological advantages of adenovirus and other gene-based vector systems, gene therapy may provide an alternative approach for in vivo immunomodulation. Adenoviral-mediated gene transfer of the murine IFN gene (AdIFN) results in dose-dependent increases in IFN in bronchoalveolar lavage fluid (HALF) in both mice and rats [17]. Recombinant protein expression occurs up to 28 days in Sprague-Dawley rats and up to 21 days in Balb/c mice [17]. Expression of IFN has a biological effect for at least 14 days in the lung as class II MHC is significantly upregulated in lavaged alveolar macrophages over this time [17]. Moreover, although AdIFN does not result in spontaneous release of TNF in the lung, a subsequent challenge with intratracheal endotoxin results in a greater than fivefold increase in peak TNF levels in BALF in AdlFN- transduced animals compared to control animals (Fig. 2). This enhanced TNF response is associated with increased neutrophil recruitment [17] and increased clearance of Pseudomonas aeruginosa up to 14 days after gene transfer [17]. Although the high levels of both IFN and TNF in the BALF were quite high, these cytokines were confined to the lung and remained essentially undetectable in the plasma (data not shown). Thus, these compartmentalized 20. Utility of Ad Vectors in Animal Models III: Acquired Diseases 599 n PBS B 10(7)AdlFN • 10(8)AdlFN • 10(9)AdlFN n 10(9)AdCMVLuc p < 0.05 Figure 2 Dose-dependent increase of LPS-induced lung TNF production by AdIFN. Six- to 8-week-old BALB/c mice were pretreated with AdIFN, AdCMVLuc, or PBS 3 days prior to admin istration of intratracheal LPS. TNF was measure in bronchoalveolar lavage (BAL) fluid 3 h after LPS administration by ELISA and corrected for macrophage cell number in the BAL fluid. ND, none detected. effects may offer cytokine gene transfer and advantage over systemically delivered protein-based therapies. Alcohol abuse is a risk factor for bacterial pneumonia [18] as well as acute lung injury [19]. Alcohol intoxication increases the risk of aspiration and suppresses macrophage free-radical protection and bacterial killing [20, 21]. Moreover, alcohol can suppress the elaboration of alarm cytokines such as TNF [22, 23]. Alcohol-induced suppression of TNF production by macrophages can be reversed by IFN in vitro. To investigate whether IFN gene therapy could augment TNF and bacterial host defense in vivo., we administered AdIFN intratracheally to rats, followed 3 days later with an acutely intoxicating dose of ethanol {S.5 g/kg intraperitoneal). Thirty minutes later animals were chal lenged intratracheally with endotoxin (LPS) or live Klebsiella pneumoniae to measure LPS-induced TNF responses and lung neutrophil recruitment or bacterial clearance of K. pneumoniae., respectively. This dose of alcohol has previously been shown by our group to suppress LPS-induced lung macrophage production of TNF. AdIFN pretreatment prevented alcohol-induced TNF sup pression as well as lung neutrophil recruitment (Figs. 3A and 3B). Moreover, we observed a significant increase in lung bacterial clearance of K. pneumoniae (Fig. 3C) [24]. Standiford and colleagues have shown that adenoviral gene transfer of functional IL-12 [25] produces the p70 heterodimer of IL-12 in the lung lavage fluid in a dose-dependent fashion for up to 7 days [26]. Mice pretreated with this vector, then challenged with 3 x 10^ K. pneumoniae., had signif icantly improved survival, compared to AdCMVLacZ-treated or untreated 600 Lubberts and Kolls 45-1 "* 40- • • L P S 1 S 35- 1 J ETOH-LPS1 ^ on 2 30- 1 25- * p < 0.05 a 20- 1 15- 1—1 1 10- 0- AdIFN AdLUC AdIFN AdLUC * p < 0.001 I 1 600 E PBS c 500 o ETOH E 3 400 0c) a. 300 J) 200 X3 (0 100 * p < 0.05 '> AdIFN AdLUC Figure 3 Enhancement of pulmonary host defense in an acute model of ethanol (ETOH) intox ication. Male Sprague-Dawley rats were treated with 10^ pfu of AdIFN or AdLUC as a control. Three days later, rats were treated with intratracheal LPS or live K. pneumoniae. Animals receiving LPS were sacrificed 3 hours later to determine cell migration into or TNF concentration in the BAL fluid. Rats receiving K. pneumoniae were sacrificed immediately or 4 h after bacterial inoculation to determine bacterial clearance. (A) AdIFN reverses ETOH-induced suppression of lung neutrophil migration after LPS. (B) AdIFN enhances lung TNF release into BAL fluid after LPS in control and ETOH-treated animals. (C) AdIFN improves lung clearance of K. pneumoniae in a ETOH-treated rat model. 20. Utility of Ad Vectors in Animal Models ill: Acquired Diseases 6 0 1 controls [26]. The beneficial effect of IL-12 overexpression was mediated by both tumor necrosis factor alpha (TNFa) and IFNy, as survival in Ad5IL- 12-treated mice w âs attenuated by concomitant neutralization of endogenous TNFa or IFNy [26]. This same group demonstrated the feasibility of using TNFa, a critical proinflammatory cytokine in lung host defenses (27, 28), for in vivo immunomodulation of pulmonary host defense. To overexpress TNF compartmentally in the lung a recombinant adenovirus expressing TNF (AdmTNF) has been reported [29]. Concomitant bacterial challenge with X. pneumoniae and low-dose AdmTNF (10^ pfu) resulted in improved host defenses against the organism. However, a higher dose of vector (5 x 10^ pfu) was not beneficial in terms of bacterial clearance. Thus, understanding dose-response relationships in gene-based immunotherapies will be critical for this form of treatment to have an impact in clinical infections. Crystal and colleagues have used an adenoviral vector encoding CD40 ligand (AdCD40L) in a vaccine approach to protect against P. aeruginosa (PA) lung infection [30]. CD40L is expressed on activated T cells and allows dendritic cells (DCs) which are specialized antigen-presenting cells, to interact directly with either CD8+ cytotoxic T cells [31, 32] and B cells [33]. By transfecting DC, with AdCD40L, Kikuchi and colleagues demonstrated that gene-modified DCs pulsed with PA could stimulate naive B cells to produce anti- PA antibodies. Moreover, if these pulsed, gene-modified DCs were administered in vivo^ an in vivo anti-PA responses was achieved which protected the vaccinated mice against a subsequent challenge with PA [30]. To support the fact that B cells were critical to this response, passive transfer of either serum or B cells from vaccinated mice conferred protection to naive mice subsequently challenged with PA. C. Opportunistic Infections In addition to its known effects on upregulating macrophage function and innate host defenses, IFNy is also the prototypic THl cytokine that facilitates THO CD4+ T-cell differentiation into THl-expressing CD4+ T cells [34]. Moreover, IFN can also modulate the cytokine expression of CD 8+ T cells to a Tel phenotype [35, 36]. As IFN is produced by activated CD4+ T cells, a lack of IFN secretion could partly explain the pulmonary host defense defect associated with HIV infection. Among HIV-associated opportunistic infections, Pneumocystis carinii pneumonia remains a persistent complication of HIV infection. There is an inverse relationship between CD4+ T-cell count and acquisition of this infection. Furthermore, IFNy, in the form of recombinant protein given as an aerosol, has been shown to reduce the intensity of P. carinii infection in a mouse model [37]. Based on these data, our laboratory investigated whether adenoviral-mediated gene transfer of IFNy to the lung would have a therapeutic effect in a mouse model of P. carinii pneumonia. To 602 Lubberts a n d Kolls p < 0.05 * p < 0.05 A d L U C AdIFN Figure 4 IFN-mediated clearance of Pneumocystis carinii in CD4 T-cell depleted mice. (A) Pretreat- ment with AdIFN resulted in significant clearance of P. carinii by 28 weeks. (B) Specific modulation of CDS phenotype by AdIFN. Lung CDS cells from AdIFN-treated mice show a significant higher precursor frequency of IFN-producing clones, as measure by Elispot, than AdLUC controls. test this concept with gene deHvery, we used the AdIFN model,
which results in prolonged expression of IFN in the lungs of mice depleted of CD4+ T cells [38]. AdIFN-transduced or control (AdLuc) animals were challenged with 2 X 10^ P. carinii cysts and sacrificed at serial time points. There was similar growth of P. carinii in both AdIFN and control animals for the first 2 weeks of the infection. However, after this time point AdIFN-treated mice showed resolution of the infection over 4 - 6 weeks in spite of continued depletion of CD4+ T cells (Fig. 4A). AdIFN-treated mice recruited greater numbers of T cells, which were largely CD8^ [38]. There was also a significant increase in recruited natural killer (NK) cells in the AdIFN-treated mice [38]. AdIFN was ineffective in improving P. carinii infection in both scid mice (which have intact macrophages and NK cells) or in mice depleted of both CD4+ and CD8+ T cells, suggesting that CD8"^ T cells are required for the clearance effect imparted by AdIFN treatment. In further support of CD 8+ T cells having effector function is the fact that there is a greater precursor frequency of IFN- producing CD8+ T cell clones in AdIFN-treated mice as measured by Elispot (Fig. 4B). Understanding effector function of CD8+ T cells in the context of 20. Utility of Ad Vectors in Animal Models III: Acquired Diseases 6 0 3 P. carinii infection may have a significant impact in future therapies designed to support HIV-infected individuals against opportunistic infections. D. Viral Hepatitis Both hepatitis B and hepatitis C are important causes of chronic hepatitis and hepatitis B has been linked to hepatocellular cancer. Hepatitis C virus (HCV) is a positive-strand RNA virus and is the major infectious agent responsible for causing chronic hepatitis. Presently, there is no vaccine for HCV infection. There have been recent advances in drug therapy for this disease using a combination of Ribavirin v^ith IFNa [39]; hov\^ever, there is still need for improved sustained therapy. Lieber and colleagues have demonstrated that adenoviral-mediated gene transfer of hammerhead ribozymes directed against a conserved region of the plus strand and minus strand of the HCV genome v^ere efficient at reducing or eliminating the respective plus- or minus-strand HCV RNAs expressed in cultured cells and from primary human hepatocytes obtained from chronic HCV-infected patients. Another therapeutic approach has been to locally upregulate innate anti viral immunity. Tov^ard this end Aurisicchio and colleagues demonstrated that adenoviral-mediated gene transfer of the IFNa2 under the control of a liver- specific promoter protected mice from a challenge w îth mouse hepatitis virus type 3 [40]. Lastly, another approach has been to construct dominant negative core mutants of hepatitis B and when these are expressed in hepatocytes cell lines in the context of a recombinant adenoviral vector, these molecules w êre capable of significantly suppressing viral replication [41]. II. Chronic Inflammatory Diseases A. Inflammatory Bowel Disease The gut has been proposed as a target for gene delivery for a variety of diseases including both metabolic diseases and primary diseases affect ing the intestine, including the inflammatory bowel diseases, Chron's disease and ulcerative colitis [42, 43]. Toward this end Hogaboam and colleagues have shown that intraperitoneal delivery of adenovirus encoding interleukin-4 (AdIL-4), a prototypic TH2 cytokine, attenuates colitis induced by trinitroben- zene sulfonic acid (TNB) [44]. TNB-induced colitis is associated with an acute phase followed by an immunologically mediated phase, which is thought to be hapten-induced [45]. The attenuation as a result of AdIL-4 in colitis was associated with a reduction in colonic IFN levels and less induction of inducible nitric oxide synthase [44]. The same group has shown similar data for another TH2 cytokine, interleukin-10 in a similar model of colitis [46]. 6 0 4 Lubberts and Kolls Adenovirus IL-10 treatment was again done by the intraperitoneal route and associated with a significant reduction in colonic myeloperoxidase activity and leukotriene levels, both markers of acute inflammation. What remains unclear from these studies is whether T-cell activation is modified and whether there is protection against a second bout of colitis. Last, the intraperitoneal approach is essentially a systemic form of therapy since IL-4 and IL-10 can be detected in the serum of these mice. Since the gut can be transduced directly with adenovirus vectors, this raises the possibility that local administration of vectors to inflamed intestine could be used to compartmentally upregulate an immunomodulatory gene that would prevent or attenuate existing colitis. Toward this end, Wirtz and colleagues have investigated adenovirus- mediated gene transfer to the inflamed colon using intrarectal administration of Ad5-based vectors. These investigators observed significant gene transfer to colonic epithelium, whereas no colonic gene transfer was observed when the vector was given systemically (intravenous or intraperitoneally). Moreover, gene transfer was enhanced in the setting of TNB-induced inflammation. Last, the investigators investigated an Ad5-based vector with a lysine repeat engineered in the fiber gene, the protein responsible for initial interactions with the Coxsackie-adenovirus receptor. With this genetically modified vector, the investigators observed enhanced gene transfer to cells in the lamina propria and spleen, suggesting that antigen-specific T cells could be modified with this vector approach. B. Arthritis Like inflammatory bowel disease, rheumatoid arthritis (RA) is thought to be dominated by THl-like inflammation (Fig. 5) [47, 48]. Among chronic inflammatory diseases, more has been published on gene therapy for arthritis than any other disease. This is likely due to the fact that (1) it is a common disease entity, (2) current treatment, although effective in many cases, can be improved upon, (3) there is a readily accessible site for gene transfer, (4) there are relevant clinical models of the disease, particularly RA, and (5) gene transfer can be accomplished locally to the synovial lining cells using adenovirus-based vectors [49]. The pathogenesis of RA is complex but data to date suggest that there exist alloreactive T cells that secrete TH-1-like cytokines such as TNFa, TNFp, IL-2, and IFN, which drives inflammation. Accessory cells can also secrete TNF, IL-ip, and IL-18, which are also proinflammatory and can drive THl inflammation. This leads to an inflammatory synovial pannus, which mediates destruction of cartilage and joint erosion, which results in loss of joint function over time. A novel T-cell-derived cytokine, IL-17, has also been implicated in the pathogenesis of RA [50]. Since TH-1 inflammation can be downregulated by TH-2 cytokines, such as IL-4 or IL-10, these cytokines have been investigated as candidate genes 20 . Utility of Ad Vectors in Animal Models III: Acquired Diseases 605 Rheumatoid factors Immune Complexes, Bacterial products, IL-l,TNFa, etc. synoviocytes chondrocytes Collagenase and other proteases Figure 5 Schematic diagram of the pathogenesis of RA. to modify RA inflammation. Woods and colleagues investigated adenoviral- mediated gene transfer of the human IL-4 gene into synovial explants from RA patients and demonstrated a significant reduction in IL-ip, TNFa, and IL-8 elaboration in the explant cultures treated w îth AdIL-4 [51]. In follov^-up to this work, the same group demonstrated in vivo efficacy of intraarticular AdIL-4 treatment in adjuvant-induced arthritis in a rat model [52]. Of note v^as that AdIL-4 w âs effective in both a pretreatment and a posttreatment paradigm [52]. Similar to the in vitro findings in human explants, the in vivo treatment with AdIL-4 in the rat model was associated with lower TNFa and IL-ip levels [52]. Lubberts and colleagues have also shown efficacy of AdIL-4 in a murine model of collagen-induced arthritis (CIA) [53, 54]. Interestingly, in these studies IL-4 had less effect on the joint inflammation than it appeared to have on preservation of cartilage and in preventing bone erosion [53]. These later effects were associated with a reduction of mRNAs for IL-17, TNF, and IL-ip, as well as a decrease in metalloproteinase activity [53, 54]. These investigators also demonstrated that IL-4 can increase type I procollagen 606 Lubberts a n d Kolls synthesis and thus this may explain the joint-sparing/repair effect of IL-4 [53]. Last, Kim and colleagues demonstrated that both periarticular and systemic AdIL-4 were effective in a model of CIA [55]. Whalen and colleagues have investigated another TH2 cytokine, viral IL-10, encoded by an adenoviral vector (AdvIL-10) given by periarticular injection in the same model of CIA and found significant benefit in terms of development of arthritis and arthritis score. Moreover, the investigators show^ed that the injection of AdvIL-10 into one joint prevented arthritis in a second joint [56]. This may be due to in vivo T-cell immunomodulation by viral IL-10. In further support of a role for TH2 cytokine gene therapy in RA, Woods and colleagues have recently demonstrated that adenovirus-mediated gene transfer of interleukin-13, another TH2 cytokine, also suppresses TNF and IL-ip production in RA explant cultures [57]. In addition to the TH2 cytokine approach, the other approach of aden oviral gene transfer for arthritis has largely focused on the proinflammatory cytokines TNFa and IL-ip. Tow^ard this end, our laboratory has created sol uble type-1 receptors for both IL-1 [58] and TNFa [59] (Fig. 6). Both these molecules are dimerized by the addition of murine IgG Fc fragment and in the case of the TNF inhibitor, this molecule has been found to be more potent in TNF inhibition than monoclonal antibodies that only bind to one epitope [60]. Moreover, the proteins have longer half-lives in vivo than the monomeric soluble receptors [59]. Adenoviral-mediated gene transfer of either one of these constructs into the joint space in a rabbit model of arthritis show^ed less v^hite blood cell infiltration as w êll as less joint sv^elling. How^ever, the IL-1 inhibitor show^ed a better effect in preventing a reduction in cartilage matrix hu TNFR- EDor murine type IIL- 1RED Thrombin cleavage site mu IgG Hinge + Fc Figure 6 Schematic diagram of TNF and IL-1 receptor fusion proteins utilized in arthritis gene therapy. 20. Utility of Ad Vectors in Animal Models ill: Acquired Diseases 6 0 7 degradation. Moreover, the two vectors together appeared to have an additive effect on white blood cell infiltration into the joint space. There was also an effect observed on contralateral joints in this study 158]. Le and colleagues also demonstrated efficacy of the TNF inhibitor gene in a rat model of CIA [61]. Interestingly, Quattrocchi have reported in a mouse model of CIA that there is an acute beneficial effect of the TNF inhibitor fusion protein; however, there is a subsequent rebound with enhanced inflammation despite continued circulat ing levels of the TNF inhibitor. The investigators speculated that this may be due to antibody formation against the extracellular domain of the receptor that the cross-linked endogenous TNF receptors in the joint [62]. It is important to note that these studies were performed with a chimeric fusion protein (mouse Fc/human p55 TNF receptor) and thus whether the exacerbation of arthritis would be seen with the mouse p55 TNF receptor remains to be seen. Last, Zhang and colleagues have shown that adenoviral-mediated gene transfer of a dominant negative form of inhibitory kappa-B, which facilitates nuclear translocation of nuclear factor-kappa-B, enhanced TNF-mediated apoptosis in synovial tissue [63]. C. Fibrotic Lung Disease Idiopathic pulmonary fibrosis (IFF) is an insidious disorder that results in the deposition of collagen and fibrous tissue in the lung. The etiology of this disorder is unknown but several groups have reported decreased fibrinolytic activity [64, 65] and elevated tissue growth factor-beta-1 expression [66^ 67] in the lungs of patients with IFF. Moreover, IFNy has been shown in a pilot study to improve lung function in patients with IFF and this impairment was associated with decreased levels of messenger RNA for transforming growth factor-beta-1 and connective-tissue growth factor, the main growth factor product of transforming growth factor-beta stimulation [67]. To date this is the first compound to show improvement in lung function. Many trials have been performed with corticosteroids (prednisone) alone or in combination with cyclophosphamide [68]. However, these agents have not been shown to be effective in preserving lung function in randomized clinical trials, and moreover, their use is associated with significant side effects. Since IFF is associated with dysregulated growth factor gene expression, and a lack of definitive therapy, there is a rationale for gene therapy. Simon and colleagues recently reported on enhancing fibrinolytic activ ity in the lung in an effort to ameliorate lung fibrotic injury in response to bleomycin, a chemotherapeutic agent that can cause lung fibrosis [69]. These investigators constructed a recombinant adenovirus encoding urokinase-
type plasminogen activator (AduPA), a fibrinolytic activator protein. When expressed in the lung, AduPA resulted in a significant attenuation of bleomycin- 6 0 8 Lubberts and Kolls induced increases in hydroxyproline content, a measure of collagen deposi tion [69], Furthermore, Nakao and colleagues have shown that adenovirus- mediated gene transfer of smad7, a downstream inhibitor of TGFp signaling could also block bleomycin-induced fibrosis [70]. This finding was specific to smad7 and not to smad6, which does not inhibit TGPp signaling and thus the data suggest that the effect is through the downregulation of TGFp signaling. Thus, other molecules such as dominant-negatives or soluble receptors for TGFp may also be good candidate constructs for pulmonary fibrosis. In addition to TGFp other proinflammatory cytokines such as interleukin- 1 and TNF have been implicated in pulmonary fibrosis [71]. Our lab reported several years ago on a soluble inhibitor of TNF that consists of the extracellular domain of the human p55 TNF receptor coupled to the murine CH2 and CH3 domains of mouse IgGl (Fig. 6) [59]. This molecule forms as a dimer and is a potent inhibitor of TNF [60]. When expressed in the context of a recombinant adenovirus, after intravenous administration, the construct results in high circulating levels of TNF inhibitory activity [59]. In fact these mice provide a phenocopy of p55 TNF-receptor knockout mice in that they are resistant to mortality induced by endotoxin and d-galactosamine administration; however, they are susceptible to the intracellular pathogen Listeria monocytogenes [59]. However, this molecule also readily crosses into the lung [72] and inhibits TNF activity in this compartment. Moreover, this construct, by virtue of its ability to inhibit TNF in the lung (after systemic vector administration) attenuates the fibrotic response to intratracheal silica [73]. III. Conclusions There are numerous acquired diseases in which adenoviral-mediated gene transfer has shown in proof-of-principle experiments a therapeutic benefit. The challenges for researchers in the field are to take these data and try to develop safe and effective therapies for these diseases. Toward this end, there will need to be advances in targeted vector therapy and regulated gene expression. One area, which may yield promising results in the near future, is in adenovirus- based vaccines either into somatic cells or professional antigen presenting cells such as dendritic cells or in compartmentalized chronic inflammation such as arthritis. In this case, precise gene expression is less likely and, thus, there are fewer technological hurdles to overcome. References 1. Gurwith, M. J., Horwith, G. S., Impellizzeri, C. A., Davis, A. R., Lubeck, M. D., and Hung, P. P. (1989). Current use and future directions of adenovirus vaccine. Semin.Respir. Infect. 4, 299-303. 20. Utility of Ad Vectors in Animal Models III: Acquired Diseases 6 0 9 2. Dolin, P. J., Raviglione, M. C , and Kochi, A. (1994). Global tuberculosis incidence and mortality during 1990-2000. Bull. WHO. 72, 213-220. 3. Sudre, P., Ten, D. G., and Kochi, A. (1992). Tuberculosis: A global overview of the situation today. Bull. WHO. 70, 149-159. 4. Mackaness, G. B. (1971). Resistance to intracellular infection. / . Infect. Dis. 123, 439-445. [Review] 5. Orme, I. M., Andersen, P., and Boom, W. H. (1993). T cell response to Mycobacterium tuberculosis./. Infect. Dis. 167, 1481-1497. [Review] 6. Orme, I. M. (1988). Characteristics and specificity of acquired immunologic memory to Mycobacterium tuberculosis infection./. Immunol. 140, 3589-3593. 7. Orme, I. M., Miller, E. S., Roberts, A. D., Furney, S. K., Griffin, J. P., Dobos, K. M., Chi, D., Rivoire, B., and Brennan, P. J. (1992). T lymphocytes mediating protection and cellular cytolysis during the course of Mycobacterium tuberculosis infection. Evidence for different Icinetics and recognition of a wide spectrum of protein antigens. / . Immunol. 148, 189-196. 8. Dalton, D. K., Pitts Meel^, S., Keshav, S., Figari, I. S., Bradley, A., and Stewart, T. A. (1993). Multiple defects of immune cell function in mice with disrupted interferon-gamma genes. Science 1S9,17?>9-17A1. 9. Cooper, A. M., Dalton, D. K., Stewart, T. A., Griffin, J. P., Russell, D. G., and Orme, I. M. (1993). Disseminated tuberculosis in interferon gamma gene-disrupted mice. / . Exp. Med. 178,2243-2247. 10. Flynn, J. L., Chan, J., Triebold, K, J., Dalton, D. K., Stewart, T. A., and Bloom, B. R. (1993). An essential role for interferon gamma in resistance to Mycobacterium tuberculosis infection. / . Exp. Med. 178, 2249-2254. 11. Magram, J., Connaughton, S. E., Warrier, R. R., Carvajal, D. M., Wu, C. Y., Ferrante, J., Stewart, C , Sarmiento, U., Faherty, D. A., and Gately, M. K. (1996). IL-12-deficient mice are defective in IFN gamma production and type 1 cyto]<:ine responses. Immunity 4, 471-481. 12. Cooper, A.M., Magram, J., Ferrante, J., and Orme, I. M. (1997). Interleukin 12 (IL-12) is crucial to the development of protective immunity in mice intravenously infected with mycobacterium tuberculosis./. Exp. Med. 186, 39-45 . 13. Nathan, C. F., Kaplan, G., Levis, W. R., Nusrat, A., Witmer, M. D., Sherwin, S. A., Job, C. K., Horowitz, C. R., Steinman, R. M., and Cohn, Z. A. (1986). Local and systemic effects of intradermal recombinant interferon-gamma in patients with lepromatous leprosy. N.Engl.]. Med. 3\S,6-1S. 14. Wilhams, L. M., Snyder, D. C , Deblieux, P., Ah, J., Kuebel, D., deBoisblanc, B. P., and Sum mer, W. R. (1994). Safety and feasibility of combined aersolized and subcutaneous interferon- gamma as adjuvant treatment of Mycobacterium avium complex pulmonary infection in non-HIV infected hosts. Am. J. Respir. Crit. Care Med. AllO. 15. Condos, R., Rom, W. N., and Schluger, N. W. (1997). Treatment of multidrug-resistant pulmonary tuberculosis with interferon-gamma via aerosol. Lancet 349, 1513-1515. [see comments] 16. Ewig, S. (1999). Community-acquired pneumonia: Definition, epidemiology, and outcome. Semin. Respir. Infect. 14, 94-102. 17. Lei, D., Lancaster, J. R., Jr., Joshi, M. S., Nelson, S., Stoltz, D., Bagby, G. J., Odom, G., Shel- lito, J. E., and Kolls, J. K. (1997). Activation of alveolar macrophages and lung host defenses using transfer of the interferon-gamma gene. Am. J. Physiol. 272, L852-L859. 18. MacGregor, R. R. (1986). Alcohol and immune defense./. Am. Med. Assoc. 256,1474-1479. 19. Moss, M., Bucher, B., Moore, F. A., Moore, E. E., and Parsons, P. E. (1996). The role of chronic alcohol abuse in the development of acute respiratory distress syndrome in adults. / . Am. Med. Assoc. 275, 50-54. 20. Tamura, D. Y., Moore, E. E., Partrick, D. A., Johnson, J. L., Offner, P. J., Harbeck, R. J., and Silliman, C. C. (1998). Clinically relevant concentrations of ethanol attenuate primed neutrophil bactericidal activity. ].Trauma 44, 320-324. 6 1 0 Lubberts and Kolls 21. Dorio, R. J., Forman, H. J. (1988). Ethanol inhibition of signal transduction in superox ide production by rat alveolar macrophages. A proposed mechanism for ethanol related pneumonia. Ann. Clin. Lab Sci. 18, 190-194. 22. Nelson, S., Bagby, G., and Summer, W. R. (1989). Alcohol suppresses lipopolysaccharide- induced tumor necrosis factor activity in serum and lung. Life Sci. 44, 673-676. 23. D'Souza, N. B., Bagby, G. J., Nelson, S., Lang, C. H., and Spitzer, J. J. (1989). Acute alcohol infusion suppresses endotoxin-induced tumor necrosis factor production. Alcohol Clin. Exp. Res. 13, 295-298. 24. Kolls, J. K., Lei, D., Stoltz, D., Zhang, P., Schwarzenberger, P. O., Ye, P., Bagby, G., Sum mer, W. R., Shellito, J. E., and Nelson, S. (1998). Adenoviral-mediated interferon-gamma gene therapy augments pulmonary host defense of ethanol-treated rats. Alcohol Clin. Exp. Res. 22, 157-162. 25. Bramson, J., Hitt, M., Gallichan, W. S., Rosenthal, K. L., Gauldie, J., and Graham, F. L. (1996). Construction of a double recombinant adenovirus vector expressing a heterodimeric cytokine: In vitro and in vivo production of biologically active interleukin-12. Hum. Gene Ther. 7, 333-342. 26. Greenberger, M. J., Kunkel, S. L., Stricter, R. M., Lukacs, N. W., Bramson, J., Gauldie, J., Graham, F. L., Hitt, M., Danforth, J. M., and Standiford, T.J. (1996). IL-12 gene therapy protects mice in lethal Klebsiella pneumonia. ]. Immunol. 157, 3006-3012. 27. Standiford, T. J., Huffnagle, G. B. (1997). Cytokines in host defense against pneumonia. / . Invest. Med. 45, 335-345. 28. Nelson, S., Bagby, G., Andresen, J., Nakamura, C , Shellito, J., and Summer, W. (1991). The effects of ethanol, tumor necrosis factor, and granulocyte colony-stimulating factor on lung antibacterial defenses. Adv. Exp. Med. Biol. 288, 245-253. 29. Standiford, T. J., Wilkowski, J. M., Sisson, T. H., Hattori, N., Mehrad, B., Bucknell, K. A., and Moore, T. A. (1999). Intrapulmonary tumor necrosis factor gene therapy increases bacterial clearance and survival in murine gram-negative pneumonia. Hum. Gene Ther. 10, 899-909. 30. Kikuchi, T., Worgall, S., Singh, R., Moore, M. A., and Crystal, R. G. (2000). Dendritic cells genetically modified to express CD40 ligand and pulsed with antigen can initiate antigen- specific humoral immunity independent of CD4+ T cells. Nat. Med. 6, 1154-1159. 31. Banchereau, J., and Steinman, R. M. (1998). Dendritic cells and the control of immunity. Nature 392, 245-252. 32. Grewal, I. S., and Flavell, R. A. (1998). CD40 and CD154 in cell-mediated immunity. Annu. Rev. Immunol. 16, 111-135. 33. Clark, E. A., and Ledbetter, J. A. (1994). How B and T cells talk to each other. Nature 367, 425-428. 34. Mosmann, T. R., and Sad, S. (1996). The expanding universe of T-cell subsets: Thl , Th2 and more. Immunol. Today 17, 138-146. [Review] 35. Li, L., Sad, S., Kagi, D., and Mosmann, T. R. (1997). CDSTcl and Tc2 cells secrete distinct cytokine patterns in vitro and in vivo but induce similar inflammatory reactions. / . Immunol. 158,4152-4161. 2>6. Mosmann, T. R., Li, L., and Sad, S. (1997). Functions of CD8 T-cell subsets secreting different cytokine patterns. Semin. Immunol. 9, 87-92. [Review] 37. Beck, J. M., Liggit, H. D., Brunette, E. N., Fuchs, H. J., Shellito, J. E., and Debs, R. J. (1991). Reduction in intensity of Pneumocystis carinii pneumonia in mice by aerosol administration of interferon-gamma. Infect. Immun. 59, 3859-3862. 38. Kolls, J. K., Habetz, S., Shean, M. K., Vazquez, C , Brown, J. A., Lei, D., Schwarzenberger, P., Ye, P., Nelson, S., Summer, W. R., and Shellito, J. E. (1999). IFN-gamma and CD8+ T Cells Restore Host Defenses Against Pneumocystis carinii in Mice Depleted of CD4''~ T Cells. / . Immunol. 162, 2890-2894. 20. Utility of Ad Vectors in Animal Models ill: Acquired Diseases 6 1 1 39. Cummings, K. J., Lee, S. M., West, E. S., Cid-Ruzafa, J., Fein, S. G., Aoki, Y., Sulkowski, M. S., and Goodman, S. N. (2001). Interferon and Ribavirin vs Interferon Alone in the Re-treatment of Chronic Hepatitis C Previously Nonresponsive to Interferon: A Meta- analysis of Random ized Trials. / . Am. Med. Assoc. 285, 193-199. 40. Aurisicchio, L., Delmastro, P., Salucci, V., Paz, O. G., Rovere, P., Ciliberto, G., La Mon ica, N., and Palombo, F. (2000). Liver-specific alpha 2 interferon gene expression results in protection from induced hepatitis. / . Virol. 74, 4816-4823. 41. Scaglioni, P., Melegari, M., Takahashi, M., Chov^dhury, J. R., and Wands, J. (1996). Use of dominant negative mutants of the hepadnaviral core protein as antiviral agents. Hepatology 24, 1010-1017. 42. Noel, R. A., Shukla, P., and Henning, S. J. (1994). Optimization of gene transfer into intestinal cells using a retroviral vector./. Pediatr. Gastroenterol. Nutr. 19, 43-49. 43. Cheng, D. Y., Kolls, J. K., Lei, D., and Noel, R. A. (1997). In vivo and in vitro gene transfer and expression in rat intestinal epithelial cells by El-deleted adenoviral vector. Hum. Gene Ther. 8, 755-764. 44. Hogaboam, C. M., Vallance, B. A., Kumar, A., Addison, C. L., Graham, F. L., Gauldie, J., and Collins, S. M. (1997). Therapeutic effects of interleukin-4 gene transfer in experimental inflammatory bowel disease. / . Clin. Invest. 100, 2766-2776. 45. Macdonald, T. T. (1998). Viral vectors expressing immunoregulatory cytokines to treat inflammatory bov^el disease. Gut 42, 460-461. 46. Barbara, G., Xing, Z., Hogaboam, C. M., Gauldie, J., and Collins, S. M. (2000). Interleukin 10 gene transfer prevents experimental colitis in rats. Gut 46, 344-349. 47. Miossec, P. (2000). Are T ceUs in rheumatoid synovium aggressors or bystanders? Curr. Opin. Rheumatol. 12, 181-185. 48. Muller, B., Gimsa, U., Mitchison, N. A., Radbruch, A., Sieper, J., and Yin, Z. (1998). Mod ulating the Thl/Th2 balance in inflammatory arthritis. Springer Semin. Immunopathol. 20, 181-196. 49. Roessler, B. J., Allen, E. D., Wilson, J. M., Hartman, J. W., and Davidson, B. L. (1993). Adenoviral-mediated gene transfer to rabbit synovium in vivo. / . Clin. Invest 92, 1085-1092. 50. Chabaud,
M., Fossiez, F., Taupin, J. L., and Miossec, P. (1998). Enhancing effect of IL-17 on IL-1-induced IL-6 and leukemia inhibitory factor production by rheumatoid arthritis synoviocytes and its regulation by Th2 cytokines./. Immunol. 161, 409-414. 51. Woods, J. M., Tokuhira, M., Berry, J. C , Katschke, K. J., Kurata, H., Damergis, J. A., Arai, K., and Koch, A. E. (1999). Interleukin-4 adenoviral gene therapy reduces production of inflammatory cytokines and prostaglandin E2 by rheumatoid arthritis synovium ex vivo. / . Invest. Med. 47, 285-292. 52. Woods, J. M., Katschke, K. J., Volin, M. V., Ruth, J. H., Woodruff, D. C , Amin, M. A., Connors, M. A., Kurata, H., Arai, K. I., Haines, G. K., Kumar, P., and Koch, A. E. (2001). IL- 4 adenoviral gene therapy reduces inflammation, proinflammatory cytokines, vascularization, and bony destruction in rat adjuvant-induced arthritis./. Immunol. 166, 1214-1222. 53. Lubberts, E., Joosten, L. A., Chabaud, M., Van Den, B. L., Oppers, B., Coenen-De Roo, C. J., Richards, C. D., Miossec, P., and Van den Berg, W. B. (2000). IL-4 gene therapy for collagen arthritis suppresses synovial IL-17 and osteoprotegerin ligand and prevents bone erosion. / . Clin. Invest. 105, 1697-1710. 54. Lubberts, E., Joosten, L. A., Van Den, B. L,, Helsen, M. M., Bakker, A. C , van Meurs, J. B., Graham, F. L., Richards, C. D., and Van den Berg, W. B. (1999). Adenoviral vector-mediated overexpression of IL-4 in the knee joint of mice with collagen-induced arthritis prevents cartilage destruction. / . Immunol. 163, 4546-4556. 55. Kim, S. H., Evans, C. H., Kim, S., Oligino, T., Ghivizzani, S. C , and Robbins, P. D. (2000). Gene therapy for established murine collagen-induced arthritis by local and systemic adenovirus-mediated delivery of interleukin-4. Arthritis Res. 2, 293-302. 6 1 2 Lubberts and Kolls 56. Whalen, J. D., Lechman, E. L., Carlos, C. A., Weiss, K., Kovesdi, I., Glorioso, J. C , Rob- bins, P. D., and Evans, C. H. (1999). Adenoviral transfer of the viral IL-10 gene periarticularly to mouse paws suppresses development of collagen-induced arthritis in both injected and uninjected pav^s./. Immunol. 162, 3625-3632. 57. Woods, J. M., Katschke, K. J., Tokuhira, M., Kurata, H., Arai, K. I., Campbell, P. L., and Koch, A. E. (2000). Reduction of inflammatory cytokines and prostaglandin E2 by IL-13 gene therapy in rheumatoid arthritis synovium./. Immunol. 165, 2755-2763. 58. Ghivizzani, S. C , Lechman, E. R., Kang, R., Tio, C , Kolls, J., Evans, C. H., and Robbins, P. D. (1998). Direct adenovirus-mediated gene transfer of interleukin 1 and tumor necrosis factor alpha soluble receptors to rabbit knees with experimental arthritis has local and distal anti-arthritic effects. Proc. Natl. Acad. Sci. USA 95, 4613-4618. 59. Kolls, J., Peppel, K., Silva, M., and Beutler, B. (1994). Prolonged and effective blockade of tumor necrosis factor activity through adenovirus-mediated gene transfer. Proc. Natl. Acad. Sci. USA 91, 215-219. 60. Peppel, K., Crawford, D., and Beutler, B. (1991). A tumor necrosis factor (TNF) receptor-IgG heavy chain chimeric protein as a bivalent antagonist of TNF activity. / . Exp. Med. 171, 1483-1489. 61. Le, C. H., Nicolson, A. G., Morales, A., and Sewell, K. L. (1997). Suppression of collagen- induced arthritis through adenovirus-mediated transfer of a modified tumor necrosis factor alpha receptor gene. Arthritis Rheumatism 40, 1662-1669. 62. Quattrocchi, E., Walmsley, M., Browne, K., Williams, R. O., Marinova-Mutafchieva, L., Buurman, W., Butler, D. M., and Feldmann, M. (1999). Paradoxical effects of adenovirus- mediated blockade of TNF activity in murine collagen-induced arthritis. / . Immunol. 163, 1000-1009. 63. Zhang, H. G., Huang, N., Liu, D., Bilbao, L., Zhang, X., Yang, P., Zhou, T., Curiel, D. T., and Mountz, J. D. (2000). Gene therapy that inhibits nuclear translocation of nuclear factor kappaB results in tumor necrosis factor alpha-induced apoptosis of human synovial fibroblasts. Arthritis Rheumatism 43, 1094-1105. 64. Hattori, N., Degen, J. L., Sisson, T. H., Liu, H., Moore, B. B., Pandrangi, R. G., Simon, R. H., and Drew, A. F. (2000). Bleomycin-induced pulmonary fibrosis in fibrinogen-null mice. / . Clin. Invest. 106, 1341-1350. 65. Olman, M. A., Mackman, N., Gladson, C. L., Moser, K. M., and Loskutoff, D. J. (1995). Changes in procoagulant and fibrinolytic gene expression during bleomycin-induced lung injury in the mouse./. Clin. Invest. 96, 1621-1630. 66. Gauldie, J., Jordana, M., and Cox, G. (1993). Cytokines and pulmonary fibrosis. Thorax 48, 931-935. 67. Ziesche, R., Hofbauer, E., Wittmann, K., Petkov, V., and Block, L. H. (1999). A preliminary study of long-term treatment with interferon gamma-lb and low-dose prednisolone in patients with idiopathic pulmonary fibrosis. N. Engl. ]. Med. 341, 1264-1269. 68. Selman, M., King, T. E., and Pardo, A. (2001). Idiopathic pulmonary fibrosis: PrevaiHng and evolving hypotheses about its pathogenesis and implications for therapy. Ann. Intern. Med. 134,136-151. 69. Sisson, T. H., Hattori, N., Xu, Y., and Simon, R. H. (1999). Treatment of bleomycin-induced pulmonary fibrosis by transfer of urokinase-type plasminogen activator genes. Hum. Gene Ther. 10,2315-2323. 70. Nakao, A., Fujii, M., Matsumura, R., Kumano, K., Saito, Y., Miyazono, K., and Iwamoto, L (1999). Transient gene transfer and expression of Smad7 prevents bleomycin-induced lung fibrosis in mice./. Clin. Invest. 104, 5 - 1 1 . 71. Piguet, P. F. (1993). Cytokines involved in pulmonary fibrosis. Int. Rev. Exp. Pathol. 34B, 173-181. 20. Utility of Ad Vectors in Animal Models III: Acquired Diseases 6 1 3 72. Kolls, J. K., Lei, D., Greenberg, S., Nelson, S., and Beutler, B. (1995). Adenovirus-mediated blockade of tumor necrosis factor in mice protects against endotoxic shock yet impairs pulmonary host defense./. Infect, Dis. 171, 570-575. 73. Curiel, D. T., Pilewski, J. M., and Albelda, S. M. (1996). Gene therapy approaches for inher ited and acquired lung diseases. Am. J. Respir. Cell MoL Biol. 14, 1-18. C H A P T E R Testing of Adenoviral Vector Gene Transfer Products: FDA Expectations Steven R. Bauer% Anne M. Pilaro^, and Karen D. Weiss^ *Divlsion of Cellular and Gene Therapies and ^Division of Clinical Trial Design and Analysis CBER Food and Drug Administration Rockville, Maryland I. Introduction Adenovirus vectors that contain gene transfer products are biological products subject to Food and Drug Administration (FDA) regulation through the Center for Biologies Evaluation and Research (CBER) [1]. Sponsors of biologicals subject to FDA regulation that are not yet approved for marketing must file a "Notice of Claimed Investigational Exemption for a Nev^ Drug," w^hich is abbreviated as "IND" for Investigational New Drug Application. Adenoviral vector products have been studied in clinical trials under IND since 1993. As of December 2000, approximately 75 INDs involving administration of an adenoviral vector product have been filed with the FDA, with slightly more than 50% currently active. Each IND contains one or more clinical protocols. The vast majority (>90%) of the adenoviral gene therapy INDs target patients with cancer. The clinical studies contained in the remainder of the INDs target patients with vascular disease (coronary artery or peripheral) or genetic/metabolic diseases. The sponsor is the entity or individual that holds and maintains the IND. The clinical investigator is the individual responsible for the care and welfare of the study participants at his or her site. Sponsors and investigators involved in FDA regulated research must be in compliance with federal regulations, described in the following sections of this chapter. In addition, investigators who receive federal funding for gene transfer clinical research or who conduct clinical studies at an institution that receives federal funds for recombinant DNA research must register the cHnical protocol with the National Institute of ADENOVIRAL VECTORS FOR GENE THERAPY 6 1 5 Copyright 2002, Elsevier Science (USA). All rights reserved. 6 1 6 Bauer ef aL Health (NIH) Office of Biotechnology Activities (OBA) and be in compliance with the NIH Guidelines [2]. The FDA's assessment of safety and ultimately effectiveness of adenovirus- containing products involves thorough evaluation of the information contained in the IND, and any supporting information cross-referenced to another IND or drug master file [3]. The type of information contained in an IND is set forth in 21 CFR 312.20, subpart B. The follow^ing sections describe many of the agency requirements and guidances regarding drug development of adenoviral-containing products. II. Manufacturing Control and Product Characterization A. Purity, Safety, and Potency When an adenovirus-based vector is used for the first time in humans, a major goal of FDA oversight is to ensure the safety of patients who receive the investigational product. A crucial component of safety and effectiveness is careful attention to the details of manufacturing and product characterization. The extent and quality of this information allow^s an assessment of the purity of the final vector preparation that w îll be administered to patients. Assessment of purity involves biological and biochemical characterization of the vector preparation and assessment of hov\̂ completely the formulated product con forms to expected characteristics. For adenovirus vectors assessment of purity includes structural and biochemical information about the vector itself as w êll as demonstration of freedom from unexpected and potentially harmful agents such as viruses, fungi, and bacteria or bacterial toxins. Another important goal of product characterization is assessment of the potency of adenovirus vector preparations. Potency measurements are intended to determine the extent to v^hich a particular vector preparation has a desired biological activity. A vector preparation v^ith insufficient potency has little chance of behaving as desired in a clinical trial. Although infectious titer has been proposed as a measurement of potency, this is currently not considered sufficient since the correlation betw^een in vitro infectious assays and biologic effects has not been established. While potency is related to safety and efficacy, it is also an indicator of product manufacturing consistency. Direct measurement of potency for a new adenovirus vector product is often challenging due to lack of an appropriate in vitro or in vivo system to measure potency. Therefore, in initial phases of product development, demonstration of transgene activity by enzymatic means is often adequate for initiation of clinical trials. Development of a bona fide potency assay for vector lot release will be required before FDA can license an adenovirus product. It is generally expected that a potency assay will be in place before Phase 3. Thus, 2 1 . Testing of Ad Vector Gene Transfer Products 6 1 7 as with all biological therapeutic products, assessment of the purity, safety, and potency of adenovirus vectors is a crucial part of product development. B. Regulation of Process as Well as Product The complexity of adenovirus vector manufacturing as v^ell as inher ent biological properties of the production system v^arrants oversight of the production process as well as the final product. Indeed, as with all complex bio logical products, in order to assure the purity, potency, and safety of adenovirus vectors, regulation of the manufacturing process is as important as character ization and testing of the final product. Therefore, there should be thorough characterization of starting materials and product intermediates in order to assure that the final vector product is acceptable for administration to humans. Initial development of a new adenovirus vector involves manipulation and cloning of a transgene cassette with the desired gene and appropriate transcriptional regulatory elements. In a commonly used approach to vector production, an appropriate cell line is then cotransfected with the transgene cassette and a backbone shuttle vector that supplies the remaining components of the adenovirus genome. An appropriate cell line allows homologous recom bination between the transgene and backbone plasmids and then supports synthesis of replication-defective adenovirus particles. It is the ability to medi ate homologous recombination that allows assembly of the desired vector, but this ability also can lead to unintended structural changes. Thus it is crucial to select a vector clone that is fully characterized and has the intended structure. Since the same cell line is then also used to propagate vector for production of virus banks and for large-scale production, it is important to monitor the structure of the vector through several stages of manufacturing. The cell lines used for production of adenovirus vectors add another complex, biological component to the manufacturing process. The characteri zation of the cell lines, including master cell banks and working cell banks is described in detail in section VI. C. Current Good Manufacturing Practices The principles of current Good Manufacturing Practice (cGMP) as per 21 CFR 210 and 211 apply to adenovirus gene transfer products. However, implementation of cGMPs may be staged according to
the phase of prod uct development, but there should always be appropriate documentation of manufacturing and of quality oversight. For Phase 1, this includes appropriate written protocols for each stage of product manufacturing and characteriza tion. At later stages of product development, appropriate documentation of manufacturing should employ standard operating procedures (SOPs) and cap ture all important information relating to vector production. Quality oversight always involves quality control (QC) and quality assurance (QA) mechanisms. 6 1 8 Bauer ef al. regardless of where manufacturing is taking place. In essence, this means that the person(s) responsible for assurance that the production and characterization testing have all been performed properly and have met specified criteria (qual ity assurance) are separate from and not direct subordinates of the person(s) responsible for conducting these tests and filing these reports (quality control). As product development moves from Phase 1 into later phases, cGMPs also stipulate development of validated assays that must be in place by prod uct Hcensure. Data regarding assay performance (specificity, sensitivity, and reliability) should be submitted to the agency as part of the validation process. III. Development of Recommendations for the Manufacture and Characterization of Adenoviral Vectors Many factors contribute to development of FDA recommendations and requirements for characterization of adenovirus vectors. First are the regula tions found in the various applicable parts of the Code of Federal Regulations (CFR). These include the regulatory requirements that biological products administered to humans must be sterile (21 CFR 610.12 or another vaHd alter native testing of equal sensitivity), be free of mycoplasma (21 CFR 610.30), and meet endotoxin limits (limulus amebocyte lysate [LAL] per 21 CFR 610.9 or pyrogenicity test 21 CFR 610.13(b)). These estabfish minimum criteria to assure that products administered to humans are not contaminated w îth microbial organisms or their toxic byproducts. Next are FDA review^ staff w ĥo have accumulated experience from review^ of many adenovirus vector and other gene therapy products. Some reviev^ers maintain active research programs in areas related to adenovirus biology or have participated in such research in the past. CBER reviewers have regular internal meetings to discuss relevant issues and develop consistency in oversight of adenovirus vector products. A major effort in this regard v^as launched March 6, 2000, with the issuance of a letter to Gene Therapy Sponsors requesting comprehensive information on product, preclinical, clinical, and QA/QC areas (see section XVI). These data have been tremendously useful and will be used to refine CBER's recommendations regarding adenovirus and other vector products. The cumulative experience of FDA reviewers is also utilized to develop guidance documents, several of which are relevant to the manufacture of adenovirus gene transfer products [4-6] The experience of the gene therapy community has also played a key role in development of FDA recommendations in regulation of adenovirus vector products. The experience of adenovirus vector manufacturers is communi cated in meetings between the manufacturer and FDA staff, at presentations 2 1 . Testing of Ad Vector Gene Transfer Products 6 1 9 at scientific meetings, and at presentations to the NIH Recombinant DNA Advisory Committee (RAC). The NIH RAC has played an important role in the development of recommendations and it provides a public forum for discussion. Follov^ing the death of a patient in a gene therapy trial in late 1999, the RAC empanelled an ad hoc advisory group, the RAC Working Group on Adenoviral Vector Safety and Toxicity (Ad-SAT), to examine data from adenovirus gene transfer trials v^ith the intent of formulating recommendations to improve the safety of these clinical trials. One important discussion centered on the accuracy of adenovirus vector titers in terms of both total particle and infectious particle titers [25]. Since toxic vector doses are just above doses w îth potential therapeutic effect, there v^as particular concern over lack of accuracy and comparability between titers determined for different product lots and between different clinical trials. This discussion highlighted the need for a reference standard that could be used to help standardize adenovirus vector titer measurements. This public discussion helped stimulate a gene therapy community initia tive to develop such standards. Several public meetings to develop consensus on the need for a standard, to discuss the nature of the reference material, and to discuss mechanisms for its development were held in late 2000 and early 2001 [7]. An Adenovirus Reference Materials Working Group (ARMWG) was formed under the auspices of the Williamsburg Bioprocessing Foundation (WBF), and an WBP/FDA partnership agreement was formulated that allowed participation of FDA staff in development of a reference stock of wild-type adenovirus type 5 which can be used to calibrate assays for particle number and infectivity. The role of FDA is to lend scientific and regulatory expertise in the form of recommendations to the ARMWG, which oversees the develop ment of the reference material. Information on this initiative is available at the WBF website (www.wilbio.com) and the CBER website (www.cber.fda.gov). The information includes meeting minutes, transcripts from FDA cosponsored meetings, and explanations of the bid mechanisms by which participants volunteered donations of goods and services toward production and character ization of the reference material. This reference material will provide another mechanism for FDA to formulate recommendations for characterization of adenovirus-based gene transfer products. FDA also seeks input from advisory committees such as the Biologi cal Response Modifiers Advisory Committee (BRMAC) for recommendations regarding characterization of adenovirus vectors. BRMAC meetings allow FDA to obtain advice on scientific issues that impact gene transfer experiments in a public forum in which all interested parties are allowed to partici pate. Transcripts of these meeting are also available on the CBER website (www.cber.fda.gov). The BRMAC's advice on issues such as the amount and type of structural characterization of gene transfer vectors, discussed at two 6 2 0 Bauer et aL recent committee meetings, has been valuable as CBER staff develop and update policy [8, 9] In summary, the FDA receives input and feedback from a variety of sources in formulating recommendations regarding adenovirus manufacturing and characterization. The recommendations may change v^ith advances in technology and through accumulating experience. FDA considers the potential risks and benefits of each vector product and each proposed clinical trial when making its recommendations. This case-by-case approach, v^hich takes into account the severity of the disease and the proposed patient population, permits some flexibility in product manufacture and characterization. IV. Considerations in Manufacturing Adenoviral Vectors A. Components and Characterization While the goal of adenovirus vector manufacturing is to produce a safe, pure, and efficacious vector, the complexity of the process necessitates careful control of the entire manufacturing procedure and of the components used. Raw materials can be a source of adventitious agents or toxic impurities that negatively impact safety of the final product. At early stages of product devel opment, certificates of analysis (CoA) for many raw materials such as buffers, and basic tissue culture components should be part of the documentation demonstrating that these reagents are pure and free of adventitious agents. These CoAs should be kept in the manufacturer's records and sample CoAs should be submitted to the agency. At later stages of product development, development of testing and acceptance criteria for some of these materials may be required of the sponsor. As an example, current techniques for adenovirus vector production require mammalian cell substrates. Raw materials include a source of serum, usually fetal bovine serum (FBS), and enzymes such as porcine trypsin for cell culture. These reagents can be contaminated with adventitious virus. Trypsin has been identified as a potential source of porcine parvovirus while FBS can harbor several adventitious viruses. Therefore, FBS and porcine trypsin should come only from sources where appropriate testing is conducted and documented in a CoA. A manufacturer of adenovirus vectors should retain all such CoAs and submit sample copies to FDA. Also, bovine serum from geographic areas known to harbor endemic bovine spongiform encephalopathy agent (BSE) is considered inappropriate for use in manufacturing a biological for use in humans. Since adenovirus vector production relies on cells that support replication of the vector, cell banking is an important aspect of production. Cell banks are cryopreserved stockpiles consisting of very well characterized cell populations that have been shown to be free of adventitious virus, are sterile, and have the 21. Testing of Ad Vector Gene Transfer Products 6 2 1 capacity to support production of the adenovirus vector. Ideally, cell banks are derived from early cell passages and assure that a reliable and consistent source of qualified cells is available for the foreseeable future production needs. Details of the necessary characterizations for cell banks are discussed belov\̂ . In similar fashion, virus banks are an important aspect of adenovirus pro duction. Virus banks consist of frozen stocks of very v^ell characterized molec ular vector clones. Characterization includes structural, physical/biochemical, and functional assessments in addition to assessments of microbial sterility and freedom from adventitious viruses. Virus banks are derived as an early step in vector manufacturing and assure that a reliable source of infectious vector is available for foreseeable future production needs. Details of the necessary characterizations for virus banks are discussed below. B. Protocols The protocols used for each step of manufacture are important records which can demonstrate that the production process and the starting materials for vector production are of a quality sufficient to assure that the final product is pure and safe. Detailed descriptions of each step should be maintained and submitted to the FDA as part of an IND. Many protocols are an integral part of manufacturing and should be part of standard operating procedures (see below). Even though many protocols such as the molecular biology techniques used to assemble a vector are not repeated steps, detailed protocols for these stages are essential. V. Process Contrcis Control of the manufacturing process is obtained through testing and characterization of intermediates and final product in the production scheme. For adenovirus vectors this includes characterization of the cell substrate (master and working cell banks), the virus seed stock (master virus bank), the bulk vector preparation, and the final formulated product. Details of the testing are outlined below. The goal of process control is twofold; to ensure safe, pure, and efficacious vector products and to demonstrate that the production process is highly reproducible. A. Standard Operating Procedures Standard operating procedures are a mechanism to ensure that pro cess controls and protocols for product manufacture and characterization are carried out in a reproducible and documented fashion for each stage of manufacturing and product testing. SOPs consist of detailed written docu ments describing each step of a process conducted in manufacturing. SOPs 6 2 2 Bauer ef aL can also refer to many different types of processes that impact adenovirus production, such as required training of personnel, acquisition and acceptance of raw materials, procedures for shipping and handling final product, and conduct of quality oversight. For early product development, SOPs should be developed for the manufacturing and testing steps discussed belov^. For later stages in product development, consultation with the FDA is advisable to assure comprehensive coverage of the manufacturing process by appropri ate SOPs. B. Quality Assurance and Quality Control Programs Quality assurance and quality control programs are considered essential steps in assuring safe and high-quality adenovirus vector products. A key concept in a QA/QC program is that there should be separation of authority between the personnel responsible for conduct of testing and manufacturing and the personnel who examine and approve the test data and final product characterization. This can be accomplished in a variety of ways. For instance, separate QA and QC departments in the same institution can be used pro vided that the responsible personnel not be under direct supervision of one another. An important topic that is often misunderstood is the division of respon sibilities between an IND sponsor and a multiuse facility contracted to do some part of product manufacturing. When these facilities are used to produce more than one gene transfer vector, they are termed multiuse facilities. Many gene-therapy vectors are produced in multiuse facilities. IND sponsors often assume that the contract lab will provide all necessary QA/QC, manufacturing, and product testing information to the FDA and do not involve themselves sufficiently in designing the testing, examining the data, and/or answering FDA questions. Although the contract lab plays an important role, the responsibility for
oversight of QA/QC and reporting lies with the sponsor. The sponsor must recognize that the FDA holds them accountable for oversight of production and testing conducted by a contract organization. An additional concern with multiuse facilities is the potential for cross-contamination of one product with a product made previously or concurrently. The multiuse facility should test for cross-contamination or validate the production and purification process to rule out cross-contamination. The entire production process, from raw materials to oversight of testing and product release, is important in assuring that adenovirus and other gene transfer vectors are as safe and consistent as possible. The next sections describe in greater detail the characterization that should be done for each of the major components or intermediates as well as the final product in adenovirus vector production. These include the cell banks, the virus bank, the bulk virus preparation, and the final vector product. 2 1 . Testing of Ad Vector Gene Transfer Products 6 2 3 VI . Characterization of Adenoviral Vector Production Intermediates The necessity for and specifications for each of these characterizations is assessed on a case-by-case basis and can change depending on the phase of product development and as a resuh of feedback from the numerous sources discussed above. Therefore, the follow^ing material is intended to give the reader an overviev^ of FDA expectations. Consultation w îth CBER at the pre-IND stage is strongly recommended. A. Master Cell Bank Testing of the cell banks used in adenovirus vector production is of tw ô general types; safety testing and characterization. Table I is an overview^ of the recommended characterizations. The safety testing is intended to demonstrate that the cell bank is free of any detectable microbial contamination including bacterial, fungal, and viral. Sterility testing is a universal requirement for biologies and is set forth in 21 CFR 610.12. Alternative sterility assays validated to be of equal sensitivity may also be used. The basic premise is to apply the product, in this case cells from the master cell bank, to several grov^th media and to look for outgrow^th of microbial contaminants over the course of 14 days. The specification for this test is no contaminants. Mycoplasma testing is conducted by inoculation of both cells and cell supernatants into appropriate cultures and examining for grow^th of Table I Characterization of the Cell Banks" Safety Identity Sterility Morphology Mycoplasma Isoenzyme tests Adventitious virus Cell-specific identity test • In vitro and in vivo virus • Bovine, porcine, canine viruses (ancillary product dependent 9CFR113.47) • Human viruses: EBV, HBV, HCV, CMV, HIV 1&2, HTLV 1&2, AAV, B19 (other cell substrate specific) Tumorigenicity ^The necessity for and specifications for each of these characterizations is assessed on a case-by-case basis and can change depending on the phase of product development and as a result of feedback from the numerous sources discussed above. Therefore, this list is intended to give the reader an overview^ of FDA oversight. Hov^ever, consultation with CBER is strongly recommended before submission of an IND. 6 2 4 Bauer ef al. mycoplasma. This testing is described in FDA guidelines [5]. Alternative tests such as PCR could be utilized following proper demonstration of the sensitivity and comparability to the culture-based assay. Adventitious virus tests are also intended to show that the test material is free of a variety of viruses. The in vitro adventitious virus test is conducted by inoculating cell cultures with the test material, in this case supernatants from the master cell bank (MCB). Following 14 days in culture, cells are tested for their ability to mediate hemadsorption or hemagglutination with red blood cells from three different species. The cell lines are chosen for their ability to support replication and detection of many different viruses. A list of viruses that can be detected is given in Table II. The in vitro adventitious virus assay provides a nonspecific screen for many different viruses and can sometimes be used to identify certain viruses. The in vivo adventitious virus test is conducted by inoculating animals from several species with supernatant from the cell bank material. The species are chosen to optimize detection of possible contaminating adventitious viruses. The in vivo virus test is capable of detecting an array of viruses complimentary to those detected by the in vitro assay. A list of viruses that can be detected is given in Table II. For both types of adventitious virus tests, the acceptable specification is no detection of virus. In addition to these nonspecific tests, a variety of specific tests for many different viruses may be required. As the current cell fines used to support adenovirus replication are of human origin, a variety of human virus tests are included. FDA-approved test kits should be used when available. Although the cell lines used to produce adenovirus are not generally thought to support replication of several of these viruses, experimental data to preclude this possibility do not exist. In addition, if sensitive cell-fine-specific identity tests are not part of the MCB characterization, it is possible that other human cell lines could be present and may serve as a reservoir for some of these Table II'' In Vitro and In Vivo Adventitious Virus Testing In vitro adventitious virus testing In vivo adventitious virus testing Picornaviruses: e.g., poliovirus, Coxsackie B, Picornaviruses: e.g., influenza, Coxsackie A echovirus, rhinovirus and B, poliovirus Togavirus: e.g., rubella Bunyavirus: e.g., LCMV, hantavirus Paramyxovirus: e.g., parainfluenza, mumps Herpesvirus: e.g., HSV-1 measles, RSV Orthomyxovirus: e.g., influenza Paramyxovirus: e.g., mumps Adenovirus Coronavirus Herpesvirus Flavivirus^ ^"Fields Virology," Chap. 17 [33]. ^"Fields Virology," Chap. 31 [34]. 2 1 . Testing of Ad Vector Gene Transfer Products 6 2 5 viruses. In addition, it is surprising that some viruses not thought to repHcate in cell lines such as HEK 293 (human embryonic kidney fibroblasts) have been detected in adenovirus product lots. For the above reasons, these tests are currently recommended at various steps for all adenovirus vector production. Currently, the specific virus tests include Epstein-Barr virus (EBV), hepatitis B virus (HBV), hepatitis C virus (HCV), cytomegalovirus (CMV), human immunodeficiency viruses I and II (HIV 1 and 2), human parvovirus B19, human T-lymphotrophic viruses 1 and 2 (HTLV 1 and 2), and adeno-associated virus (AAV). The test methods, specifications and sensitivities for these tests should be submitted as part of the proposed acceptance criteria for cell banks. Nonhuman cell lines could also be used to produce adenovirus vectors. In such cases additional testing may be necessary. For example, if rodent cells were used, the MCB should also be tested by the appropriate antibody production test: murine antibody production (MAP), rat antibody production (RAP), or hamster antibody production (FlAP) [6]. Current adenovirus production methods commonly use fetal bovine serum (FBS) and porcine trypsin for propagation of producer cell lines. The use of FBS carries two types of risks; the potential for patient exposure to BSE and to adventitious bovine viruses. The use of porcine trypsin carries risk of patient exposure to porcine parvovirus. Producer cell lines with sufficient documentation may be usable without tests for bovine or porcine viruses or BSE. When FBS is used, sufficient documentation includes the following: certificates of analysis (CoA) showing that the FBS is not from one of the countries on the USDA list of countries where BSE is found and that the FBS has been tested for bovine viruses. For porcine trypsin, sufficient documentation includes CoAs showing that the trypsin is negative for porcine parvovirus. If documentation of viral testing is unavailable, the testing will be requested as per 9 CFR 113.47. Once an MCB is tested or shown to have an accepted history of nonexposure to these agents, these tests may be omitted in subsequent stages of production if CoAs of FBS and porcine trypsin contain the proper testing and come from approved geographic locations. Although tumorigenicity testing has often been requested, it is acknowl edged that the cell line used in adenovirus production may be tumorigenic in immunodeficient mouse strains. In later stages of product development, this test may be required. For products that are in Phase 1 of clinical testing, it may be possible to omit this test if there is sufficient testing of the product for cell substrate DNA (see below). In addition to safety testing, characterization of MCBs should include tests for identity of the cell lines. Isoenzyme analysis can show the cell line is of the correct species. For most current adenovirus producer cells, this involves testing for human isoenzymes. Morphology is also assessed to show that the cell line retains the expected shape and size. Development of a cell-specific 6 2 6 Bauer ef o/. identity test is currently recommended so that accidental contamination of the adenovirus vector producer cell line can be detected. B. Working Cell Bank Working cell banks are expanded cell populations derived from the MCB and are tested after a defined number of cell generations. The testing of WCBs is similar to that requested for MCBs and consists of the follovs îng safety tests: sterility, mycoplasma, and in vitro adventitious virus. Characterization includes morphology and isoenzyme analysis. C. Master Virus Bank A master virus bank (MVB) consists of a w^ell-characterized stock of virus-based vector that serves as the inoculum for all subsequent large-scale vector production. It is sometimes referred to as a vector seed stock. Table III gives a summary of the types of characterization recommended by the FDA. Safety testing for a master virus bank is very similar to that done for a master cell bank. Thus a master virus bank is tested for sterility and mycoplasma, in vitro and in vivo adventitious virus, and specific viruses (EBV, HBV, HCV, CMV, HIV 1 and 2, AAV, B19, HTLV 1 and 2) if the cells used to produce the MVB were not fully characterized as described for the MCB. Depending on the degree of characterization of the FBS and porcine trypsin, a MVB may require testing for bovine viruses and porcine parvovirus. Table III Characterization of the Master Virus Bank° Safety Characterization Sterility Identity Mycoplasma • Sequence insert and flanking regions Adventitious Virus restriction map^ • In vitro and in vivo virus Activity • Bovine, porcine, canine viruses (ancillary • Transgene specific protein expression product-dependent 9CFR113.47) • Other • Human viruses: EBV, HBV, HCV, CMV, Titer HIV 1&2, HTLV 1 & 2, AAV, B19 • Infectious titer • Replication-competent adenovirus • Particle count '^The necessity for and specifications for each of these characterizations is assessed on a case-by-case basis and can change depending on the phase of product development and as a result of feedback from the numerous sources discussed above. Therefore, this hst is intended to give the reader an overview of FDA oversight. However, consultation with CBER is strongly recommended before submission of an IND. BRMAC Advisory Committee Meeting, November 16, 2000: recommended entire sequence for vectors <40 kb 18]. 2 1 . Testing of Ad Vector Gene Transfer Products 6 2 7 In addition to the above testing for cell banks, an adenovirus MVB should be tested for replication-competent adenovirus (RCA). RCAs are a common byproduct of adenovirus vector production and are currently con sidered a safety risk. RCAs most often arise due to molecular recombination between the vector and endogenous elements of the producer cell line genome. Some of these recombinations restore the replication competence of a normally replication-defective vector and give rise to RCA. For example, in the HEK 293 cell-line, endogenous El sequences are required to allov^ replication of the El defective adenovirus vectors. The vectors can undergo homologous recom bination with the endogenous El , thus restoring their replication competence. This is a stochastic and unavoidable consequence of the biology of the certain producer cells. Development of producer cells with smaller or no regions of homology between vector and endogenous sequences may reduce homologous recombination but may still support nonhomologous recombination. For most replication defective adenovirus vectors, RCA testing is performed by inocu lation of the test material onto a cell line that will support replication of a RCA but not of defective vector. Supernatant from this treatment is passaged to a second cell monolayer. Development of cytopathic effects (CPEs) or lysis indicates the presence of RCA. The current recommended specification for RCA is <1 RCA in a total of 3 x 10^^ virus particles. Characterization of the adenovirus vector MVB
encompasses a variety of approaches to establish the physical, biochemical, and biological properties of the vector preparation. Identity is an important parameter and demon strates that the intended product is the actual starting material for large-scale production. Current FDA recommendations for structural characterization of adenovirus vectors include determination of the nucleotide sequence of the transgene insert and flanking regions. The remainder of the structure can be demonstrated by techniques such as restriction mapping and PCR. In cases where extensive characterization of the transgene protein is available, no sequencing is necessary and restriction mapping of the vector would be suffi cient. However, at a recent meeting of the BRMAC which addressed the issue of structural characterization, it was recommended that vectors <40 kb in length should be characterized by sequencing of the entire vector genome [8]. It is likely that the FDA will adopt this recommendation in the near future. For adenovirus vectors, the MVB would be the most appropriate material for this sequence analysis. Another important characteristic of an adenovirus vector MVB is the activity of the transgene. Although this is not a potency assay per se, this parameter suggests that the therapeutic transgene will be functional in clinical trials and thereby justifies the risks of exposure to patients. Activity assays can include demonstration that the transgene-encoded protein is expressed and demonstration that the protein is functional in some biochemical assay. Assays that determine the expression and activity of the adenovirus vector should 6 2 8 Bauer ef a/. be part of the acceptance criteria for each MVB. Methods and acceptable specifications for these assays should be part of IND submissions. The number of adenovirus vector particles in a MVB is measured in two ways. One method is to determine the particle count. Most often this is determined by a measurement of the amount of DNA in a vector preparation which is then related to particle number by an agreed-upon conversion factor. Although this is a physical/chemical assay, the precision is affected by several factors including formulation of the vector preparation and nonviral nucleic acid content of the preparation. Cellular nucleic acids as well as differences in DNA sequence between vectors can affect the precision of this measurement, which can vary on the order of 10%. A second measure of adenovirus vector quantity in a MVB is the infectious titer. This is an assessment of how many of the particles retain the capacity to interact with cell surface receptors and subsequently undergo internalization. This measure is an indication that the manufacturing process is gentle enough to preserve viral coat protein structure and will largely determine the ability of adenovirus preparations to infect patient cells and thereby introduce the desired genetic material. This assay is subject to much more variability than the particle number determination. In recent years, some sources of variability have been identified. The concentration and diffusion rate of adenovirus particles are two important parameters to consider [10]. Infectious titer assays utilize adherent cells sitting at the bottom of tissue culture dishes. Since adenovirus particles do not settle out of solution but instead randomly diffuse, the volume of material tested can have a profound impact on the apparent infectious titer. A recent initiative to develop an adenovirus reference material should lead to increased accuracy in both particle and infectious particle determina tions [11]. A reference material consisting of wild-type adenovirus 5 with a known particle and infectious titer will be produced and distributed. Com parisons between different adenovirus vector preparations within and between lots can be made using this reference material as an index to calibrate assays done in different places and at different times. VII. Characterization of Adenoviral Vector Final Products Testing of the final adenovirus vector product consists of safety test ing and product characterization. Such testing involves physical/chemical and biological assessments. Table IV provides a summary of the currently recom mended testing. Whereas production intermediates such as the MCB and MVB are subject to acceptance criteria, the final product characterization is subject to lot release and is recorded on a CoA with specified tests, methods, sensi tivities, and results. Some of the safety testing is similar to that done for the 2 1 . Testing of Ad Vector Gene Transfer Products 6 2 9 Table IV Characterization of the Final Product" Safety Product characterization Sterility Identity Mycoplasma • Restriction map, structural characterization Endotoxin Activity Adventitious virus^ • Transgene specific • In vitro virus Potency • AAV • Required by phase II/III • Replication-competent adenovirus Titer General safety • Particle count/infective particle ratio <30:1 • Required by time of licensure Purity • Cell substrate DNA <10 ng/dose, <100-200bpins ize • Cell substrate protein • Ancillary products • Process residuals ^The necessity for and specifications for each of these characterizations is assessed on a case-by-case basis and can change depending on the phase of product development and as a result of feedback from the numerous sources discussed above. Therefore, this list is intended to give the reader an overview of FDA oversight. However, consultation with CBER is strongly recommended before submission of an IND. ^These tests should be done on the unpurified bulk in order to maximize sensitivity and not deplete final product. MCB and MVB. Thus sterility and mycoplasma testing should be performed, as should testing for endotoxin levels in the final formulated product (LAL per 21 CFR 610.9 or pyrogenicity test 21 CFR 610.13(b)). Adventitious virus testing consists of the in vitro virus test, and tests for AAV and RCA. In general, an in vivo adventitious virus test is not recommended for final product. These adventitious virus tests should be performed on the unpurified bulk in order to maximize sensitivity and not deplete the final product. One other test that is required for licensed products is that of General Safety 21 CFR 610.11. The current recommendation for RCA is <1 RCA per 3 x 10^^ virus particles. Current recommendations for final product characterization are similar to those for MVB. However, identity (structural characterization) need not be done by DNA sequence analysis. Rather, other methods such as sensitive restriction mapping combined w îth Southern blot analysis or PCR mapping may be used to show that the final vector preparation is homogenous within the limits of the assays. The same activity assay used on the MVB can be used on the final vector preparation. Development of a potency assay that reflects the intended biological function of the vector preparation should commence as soon as possible during product development and should be in place by the end of Phase 2 or the beginning of Phase 3. Test methods, sensitivities. 6 3 0 Bauer ef a/. and specifications for lot release should be submitted as part of an IND submission. The number of particles and the infectious titer per unit volume should be measured and reported. Currently the recommendation is that the ratio of total particles to infectious particles in the final product should be no greater than 30:1. The previous recommendation of 100:1 was developed shortly after the first adenovirus vector trials v^ere initiated and has remained constant until recently. How^ever, review of data received in response to the March 6, 2000, letter to gene-therapy sponsors suggests that almost all adenovirus vector lots have a ratio of less than 30:1 particles to infectious particles. Advances in understanding of infectious titer assays and the development of an adenovirus reference material will be helpful in reassessing this recommendation in the near future. Product characterization should also include assessments of potential impurities such as production cell DNA and protein. If the cell line used for production is tumorigenic, current FDA recommendations for adenovirus vector products are that no more than 10 ng/dose of cell substrate DNA be present. In addition, the DNA that is present should be degraded to a size less than 100-200 bp in length. If these criteria are met, the need for tumorigenicity assays of the cell substrate is less pressing. The current recommendation for cell substrate protein is that the sponsor should measure and report amounts present in order to set lot release acceptance criteria by Phase III. If cell substrate proteins are present, their potential for immunogenicity should be considered. Other potential impurities should also be assessed in analysis of the final product. These include fetal bovine serum, other tissue culture reagents, antibi otics, process residuals such as CsCl, or column chromatography materials. Other tests that may be necessary include pH of the formulated final product, assessment of particulates, volume, and appearance. The necessity and extent of these tests should be discussed with FDA. All lot-release testing of the product should be summarized in a certificate of analysis that accompanies the vector product. A final consideration for product characterization is vector stability. Stability testing should be conducted on the final formulated, vialed product. In early phases of product development, stability testing should also assess procedures for shipping and handling of the final product. Stability testing should be initiated during Phase 1 and should be conducted according to a plan that has been discussed with the FDA. VIII. Preclinical Testing of AdenoviraE Vectors In the development of a new adenoviral vector for gene transfer, the preclinical pharmacology and toxicology programs are typically conducted 2 1 . Testing of Ad Vector Gene Transfer Products 6 3 1 in conjunction with the development of the product manufacturing. The overall purpose of preclinical animal and in vitro studies is to support the safety and rationale for use of the product in human subjects. Although not unique to gene therapy vectors in general, or more specifically, to ade noviral vector development, there are several basic goals to be achieved by preclinical testing v^hich contribute to the design and conduct of the ini tial clinical trials. These include, but are not limited to, (i) identification of dose(s) which confer the desired biologic effect; (ii) definition of a safe starting dose and escalation scheme; (iii) identification of pharmacodynamic mea sures of biologic activity; (iv) identification of safety and toxicity parameters to monitor in the clinical trial; (v) definition of inclusion and/or exclu sion criteria based on observed toxicities, and, finally, (vi) designated stop ping rules for the clinical trial based on the toxicity profile observed in animals. A. Pharmacologic Activity Initially, the pharmacologic activity of a proposed vector system is evaluated either in vitro or in vivo, as demonstration of "proof of concept." These studies are designed to determine the feasibility and efficiency of the gene transfer, and whether the biologic activity in correcting the genetic defect or conferring that the desired response is observed (e.g., multidrug resistance in hematopoietic stem cells). When available, animal models which mimic the human disease, either through genetic or pharmacologic mechanisms may be used as "proof of principle," to demonstrate that transfer of the gene is actually able to correct the genetic defect, ameliorate or slow progression of the disease, or alleviate some of its clinical signs or symptoms. Based on the responses observed in the preclinical pharmacology program, a decision is made by the investigators to either further evaluate the candidate vector for safety with the intention of entering it into the clinic or to terminate the development of potentially unsuccessful products. Preclinical pharmacology data are provided both to CBER in support of an IND application and to the NIH RAC in support of use of aden oviral vectors for gene transfer in several different clinical indications. Of the data which have been publicly reviewed and discussed, biologic activ ity of adenoviral vectors have been evaluated in murine tumor models and murineihuman tumor xenografts, transgenic mouse models of human dis ease (e.g., ornithine transcarbamylase deficiency), human cell xenografts in immunodeficient rats and/or mice, and in pharmacologically induced dis ease states in rodents, monkeys, and dogs. Advantages of using adenoviral vectors are their ability to transduce a variety of different, nondividing cell types, high levels of gene expression for relatively short durations of time, and a large enough capacity to carry relatively large, transgene sequences. 6 3 2 Bauer ef al. IX. Toxicology Testing A. Scope of Toxicity Testing The next step in the precUnical program for a candidate gene transfer vector is the toxicology testing. Prior to initial entry of a new drug or biologic agent into humans, the basis for the determination of in
vivo safety is the preclinical testing performed in animals. Toxicology studies to demonstrate safety of gene transfer vectors, including adenovirus, are intended to answer specific questions regarding the acceptable riskibenefit ratio to the patient, and provide an indication of what expected toxicities may occur on introduction of the product into humans. Traditional drug development programs, evaluating the safety of small molecule or protein therapeutics typically conduct toxicology testing in normal animals, using a well-defined paradigm to establish the acute, subchronic, and cumulative toxicities of an agent prior to its first use in man. At least two animal species are used for the initial demonstration of safety; typically, testing is done both in rodents (i.e., mice, rats, or hamsters) and one nonrodent species (i.e., dog, pig, or nonhuman primate). The advantages of this approach are that a wide range of doses may be investigated to give high multiples of the expected human exposure, the metabolism and disposition profiles in the different species may be established as a basis for comparison for the clinical dosing, and the background incidence of any specific, adverse findings may be well-documented in that particular strain of animal being tested. The use of more than one species in traditional drug evaluation programs is encouraged to increase the chance of detecting any toxicity expected for the clinical trial. Traditional toxicology programs, however, frequently are of little value in the determination of safety of gene transfer agents. For many of the vectors in development, the issues of species-specificity of the transgene product under study, as well as limitations in the doses that are feasible to administer and the interaction of the agent with its specific receptor must be taken into account in designing the safety program. In gene transfer research, demonstration of safety must also take into account toxicities due to both expression of the transgene, or the ultimate therapeutic agent, as well as any adverse effects associated with the vector, or delivery system used to introduce the foreign gene. Additionally, any underlying pathology associated with the disease being investigated may either exacerbate or confound any toxicity related to the gene transfer system. These points must be considered in designing a preclinical program to evaluate the safety and efficacy of a gene transfer agent. The FDA recognizes that novel issues exist in designing and interpreting preclinical studies for gene transfer vectors, and has provided several guidance documents to assist investigators in developing their preclinical programs. CBER's recently published guidance document provides a framework for the 2 1 . Testing of Ad Vector Gene Transfer Products 6 3 3 design of preclinical safety programs in gene therapy, based on the available data from both in vitro and in vivo efficacy models, as well any specific concerns for the clinical population planned for study [4]. The CBER document follows the guidance set forth by the International Conference on Harmonization S6 document, "Preclinical Safety Evaluation of Biotechnology-Derived Pharma ceuticals" (ICH S6). Although the ICH guidance does not directly address toxicology study design for gene transfer agents, many of the principles of this document apply [12]. In general, toxicity study design for gene transfer agents follows many of the principles set forth by ICH S6 regarding dose and species selection, route of administration, and study timing. Each of these points is addressed separately in the context of gene transfer, below. To understand the safety of gene transfer vectors, the design of preclinical studies should take into consideration the following points: (i) the class of vector to be administered, (ii) the animal species, gender, age, and physiologic state most relevant for the clinical indication and product class, and (iii) the intended doses, route of administration, and treatment regimens planned for the clinical trial. With many of the gene transfer vectors, these considerations will be dependent, as the route of administration or the maximal feasible dose for the preclinical study may be influenced by the species selected for testing, and vice versa. B. Species Selection The recent death of a patient while participating in a clinical trial of adenovirus-mediated gene transfer, as well as the finding that data in Rhesus monkeys using the same class of vectors and route of administration predicted many of the toxicities observed in this subject have highlighted the importance of preclinical data, and the relevance of the animal model in determining a safety profile for these agents. CBER's recommendations for selection of species for safety evaluation of adenoviral vectors have generally followed the guidance set forth by the ICH S6 document, taking into account the limitations of the animal model being tested. Preclinical pharmacologic and safety testing of vectors for gene transfer should employ the most appropriate, pharmacologically relevant animal model available. In contrast to traditional drug development programs, for many biologic products including gene transfer vectors, safety evaluation and toxicology testing in a single, relevant species is permissible prior to Phase 1 studies in the clinic. A relevant animal species would be one in which the biological response to the therapy would be expected to mimic the human response. Relevant animal species for safety evaluation may also be selected based on the clinical population intended for study and/or intended route of administration, or by the species-specificity of the transgene product. In some cases, the interaction of the transgene product with its specific receptor occurs only in humans 6 3 4 Bauer ef o/. and nonhuman primates, necessitating toxicology testing in monkeys. In many cases, however, the toxicities observed are independent of the transgene product (e.g., inflammatory reactions in response to adenovirus capsid proteins) and may be tested in rodent species or other small, nonrodent laboratory species. In other cases, specific information regarding the safety of a gene transfer approach may be obtained only in an animal model of the disease, in w^hich the underlying disease pathology can influence significantly the safety of the intervention. When evaluating the pharmacologic activity of a vector in an animal model of the clinical indication, it is recommended that safety data be gathered at the same time, in order to assess the contribution of disease-related changes in physiology or underlying pathology to the response to the vector. C. Route of Administration Most gene transfer studies, both in humans and in animals, are expected to involve either single administrations or a small number of repeat admin istrations over a short duration of time. CBER recommends that both the route of administration and the dosing schedule in animal studies mimic those intended for the clinical trial as closely as possible. However, there are issues specific to the gene transfer that need to be incorporated into the study design, for example, the persistence of gene expression following transduction of the target organ, which will impact upon the duration of the toxicity study. Another example would be the physical characteristics of the agent being stud ied (i.e., vector aggregation at high concentrations). The dose and the route of administration for the preclinical safety studies of cellular and gene therapies should mimic those intended for the clinical trial as closely as possible. It is understood, however, that some dosing techniques and/or regimens intended for the clinical trial may be difficult to achieve in a small animal species, such as a rodent. In these cases, a method of administration similar to that planned for use in the clinic is advised. For example, intrapulmonary instillation of adenoviral vectors by intranasal administration in Cotton rats or mice is an acceptable approach in lieu of direct intrapulmonary administration through a bronchoscope. D. Selection of Dose Current recommendations for dose selection for safety testing are based on those demonstrated in efficacy models to provide gene transfer sufficient for pharmacologic effect, as well as inclusion of doses with a likelihood of demonstrating toxicity. Dose selection should be based on preliminary activity data from studies both in vitro and in vivo. For the determination of safety, a no-observable adverse effect level dose (NOAEL), an overtly toxic dose, and several intermediate doses should be evaluated, to determine not only 2 1 . Testing of Ad Vector Gene Transfer Products 6 3 5 the dose relationship of the toxicities to the amount of vector administered and/or transgene expression, but also to evaluate the shape and steepness of the dose-response curve. Preclinical safety studies should include one dose equivalent to, and at least one dose escalation level exceeding, those proposed for the clinical trial. The multiples of the human dose required to determine adequate safety margins may vary w îth each class of vector employed and the relevance of the animal model to humans. Allometric scaling of doses based on either body weight or total body surface area as appropriate facilitates comparisons across species and allov\̂ s determination (retrospectively) of v^hether an animal model was predictive of toxicities observed in the clinic. For example, adenoviral vectors used in cystic fibrosis demonstrated very similar toxicities after direct instillation into the lungs of Cotton rats, mice, hamsters. Rhesus monkeys, and baboons (Table V). These toxicities included dose-related, perivascular, and peribron chiolar inflammation, mononuclear inflammatory cell infiltrates, pulmonary edema, and interstitial pneumonia. When the NOAEL doses were calculated for each species after scaling by total body surface area, with the exception of Rhesus monkeys, it was discovered that these values were remarkably similar between the different species. Additionally, when scaled by total body surface area, the NOAEL doses in mice. Cotton rats, hamsters, and baboons for direct instillation of adenovirus into the lungs were approximately equivalent to the human dose of 2 x 10^ lU, or 1.2 x 10^ lU/m^, which was the first dose in humans at which toxicity was observed, when scaled by body surface areas. Table V Allometric Scaling of Adenovirus Dose in Animals and Man Species Apparent NOAEL NOAEL (pfu/m^ surface area) C57B1/6 mouse 2.6 x 10^ pfu/mouse 2.4 x 10^ pfu/m^ Hamster 3.6 x 10^ pfu/hamster 1.7 x 10^ pfu/m^ Cotton rat 5 x 10^ pfu/rat 1.9 x 10^ pfu/m^ Rhesus monkey 2 x 1 0 ^ pfu/monkey^ 8.2 x 10^ pfu/m^ Baboon 7 x 10^ pfu/monkey 1.8 x 10^ p f u W Human 2 x 10^ pfu/patient 1.2 x 10^ pfuW^ Note. Cotton rats, mice, and hamsters were administered increasing doses of adenoviral vectors encoding the human CFTR gene by intranasal instillation. Baboons, Rhesus monkeys, and humans w êre treated w îth adenoviral vectors encoding CFTR via bronchoscopic instillation into an isolated lobe of the lung. Animals v^ere sacrificed 3 to 5 days after vector administration, and histologic sections of the lung were examined microscopically for evidence of inflammation [15]. The human data were obtained via chest radiograms and CT scans of a patient in a phase 1 clinical trial [13]. ^NOAEL not available; lowest dose tested with minimum pathology ^Toxic dose in humans, 2 x 10^ lU, or 1.2 x 10^ lU/m^. 6 3 6 Bauer ef o/. This finding allowed for a redesign of the clinical approach to gene therapy for cystic fibrosis, using smaller volumes for instillation of vector and a more targeted approach to deliver the adenovirus to the larger airway epithelial surfaces. To date, cystic fibrosis patients have been treated using two to three logs higher doses of adenovirus with this newer approach without the toxicities observed in the initial clinical trial [13]. In cases where gene transfer vectors may be in limited supply, or for vectors with inherently low toxicity, a maximum feasible dose may be admin istered as the highest level tested in the preclinical studies. In all studies, and especially when using animal models of the clinical indication, appropriate controls, such as naive or vehicle-treated animals should be included. This should allow determination of an adequate margin of safety for use of the vector in the clinical trial, as well as an acceptable dose-escalation scheme. X. Biodistribution One issue with direct administration of genetically modified cells or viral or other vectors is that the injected material may not stay where it is initially introduced. Therefore, localization studies designed to determine the distribution of the vector, or the trafficking of genetically modified cells after administration to the proposed site are incorporated into the toxicology test ing. These studies have two purposes: (i) first, to identify potential distribution of the vector to sites other than the intended target site, where presence of the vector and/or aberrant expression
of the transgene may lead to toxicity; and (ii) to evaluate potential distribution of vector to gonadal tissues and/or transfection of germ cells. In a discussion by the NIH RAC about the risk of potential, inadvertent gene transfer to germ cells, it was concluded that the risk of vertical transmission of the foreign gene was very small. A discussion by the RAC and several expert panelists in gene transfer or reproductive biology recommended that unless there were significant safety issues associated with either the vector or the transgene product, preclinical biodistribution studies in animals were not always required prior to initial Phase 1 trials. In addition, the panel concluded that in cases such as adenoviral vectors, where a large body of literature exists regarding their distribution and potential for toxicity, minor changes in the vector (e.g., substitution of a different transgene with no poten tial toxicity associated with it) did not require further preclinical distribution studies prior to initiating clinical trials [14]. Biodistribution studies, in which the disposition of the vector is detected after administration by the intended clinical route not only provide data regarding the potential for gonadal uptake and inadvertent germ-line gene transfer, but can also identify any target organs in which aberrant vector distribution or gene expression may be detrimental. CBER's current recommendation is that biodistribution studies of gene transfer agents are not always required prior to Phase 1 clinical trials; however, these 2 1 . Testing of Ad Vector Gene Transfer Products 6 3 7 studies should be incorporated into the drug development plan so that data are available prior to commencing large-scale, pivotal studies in the clinic [14]. Dose levels selected for biodistribution studies should foUovvr those used in the toxicity studies and include either vehicle or untreated control animals, and the route of administration should be relevant to that employed in the clinical trial. Transfer of the gene to normal, surrounding, and distal tissues as v^ell as to the target site should be evaluated using the most sensitive detection methods possible and should include evaluation of gene persistence. When aberrant or unexpected localization is observed, studies should be conducted to determine w^hether the gene is expressed and v^hether its presence is associated with adverse effects. Additional groups of animals may be treated intravenously, as a 'Vorst-case" scenario in cases v^here w^idespread vector dissemination may be expected to cause toxicities in organs other than the target site [15]. A. Good Laboratory Practices Preclinical studies in support of use of gene transfer vectors including adenovirus, in clinical studies should be conducted in compliance v^ith the regulations for Good Laboratory Practices (GLPs) as set forth in 21 CFR, part 58. Compliance v^ith these regulations is intended to assure the quality and integrity of the animal safety data used in support of human research studies, as v^ell as marketing approval. There is often some confusion as to w^hat types of studies need to be conducted under the GLP regulations. Preclinical pharmacology, "proof-of- concept," and efficacy studies in animals, as well as in vitro pharmacology studies are not expected to be conducted in full compliance with GLP. However, in vitro and animal toxicology studies, including single- and repeat-dose toxicity testing, reproductive toxicity and carcinogenicity studies, and, for gene transfer research, biodistribution studies are expected to follow the guidelines set forth by the regulation. Although studies for gene transfer vectors in early stages of clinical development need not be in full compliance with the GLP regulations (i.e., quality assurance audits, validation of test and other methodology may be omitted in early studies), CBER expects that any pivotal toxicology studies submitted to an IND or licensing application will be conducted under the auspices of GLP. XI . Introduction to Clinical Testing The goal of clinical testing is to provide information about the product's safety and effectiveness and, ultimately, allow new products to come to the marketplace. As discussed in the introduction to the precUnical section, the principles described below are neither unique to gene transfer vectors in general, nor to adenoviral vectors in particular. 6 3 8 Bauer ef aL A. Phases of Clinical Development Premarket clinical testing proceeds in a stepwise fashion, often referred to as Phases 1, 2, and 3 of clinical development, although the phases are not always discrete. Phase 4 studies are those performed after marketing. Each phase of product clinical testing has its series of goals or objectives. The primary goals of Phase 1 testing are to learn about the product's safety and pharmacokinetic profile and to identify a safe dose or doses for further study. Phase 1 studies involve small numbers of study participants who are closely monitored for the development of drug effects. A common Phase 1 design is a single dose, rising dose, cohort study. Escalation to the next dose cohort occurs after sufficient safety assessment of the proceeding cohort. The starting dose and dose escalation scheme employed depend on the data gleaned from product and preclinical testing, and other clinical data, if available (e.g., closely related products or same product studied in different populations). Dose escalation usually proceeds until a defined endpoint, such as a maximal tolerated dose, or an optimal biologic dose, is reached. Phase 1 studies for some drugs may be conducted in healthy volunteers. This approach is common when anticipated side-effects of the product are expected to be minimal and transient and the target population (those with the disease or condition of interest) have high background rates of adverse events, making it difficult to tease out the safety profile of the product. However, for many classes of drugs and biologicals, including adenovirus gene transfer products, the potential short- and long-term adverse effects (see section XIII) generally makes their risks unacceptable for testing in healthy volunteers. The next phases of clinical testing, Phases 2 and 3, build upon the information generated from the prior studies. The goal of Phase 2 testing is to gain preliminary evidence of the product's activity in the disease or condition of interest and to begin to characterize that activity. Phase 2 is the ideal time to optimize the dose and/or dosing regimen, the patient population, the response parameters that are most likely to reflect clinical benefit, as well to build upon the safety database. Phase 2 trials often are randomized, controlled, and conducted in multicenters. Phase 3 of clinical testing includes clinical studies to establish the prod uct's effectiveness. The number of efficacy trials, trial design(s), and size of the safety database necessary to determine net clinical benefit depend on a number of factors, including but not limited to the class of product under development, the condition or disease being studied, and the availability of other therapies. Phase 4 of clinical testing are studies conducted after market approval. Their purpose is to address questions that arose during the premarketing investigations, or to evaluate the product in other related setttings, such as the elderly, or people with more advanced stages of the disease. The design of a postmarketing study (such as a randomized controlled clinical trial or a registry) depends on the questions to be addressed. 2 1 . Testing of Ad Vector Gene Transfer Products 6 3 9 XII . Good Clinical Practices Good Clinical Practices (GCPs) are a set of principles and procedures intended to preserve and protect the rights and confidentiality of human research subjects and to assure, to the extent possible, that the clinical research generates valid scientific data. The origins of a code of conduct to protect human subjects in clinical research date back to the Nuremberg war trials and the Declaration of Helsinki. In 1996, the FDA, under the auspices of the Interna tional Conference on Harmonization (ICH), published the guidance document entitled: "E6 Good Clinical Practice (GCP) Consohdated Guideline." Basic principles of GCP will be discussed below; the reader is referred to the CBER website http://www.fda.gov/cber/guidelines.htm for the full document [16]. A. Responsibilities of a Sponsor and Investigators The sponsor oversees the IND and communicates with the FDA. As set forth in regulations at 21 CFR 312, subpart D, and in the ICH GCP guidelines, the oversight function includes selecting study investigators, reporting safety information to the FDA, and providing accurate and timely information to all investigators. In some cases, a sponsor may transfer all or some of its obligations to a contract research organization (CRO), although the sponsor retains ultimate responsibility for the IND. Clinical investigators also have specific obligations, delineated in 21 CFR 312, subpart D, and in the ICH GCP guidelines. Investigators are responsible for selecting study participants based on eligibility requirements of the protocol and for obtaining the protocol-specified evaluations. The investigator is responsible for the welfare of the study subjects at his/her clinical site. This includes collecting safety data and reporting safety information to the IND sponsor. The investigator also must account for all investigational medical product, maintain accurate records, provide annual updates to the Institutional Review Board (IRB), and obtain consent from all study participants. Where the sponsor and investigator are distinct, their separate roles, with the former overseeing the latter, incorporate the checks and balances that minimize bias and maximize patient safety and trial validity. These checks and balances may be lacking when the investigator is also the sponsor, and additional external oversight is advisable. Individual physicians who assume the role of sponsor, investigator, or sponsor/investigator should be familiar with guidances and federal regulations that set out the respective duties of the sponsor and the investigator. B. Adverse Event Reporting Adverse event collection and reporting is a fundamental aspect of drug development and of human subjects protection. The clinical investigator is the 6 4 0 Bauer et aL individual who identifies, evaluates, and documents adverse events experienced by study participants at his or her site and v^ho is responsible for updating the IND sponsor and the IRB as appropriate, as set forth in federal regulations (at 21 CFR 312.64). The sponsor is responsible for submitting safety information to FDA. The timing and reporting format will depend on the nature of the adverse event. The sponsor must report to FDA in writing all serious and unexpected adverse event information associated with the use of the investigational product within 15 calendar days of receipt of the information. Any unexpected life- threatening or fatal event associated with the use of the investigational product must be reported by telephone (or facsimile) within 7 calendar days of receipt of the information (as per 21 CFR 312.32). The telephone and written reports constitute expedited reports. Although causality assessment is integral to expedited reporting, a determination that a given investigational product caused or was associated with an adverse event in the course of a clinical study is not always possible. The most reliable way to assess the contribution of a test article to an adverse event is by comparing adverse event rates and severity in treatment and control groups. Randomized controlled trials, however, are infrequent in early phases of clinical testing. Although one cannot always be certain that there is a relationship between the administration of the study product and the adverse event, the level of suspicion required for reporting is quite low. Except if there is no reasonable possibility that the product caused or contributed to an unexpected serious adverse event, that event must be reported to the FDA according to specified time frames. The sponsor is also required to submit to the IND an annual report that includes a summary of the most frequent and the most serious adverse events (21 CFR 312). The ICFl guideline entitled "E3: Structure and Content of Clinical Study Reports" describes the manner in which safety data for individual studies should be organized and presented to regulatory authorities in marketing applications [17]. A marketing application includes an integrated summary of the entire safety experience for the product. FDA, as part of the ICH process, is developing a guideline entitled "The Common Technical Document for the Registration of Pharmaceuticals for Human Use" that addresses, among other items, formatting of integrated safety data [18]. Once marketed, a passive surveillance system allows for the continued collection and reporting of safety information [19]. For some products, such as ones that pose unique long-term risks, a more active type of postmarketing follow-up will be required. C. Consent and Vulnerable Populations In general, prospective participants cannot
be enrolled into a trial without their consent. Elements of the consent form and the consent process are set forth 2 1 . Testing of Ad Vector Gene Transfer Products 6 4 1 in 21 CFR part 50. Before consenting, study participants must be informed of known and potential toxicities that may occur from participation in a trial of an investigational product, even if the likelihood of toxicity is remote. The IRB at each institution participating in a study must reviev^ and approve the consent form and the clinical research protocol before the study can be initiated at that institution. The composition and duties of the IRB are described in the ICH GCP guidelines and in 21 CFR part 56. For some of the disorders that are targets of gene therapy, such as inborn errors of metabolism, the affected population v îll be pediatric subjects. Mechanisms exist to strengthen the human subject protections for study participants w ĥo may be particularly vulnerable, such as children, w ĥo cannot give valid consent [20]. When a child is to be enrolled in a research study, the parent or legal guardian consents (gives permission) for the child to be in the study. The FDA, as part of the ICH process, has published a guidance document that addresses clinical trials in children, including ethical issues [20]. In rare circumstances v^here it is not possible to obtain a participant's consent because of the nature of his or her illness or injury, and in which obtaining consent from a legally acceptable representative (e.g., next of kin) is not feasible, the FDA may permit the clinical trial to proceed with a waiver of consent, as set forth in 21 CFR 50.24. D. Moni tor ing and Audi t ing Monitoring and auditing are fundamental aspects of GCP. Although their purposes are similar (to assure appropriate trial conduct and data validity), the approaches differ. As stated in the ICH GCP document, monitoring is "the act of overseeing the progress of the cUnical trial and ensuring that it is conducted, recorded, and reported in accordance with the protocol, standard operating procedures, GCP, and applicable regulatory requirements." Medical monitors, usually employees of the sponsor, perform on-site (and, if indicated, off-site) evaluations of trial-related activities. The extent and frequency of monitoring should be appropriate for the length, complexity, and other particulars of the trial. Among the functions of the monitor is identification of deviations in protocol conduct so that the sponsor may take appropriate corrective steps, e.g., retraining investigators, closing out certain sites, etc. Auditing is defined in the ICH CGP document as "the systematic and independent examination of trial-related activities and documents." The audit is usually conducted at the conclusion of the trial. The sponsor may hire auditors who document findings in a written report to the sponsor. FDA field inspectors also conduct independent study audits. Traditionally, the purpose of the FDA audits has been to verify the data submitted to the FDA in support of a marketing application. However, the FDA and the sponsor may conduct "for cause" or directed audits at any stage of clinical investigation if there is reason to suspect a problem with trial conduct or data integrity. 6 4 2 Bauer et al. The FDA has performed directed inspections at a few gene therapy chnical sites since 1999. The agency also audited approximately 70 gene transfer clinical sites selected at random to assess whether systemic problems with the conduct of such clinical studies existed. Inspectional findings will be discussed in more detail in section XVI. An additional measure of human subject protection is use of a Data Monitoring Committee (DMC) to evaluate accumulating data from a clinical trial [22]. Generally, the sponsor establishes the DMC, including selecting the members and devising the charter. The DMC members should be independent of the sponsor and clinical investigators. The role of the DMC varies according to the charter and the nature of the study. The DMC is usually empowered to recommend study modifications to enhance safety of participants; in some cases, a DMC may recommend that a study be stopped if data indicate a major safety concern. Of note, DMCs review data submitted to them but do not visit sites to directly ensure that the data are accurate, the protocol is followed, consent is documented, etc. Thus, a DMC does not perform the functions of or obviate the need for study monitors. The FDA is in the process of developing guidance on DMCs. XIII. Clinical Safety of Adenoviral Vector Products Most of the completed and ongoing adenoviral vector clinical trials are early, uncontrolled trials. The absence of an internal control group limits the ability to draw definitive conclusions about the contribution of the adenovirus vector product to an adverse event. Despite this caveat regarding causality assessments, administration of replication defective adenovirus is associated with an acute cellular and cytokine mediated inflammatory response. Individ uals have experienced systemic reactions such as fever, chills, hypotension, and laboratory findings consistent with disseminated intravascular coagula tion, including thrombocytopenia. An overwhelming systemic inflammatory response, to which has been attributed, at least in part, the death of a volunteer in a trial of ornithine transcarbamylase (OTC) deficiency who received intra hepatic artery injection of a high dose of adenovirus-containing product, has not been observed in other clinical trials, including those that employ systemic administration of similar doses of adenovirus vector. See also discussion in section XVI. The route of administration appears to play a key role in determining the type of and occurrence of adverse events. Toxicities have been particularly prominent in organs that are the sites of adenovirus injection, including the lung, brain, and liver [13, 23, 24]. In addition to route of administration, other variables associated with the cHnical trial may influence the nature, frequency, and severity of an adverse event. Such factors include the adenovirus construct. 2 1 . Testing of Ad Vector Gene Transfer Products 6 4 3 transgene, dose, and frequency of product administration, and host factors such as the underlying disease, other comorbidities, and use of concomitant medications. A committee of experts convened to discuss adenovirus safety in December 1999 questioned the role of the transgene in the toxicity profile and suggested employing null adenovirus vectors as controls v^hen possible to tease out the relative toxicities of the transgene from the vector [25]. Preexisting antibody to adenovirus and/or the development of an anti body response foUow îng administration of an adenovirus-containing product may play a role in product safety, although a clear relationship has not been established [24]. The limited data available have not suggested a correlation between high baseline levels of neutralizing antibody and adenovirus toxicity (or activity). Moreover, in a study that involved repeat administration of an adenovirus-containing product, participants developed large spikes in serum levels of neutralizing antibody after the initial dose. How^ever, the toxicity pro files of the first and subsequent doses were similar, again suggesting a lack of correlation. It is important that clinical investigators continue to characterize the immune status of study participants at baseline and following adenovirus vector administration, and attempt to correlate adverse events with levels of or changes in antibody titer. Ultimately, such information could be utilized in patient selection criteria or in clinical monitoring to enhance safety and effectiveness. The long-term safety of gene transfer is under active discussion. Con cerns about late adverse sequelae such as new malignancies occurring years or decades following administration of replication-competent, integrating viruses resulted in FDA guidance regarding testing for replication-competent retrovirus (RCR) in product and patient's serum and for lifelong clinical monitor ing [26]. These recommendations are currently limited to retroviral vector INDs. Although adenovirus can become replication competent, the FDA had not previously recommended that patients exposed to this class of product be followed long term. Long-term follow-up of gene therapy products was discussed at recent meetings of the Biologies Response Modifier's Advisory Committee [8, 9, 9a]. FDA will revise the recommendations for long term fol low up of recipients of gene transfer products including adenovirus-containing products, pending additional public discussions. XIV. Bioactivity of Adenoviral Vector Products A goal of Phase 2 testing is to determine if the adenovirus containing product is bioactive and, if so, to determine whether the observed activity findings, together with the safety profile, warrant further clinical testing. Bioactivity measures may be laboratory findings, clinical outcomes, or a combination of the two. One measure of bioactivity for gene therapy products is detection of gene transfer and gene expression. This may not be possible 6 4 4 Bauer ef a/. where assays for the transgene are not yet developed or are insensitive to low levels of expression. Documentation of clinical or surrogate outcomes and/or alternative assessments (e.g., pharmacodynamic measurements), and correlations, if any, to levels of gene expression, are highly desirable in early product development. The extent to which the generation of such data will be feasible depends on, among other factors, the nature of the product, the clinical population in the study, and the state of the science regarding assays to detect the transgene. The majority of the clinical investigations with adenoviral vectors to date target patients with cancer. In the oncology setting, studies that are in Phase 2 of development are usually designed to capture data on tumor responses (complete and partial response rates). The demonstration that the adenovirus gene therapy product results in a certain level of tumor response, and the characterization of those responses (rates of complete and partial responses, duration of response, etc.), along with an acceptable safety profile, will usually be sufficient evidence of activity to warrant efficacy trials. Early studies of cystic fibrosis (CF) involved topical administration of the adenovirus product containing the cystic fibrosis transmembrane regulator (CFTR) protein gene to the nasal epithelium. Measures of product activity included gene transfer/gene expression and assessment of the potential differ ence across the nasal epithelium. Topical administration resulted in only low levels of gene transfer and limited pharmacodynamic affects. Gene transfer via aerosolized delivery systems appeared to be marginally improved over topical administration. Given the limited product bioactivity that has been seen, clin ical development of adenovirus containing products for CF has largely been abandoned. An evolving area of clinical research is use of adenoviral vector products that contain genes intended to promote vascular growth. Patients enrolled gen erally have vascular disease. Studies are ongoing in both cardiac and peripheral vascular disease settings. The activity measures can include laboratory measures such as myocardial perfusion, and measures of gene expression. XV. Clinical Efficacy of Adenoviral Vector Products FDA grants market approval for products that are shown to be safe and effective. The efficacy standard, applicable to all FDA-regulated products, as stated in section 505(d) of the Food, Drug, and Cosmetic Act, is substantial evidence^ defined as "evidence consisting of adequate and well-controlled investigations, including clinical investigations, by experts qualified by scientific training and experience to evaluate the effectiveness of the drug involved, on the basis of which it could be fairly and responsibly concluded by such experts 2 1 . Testing of Ad Vector Gene Transfer Products 6 4 5 that the drug will have the effect it purports or is represented to have under the conditions of use prescribed, recommended, or suggested in the labeling or proposed labeling thereof." The follov^ing paragraphs address the issues of the quality and quantity of clinical investigations that can provide "substantial evidence." A. Choice of Control An "adequate and w êll controlled" investigation is one w^hose design and execution produces valid scientific data. Clinical investigations intended to show^ efficacy must be controlled so that the effect(s) of the intervention can be distinguished from other influences, such as spontaneous change, placebo effect, or biased observation. In Phase 2 testing, controlled trials are helpful in teasing out adverse events and in assessing the magnitude of the effect relative to the control group. Such information will be useful for sample size calculations for the efficacy trial(s). The choice of control (e.g., historical, active, placebo, etc.) depends on the clinical setting. The agency has approved products for market based on studies with various types of control groups. Each type of control has its advantages and limitations. The reader is referred to the ICH guidance entitled "ElO Choice of Control in Clinical Trials" for an extensive discussion on this
topic [27]. A control for an adenoviral-containing gene transfer product could be the adenovirus vector without the transgene (i.e., containing a null vector) as discussed previously. Such a null vector control could help delineate safety and efficacy of the vector separately from the insert, as well as show that both vector and insert contribute to product effectiveness. A null vector control, if deemed appropriate, could be incorporated earlier in product development (rather than during Phase 3) as it might be beneficial to determine early on the contribution of and need for the transgene. Adenovirus products are currently in Phase 3 testing in patients with malignancies. Most are designed as "add-on" trials, i.e., chemotherapy 4- gene product vs chemotherapy + placebo (or no additional treatment if a placebo is not feasible). If a trial is not blinded, such as would be the case if the control arm could not receive a placebo, it will be important to utilize objective outcome measures and to control use of concomitant therapies. If measures are not objective, blinded third party assessors may be useful. B. Endpoint Selection Trials intended to provide substantial evidence of efficacy must be "ade quate" in addition to "well-controlled." They must be conducted according to GCPs (as discussed in section XII) to maximize human subject protection and data validity. They must also be designed with appropriate, relevant endpoints that either reflect clinical outcomes or are acceptable surrogate endpoints. 6 4 6 Bauer ef o/. Surrogate endpoints are laboratory or other measurements not directly indicating clinical benefit but that are expected to correlate with or predict clinical benefit. Surrogate endpoints are usually easier to measure than clinical endpoints and occur earlier in the course of the disease, allowing for shorter, smaller, and, thus, less expensive studies. Their major disadvantage is the uncertainty surrounding whether and to what extent the surrogate reflects the true clinical benefit. Thus, if FDA bases important regulatory decisions regarding product licensure on a surrogate and the medical community bases practice decisions on data generated from trials using surrogates, it is critical that the surrogate be valid for the particular treatment and disease. Once a surrogate is validated for one treatment and disease using a particular product, the extent to which that validation applies to other products in the same class and across product classes could become important, particularly as one might define a product class in the context of adenoviral-containing products. In earlier phases of clinical testing, use of surrogate endpoints may serve useful and potentially less problematic roles. For instance, during product development, a surrogate may be used to assess dose-response and thus provide the rationale for dose selection for later trials, or they may be used as initial proof-of-concept to base decisions about further clinical development. Several excellent papers provide more in-depth discussions about surrogates and validation of surrogates [28, 29]. Where the disease is serious or life threatening and without acceptable alternatives treatments, it may be possible to establish efficacy and receive FDA approval based on trials employing a surrogate endpoint that is not yet validated but reasonably likely to predict clinical benefit. If a product is marketed based on an effect on such a surrogate endpoint. Phase 4 studies are required to verify the clinical benefit. These provisions are set forth in 21 CFR 601.40, subpart E. Oncology and AIDS are two areas where this provision has been used with some frequency. The number of adequate and well-controlled trials that will be necessary to make a determination of substantial evidence of effectiveness has been discussed in FDA guidance [30]. Sponsors should meet with the agency at the end of Phase 2 and discuss and reach agreements about critical product development issues, such as the number and types of clinical trials and the size of a safety database considered necessary to file a marketing application. XVI. How the Role of FDA Regulators Has Changed Since September 1999 In mid-September 1999, a participant in a clinical study of an adenovi ral vector product for Ornithine transcarbamylase (OTC) deficiency became profoundly compromised and ultimately died 4 days after receiving the 2 1 . Testing of Ad Vector Gene Transfer Products 6 4 7 experimental product by intrahepatic artery infusion. This event was the first death in a chnical gene transfer trial that was clearly directly attributable to the administration of a vector and resulted in a number of regulatory actions, as well as a commitment by the FDA to increase sponsor outreach programs to address issues related to the safety of all gene transfer vectors, including adenovirus. These efforts have included (i) safety symposia held in conjunction with the Office of Biotechnology Activities (OBA) at the National Institutes of Health (NIH); (ii) the FDA's issuance of a letter on March 6, 2000, to all gene therapy sponsors, requesting that they provide information regarding the oversight of their programs, including the manufacturing, animal data, and any ongoing or future clinical trials; (iii) targeted inspections of clinical sites for compliance with gene transfer protocols conducted at their site; and (iv) increased sponsor education and training in issues specific to gene transfer, as well as the conduct of clinical trials, in general. A. Safety Symposia in Conjunction with OBA Following the death of the study participant discussed above, the OTC trial was immediately placed on clinical hold, and the FDA initiated a search of its database to identify all protocols involving adenoviral vectors used for therapeutic intent. A total of 12 protocols were identified which used adenovirus administered by either systemic or intrahepatic artery infusion, or by direct injection into the liver. The sponsors of these protocols were informed of the death of the patient in the OTC trial and were asked to provide an assessment of the safety and toxicity of their adenovirus clinical studies, including the maximal dose of vector administered to date. After review of the information provided by these sponsors, one other clinical trial, using adenovirus encoding a tumor suppressor gene and administered by the same route of injection but at a higher dose than the OTC vector, was placed on clinical hold pending receipt and review of the safety data for that specific trial. The NIH OBA issued a call for investigators to submit safety information from all adenoviral vector clinical and preclinical studies. On December 8 and 9, 1999, OBA held an open, public symposium whose purpose was to exam ine the available scientific, technical, and clinical data regarding adenoviral vectors in gene transfer, to identify specific safety issues that were unique to adenovirus, and to make recommendations to the gene transfer community where additional clinical or preclinical data should be required. Investigators from both industry and academic settings presented information regarding the biology, pathophysiology, and toxicities associated with adenovirus infection, both by the natural route of infection as well as by the different approaches used in the gene transfer research studies. Both preclinical study results and data from human subjects in adenovirus-vectored trials for cystic fibrosis, oncology, and metabolic disorders were discussed, with the majority of the clinical data coming from studies in the oncologic setting [25]. 6 4 8 Bauer ef a/. In general, comparison of the data across the different settings revealed that the toxicities associated with adenovirus, whether in animals or in human subjects were very similar, and consisted mainly of local, dose-related, and dose-limiting inflammatory responses and immune cell activation. These find ings were consistent, whether the virus was administered by bronchoscopic instillation to the lungs, by direct injection into a localized tumor, or by systemic administration. Patients treated with adenovirus vectors at very high doses were found to exhibit some signs of clinical toxicity similar to those observed in the patient at University of Pennsylvania; however, there was no other incident of death attributable to the vector, even in the study where doses higher than that used in the OTC trial were administered by intrahepatic arterial infusion. Based on the results presented and the discussion at this symposium, a working group on adenovirus safety and toxicity (Ad-SAT) was con vened by OBA, composed of clinicians and scientists from FDA, industry and academia. The recommendations from this group were presented at the close of the safety symposium, and included the need for additional information regarding adenovirus vector standardization, biodistribution in human subjects as well as in preclinical studies, and the construction of a database which would include both preclinical data which could predict expected toxicities for the clinic, as well as data from human subjects which would allow comparison of the safety across a number of different settings. The findings and recommendations of the Ad-SAT and RAC were recently pubHshed [30a]. OBA and FDA have also cosponsored three additional safety symposia on clinical trials for gene transfer since the December 1999 meeting. These have included discussions of safety issues involved in development of helper- dependent adenoviral vectors and in clinical programs of gene transfer for cardiovascular disease, as well a recent discussion of the potential tumorigenic- ity of adeno-associated viral vectors in mouse models of human ^-glucuronidase deficiency. B. Results of FDA's Directed Inspections In the weeks following the death of the patient in the OTC study, the FDA conducted a directed inspection of the clinical site and the Institutional Review Board at the University of Pennsylvania, as well as an inspection of the animal experiments conducted in support of the clinical program. All three inspections found deviations and deficiencies, including inadequate clinical monitoring and oversight of the clinical trial, inadequate reporting of adverse events, and failure to follow clinical and preclinical study protocols. As a result of these directed inspections, the FDA placed the remainder of the clinical studies under the same sponsorship on clinical hold and issued warning letters 21 • Testing of Ad Vector Gene Transfer Products 6 4 9 to the sponsor, to all of the clinical investigators involved in the OTC trial, and to the director of the preclinical laboratory facility. The FDA also issued a Notice of Initiation of Disqualification Proceedings and Opportunity to Explain (NIDPOE) Letter to the principal investigator. Redacted versions of these letters are available at the CBER w^ebsites [31, 32]. A second clinical inspection of a different site, using a different class of vector for gene transfer in cardiac and peripheral vascular disease also found numerous discrepancies in the conduct of the clinical trials and compliance with the regulations governing investigational new agents [31]. As a result of these two inspections, the FDA determined that a more systematic review of procedures to ensure compliance with regulations was warranted. This was accomplished by two specific activities. In March of 2000, the FDA issued a letter to all Gene Therapy IND or Master File sponsors requesting information on the gene transfer product characterization, a review of the preclinical safety studies to ensure any findings that met the criteria requiring an expedited report as per 21 CFR 312.32-33 were submitted, and a summary of the procedures to ensure adequate monitoring and adequate oversight. A copy of the March 6, 2000, letter is available at http://www.fda.gov/cber/genetherapy/gtpubs.htm. In April 2000, the FDA initiated a series of inspections of clinical sites conducting trials in gene transfer research. At the time, CBER had 211 active gene transfer IND submissions; a random sample of 30 INDs was taken and the principal investigators and clinical sites were identified. From these 30 INDs, 70 sites were identified for inspection to determine their level of compliance with the current regulations. A summary of the results of the March 6 letter and the additional site inspections is provided below. C. Description of the March 6, 2000, Letter and Summary of Responses The March 6, 2000, letter was sent to approximately 150 sponsors holding slightly less than 300 total active INDs or master files. Items 1-5 of the letter were questions regarding product testing and characterization data, test methods, specifications, information regarding other products produced in the facility, and quality control procedures. The goals were to: (i) ensure that all gene therapy products currently in clinical trials are adequately tested by contemporary standards, (ii) determine where testing requirements need to be made more stringent or relaxed, (iii) gather information to aid in development of additional guidance, (iv) gain information concerning product characteri zation and manufacturing processes and arrangements in order
disease. The future widespread apphcation of gene therapy requires gene expression in the targeted cells or tissue. Gene expression means the successful accomplishment of gene delivery, which is most efficaciously accomplished with a gene-therapy vector. In their December 1995 report, Orkin and Motulsky identified shortcomings in all gene-therapy vectors, including a lack of quan titative assessment of gene transfer and expression [1]. Noninvasive imaging specifically addresses the latter issue and can advance the testing of enhanced gene-therapy vectors by providing information on the in vivo location of vector delivery, as well as the extent and magnitude of gene transfer and expression. In addition, the consequences of the gene expression can be eval uated, such as the production of specific enzymes or metabolites, induction of apoptosis, or measurement of tumor shrinkage. While imaging of gene transfer has not yet been approved for routine human applications, several groups have reported systems for detection of gene transfer in animal models. The purpose of this chapter is to provide an overview of current imaging technologies and their scientific bases, with emphasis on those technologies that are applicable to gene therapy. Finally, the current imaging literature will be reviewed with respect to imaging gene therapy vectors, especially adenoviral (Ad) vectors. ^ Corresponding author. Supported by NIH Grant CA80104. ADENOVIRAL VECTORS FOR GENE THERAPY ^ C C Copyright 2002, Elsevier Science (USA). All rights reserved. 6 5 6 Zinn and Chaudhuri II. What Information Is Provided by Imaging? Noninvasive imaging technologies have become increasingly important over the past 20 years in the management of human diseases. Diagnostic radiology is the medical specialty that is responsible for imaging, providing critical information in three general areas, namely (i) anatomy/blood flov ,̂ (ii) metaboUsm, and (iii) receptor expression. The first area is the most v^idely applied in terms of the number of studies. This type of imaging affords an opportunity to detect the abnormality, since many conditions result in the disruption of normal anatomy, function, or blood flow. One example is the detection of a mass in an abnormal location on a chest radio graph, which, with further tests leads to a diagnosis of cancer. Another example is the identification of fractures following traumatic injury, or decreased bone density resulting from osteoporosis. These basic radiol ogy techniques remain an important component of disease management. They are routinely accomplished by radiography and angiography, computed tomography (CT), magnetic resonance imaging (MRI), and ultrasonography (US). Less frequently, gamma-ray imaging (especially PET) studies assess blood flow. Metabolism is the second general area that can be assessed by noninvasive imaging. This category includes the evaluation of organ function. Examples include noninvasive imaging to assess heart perfusion under stress, gastric emptying, ventilation/perfusion of the lung, renal and liver function, and blood flow to the brain. Metabolite imaging is a further example, since magnetic resonance spectroscopy (MRS) techniques now detect altered metabolites in disease processes. Another aspect of metabolism that can be assessed is energy utilization. The increased metabolic rate of cancerous tissue relative to normal tissue can be imaged using radioactive probes that accumulate in areas of higher metabolic activity. These studies are accomplished by administration of a radioactive drug; the increased uptake of the radioactive drug in the cancerous lesion is imaged with gamma-ray detection instruments. In a similar manner, the glucose or fatty acid metabolism in myocardium can be evaluated following ischemic injury. The third area that can be assessed by noninvasive imaging is that of receptor expression. While receptors may potentially be assessed with MRI, the most success to date has been demonstrated using radioactive, gamma- emitting drugs followed by imaging with gamma-ray detection instruments as described above. This area represents the latest evolution in imaging; it is often described as "molecular imaging" since disease-specific receptors are detected. One example is the application of somatostatin receptor imaging for detection of neuroendocrine tumors. This recent capability is possible due to in vivo accumulation of a radiolabeled peptide with high affinity for somatostatin receptor expressed on the surface of the tumor cells. Another 22 . Imaging Adenovirus-Mediated Gene Transfer 6 5 7 example is detection and measurement of dopamine receptors, which become ahered in Parkinson's disease. Molecular imaging represents a growth area for radiology, and promises to allow early detection and monitoring of disease response during therapeutic intervention. III. Scientific Basis for Imaging A. Electromagnetic Energy In general, all imaging technologies require the use of electromagnetic energy. Each imaging modality exploits a different part of the electromagnetic energy spectrum. The spectrum includes gamma rays. X-rays, visible light, ultrasonic waves, and radiowaves. All of these waves are photons of energy, but they differ in their wavelength and, therefore, energy. Each imaging instrument is designed to detect a particular range of electromagnetic energy. Most often, the instrument also generates the requisite energy for the imaging application, and the detection occurs after interaction with the imaging subject. The exception is with gamma-ray imaging, where the requisite energy is provided by decay of an administered radioactive probe that is not part of the instrument. B. Contrast All imaging technologies require contrast in order for images to be produced. In the case of gamma-ray imaging, the contrast is provided by the localized accumulation of the radioactivity. In the case of radiography, the bone and soft tissues attenuate the X-rays to a different degree, which leads to contrast. Contrast is achieved in magnetic resonance imaging because the local environment of the proton is different in fat, water, and the soft tissues. With US, contrast is achieved because the reflectance of the ultrasonic wave is dependent on the tissue architecture or blood flow. Contrast for light-based imaging is provided by localized light emission or fluorescence. Contrast for radiography, CT, MRI, and US can be increased by administration of an exogenous contrast-enhancing agent. Angiography is always better with a contrast agent, whether done by fluoroscopy, CT, or MRI. C. Gamma Rays and Detection In the electromagnetic energy spectrum, the highest energy photons (shortest wavelength, highest frequency) are gamma rays. Gamma rays arise out of nuclear events during radioactive decay. For in vivo imaging purposes, the best gamma rays are of low energy, in the range of 100-511 keV. Gamma rays in this energy range can be efficiently stopped and therefore measured 658 Zinn and Chaudhuri by external detectors. Approximately 80-90% of nuclear medicine imaging is accomplished using radioactive ^^"'Tc, which emits a 140-keV gamma ray during its radioactive decay. ^̂ ^̂ Tc has a 6-h half-life and is continuously available from regional nuclear pharmacies. It is the decay product of ^^Mo (half-life = 66 h) and is eluted daily from the ^^Mo/^^"^Tc generator system and therefore available at very high specific activity and low cost. ^^"^Tc is chelated (complexed) with various compounds that have different biological characteristics. A typical mobile Anger gamma camera for planar imaging is shown in Fig. lA. Gamma camera imaging requires the use of a collimator, a solidly constructed gamma-ray attenuator (usually made from lead) that is placed between the subject and the gamma-ray detector. There are various types of collimators, some more specific for low-energy gamma rays, while other are specific for higher ranges of gamma-ray energies. A pinhole coUimator and parallel-hole collimator is shown in Figs. IB and ID, respectively. The pinhole collimator has a small round hole at the end (inset, Fig. IC) that allows projection of the gamma rays onto the detector crystal, thus forming an image like a pinhole camera. In contrast, the parallel-hole collimator allows passage Figure 1 Gamma camera and collimators. (A) Anger 4 2 0 / 5 5 0 mobile radioisotope gamma camera (Technicare, Solon, OH); (B) gamma camera detector head with the pinhole collimator; (C) close-up of the pinhole; (D) gamma camera detector head with the high resolution parallel-hole collimator. The gamma camera has one detector head; the collimators are changed for the particular application. 22. Imaging Adenovirus-Mediated Gene Transfer 659 "^^^^xm Detector Crystal Figure 2 Diagram showing cross-section of the detector head with a mouse in position for imaging. (A) Imaging with a parallel hole collimator; (B) imaging with a pinhole collimator; (C) data acquisition computer (NumaStation, Amherst, NH) showing collected images. A gamma ray is depicted in A and B passing through the collimators and interacting with the detector crystal (1), leading to production of light that is detected by the photomultiplier tubes. of gamma rays that are perpendicular to the plane of the collimator. Figure 2 presents a diagram illustrating a cross section of the gamma camera equipped with either a high-resolution parallel-hole collimator or a pinhole collimator. The mice are in position for imaging and were previously injected with a compound called methylene diphosphonate labeled with ^^mj^ (^^"^Tc-MDP). This compound localized in areas of bone with high osteoblastic activity by 4 h after intravenous injection; The gamma rays emitted from the animal are stopped by the detector crystal (Fig. 2, "1") and visible light photons are emitted. These photons are captured by the photomultiplier tubes adjacent to the crystal and converted to a voltage pulse. The X, Y location of the interaction event is recorded, as well as the magnitude of the voltage pulse (Z, pulse height), which is proportional to the energy of the gamma ray that was stopped. The gamma camera in this example has an intrinsic spatial resolution of 3 mm; therefore, individual vertebra of the mouse were not detected separately. However, uptake in the spine and knee joints is clearly visualized. Additional examples of ^ "̂̂ Tc complexes for human imaging include 99mYc-JV[AG3 (mercaptoacetyltriglycine) for imaging renal function and 660 Zinn and Chaudhuri ^^"^Tc-HMPAO (hexamethylpropyleneamineoxime) for imaging blood flow in the brain. Peptides and antibodies radiolabeled with ^ "̂̂ Tc are also approved for human imaging applications. Most often, the 99mj^ \|g attached to protein with a bifunctional chelater. With this system one part of the chelator binds 99mj^ in stable conformation, while a second part is used for attachment of the complex to the protein. Besides ^^"^Tc, other radionuclides that are used for imaging include ^^Ga, ^^^In, ^^^I, and -̂̂ Î (see Table I). These radionuclides have different gamma-ray emissions; simultaneous imaging with 99mj^ is possible. Multi-gamma-ray imaging is one feature that differentiates gamma camera imaging from PET. The latter is limited to detection of positron annihilation events, and therefore radionuclides lacking positron emission are not detected. The image presented in Fig. 2 is a planar image that represents a two-dimensional distribution of the ^^"^Tc-MDP at 4 h after intravenous injection. Single photon emission computed tomography (SPECT) is also possible with specialized gamma cameras that are routinely available in nuclear medicine departments. SPECT is accomplished by collecting multiple images (or projections) at various angles around the subject; the gamma camera usually moves. A tomographic image of the distribution of the radioactivity is produced following reconstruction of these projections. The typical spatial Table I Radionuclides Commonly Used in imaging Gamma-ray (keV) Imaging Radionuclide Decay mode" Half-life (Abundance) application "c H 20.38 min 511 PET 1 3 N P + 9.96 min 511 PET " O 18p n 122 s 511 PET H 109.8 min 511 PET -̂̂ Cu EC 4 1 % ,, H 12.7 h 511 PET 19%, p - 40% 1345 (0.48%) ^^Ga EC 3.26 days 93 (37%), 184.6 Gamma (20.4%), 393.5 camera (4.6%) 99m-[-^ IT 6 h 140 (89%) Gamma camera i"ln EC 2.83 days 171.3 (90.2%), Gamma 245.3 (94%) camera 1231 EC 13.2 h 159.1 (83%) Gamma camera 124j H 2 5 % , , EC 40% 4.15 days 511,602.7(61%) PET 131j P- 8.04 days 364.5 (81.2%) Gamma camera ^P—, beta minus (electron emission); p+, beta plus (positron emission); EC, electron capture; IT, isomeric transition. 22 . Imaging Adenovirus-Mediated Gene Transfer 6 6 1 resolution provided by clinical SPECT imaging is on the order of 1 cm^ [2, 3]. New methods for animal imaging are able to accomplish both planar and SPECT imaging at a spatial resolution of 1 mm^ and better [4-6]. Many new generation gamma cameras also include solid-state detectors, which eliminates the need for the photomultiplier tubes. PET is an alternate three-dimensional imaging technique for the indirect detection of positrons. Positrons are positively charged electrons that are emitted from a proton-rich nucleus during radioactive decay. The lifetime of positrons is relatively short since they undergo annihilation by combining with an electron, giving
rise to two 511-keV gamma rays at opposite (180°) orientations. The 511-keV gamma rays are actually detected in PET, not the positrons. PET scanners have a circular array of detectors that are designed to operate in a coincidence mode. This means that a signal is generated only when two detectors at opposite orientations simultaneously detect the 511-keV gamma rays, arising from the positron annihilation event. Since various 511- keV pairs of photons strike different pairs of detectors, the location of the actual decay events can be determined when the image is reconstructed. PET scanners do not require collimators, since the coincidence circuitry accomplishes the same objective. In recent years, dual-head gamma cameras have been designed with coincidence circuitry, thereby enabling gamma cameras to conduct PET imaging studies. The volumetric resolution of clinical PET scanners is approximately 0.4 cm^ [7, 8]. A new small animal PET scanner (MicroPET, Concorde Microsystems, Knoxville, TN) is reported to have a spatial resolution of 1.8 mm and volume resolution of 8 mm^ for in vivo imaging [9]. This latter system represents a significant advancement in small animal imaging, since improved spatial was needed for detection of individual organs in mice. Radionuclides that are used in PET imaging are proton rich and produced at cyclotrons using charged-particle reactions. A list of common PET radionuclides is included in Table I. Most PET radionuclides have short half-lives; therefore, production must be in close proximity to where imaging will be done. In addition, PET radionuchdes such as ^^C, -̂̂ N, and ^^O are suitable as intrinsic labels for many molecules, thereby enabling imaging studies of the actual molecule of interest. For example, fatty acid metabolism could be imaged with the ^^C-labeled fatty acid, where the ^^C replaced the normal ^^C in the molecular structure. Intrinsic labeling of this type cannot be accomplished with ^^"^Tc, since the radionuclide is not part of the molecule. A bifunctional chelate would be required for the ^ "̂̂ Tc to attach it to the fatty acid, and a ^^"^Tc-labeled fatty acid might have different in vivo uptake and elimination characteristics than the natural fatty acid. D. Light-Based Imaging and Detection Visible light has a wavelength between 400 and 700 nm, while the near- infrared region is from 700 to 1000 nm. Light in the near infrared is better 6 6 2 Zinn and Chaudhuri for in vivo imaging, since it penetrates the tissue more readily. For light-based imaging, contrast is achieved by at least three mechanisms. A specific color can be produced due to transfer of an enzyme (e.g., p-galactosidase) that reacts with a substrate to produce a colored product. A second mechanism is provided by fluorescence, excitation at one wavelength, with simultaneous detection at another wavelength. Special filters are employed to block detection of the excitation wavelength, thereby reducing the background for better contrast. Spectral imaging [10] and hyperspectral imaging [11] are technologies recently developed, while data processing for optical imaging is also improving [12, 13]. New fluorescence techniques use quenched substrates, which become fluorescent (unquenched) after activation by a specific process. Finally, light emission by enzymatic reaction can be achieved following expression of the gene encoding for luciferase. In vitro light detection instruments include microscopes, fluorescence-activated cell sorters, and fluorescence-based plate readers. In vivo light-based imaging can be accomplished with fluorescent stereomicroscopes and light-tight boxes with CCD cameras. A commercial instrument for luciferase imaging is also available from Xenogen, Inc. (Alameda, CA). E. Magnetic Resonance Imaging and Spectroscopy The proton is the element responsible for the signal generation in proton MRI, and can be viewed as a minimagnet due to the spinning single electron. MRI utilizes two energies, a strong magnetic field and pulses of radio frequency (RF) electromagnetic energy. RF energy is not ionizing, and a trillion times less in magnitude than X-rays. The sensitivity of the technology is related to the large number of protons that are present in water and fat, the primary constituents of a human or animal. When protons are placed in a magnetic field, they become aligned with, or opposed to, the external field. Excitation with a precise resonance frequency (MHz) results in excited-state protons, all of which are in phase, but tilted away from the direction of the external magnetic field. The "in-phase" aspect is unique to the excited state, since ground-state protons are not in phase. Therefore, to summarize, absorption of a resonance RF energy by the proton results in an excited state, where all the excited-state protons are in phase. When the RF excitation is stopped, the excited protons "relax" and emit resonance RF energy in proportion to proton density. This is the MRI signal and is analogous to phosphorescence for light. The relaxation of the excited protons is also referred to as the spin-lattice relaxation, which is the time for the protons to realign with external magnetic field. The time course is described by an exponential equation that includes a constant (Tl). The protons also "dephase" at an exponential rate, which is referred to as spin-spin relaxation. This decay of signal is also described by an equation that includes another constant (T2 or T2''' time constant). The important fact 22 . Imaging Adenovirus-Mediated! Gene Transfer 6 6 3 is that the magnitude of both Tl and T2 depend on the tissue (local proton environment) and therefore contrast is achieved in MRI due to this difference. MRI contrast agents exert their effects by modulating Tl and T2 in the local environment of the contrast agent. In other w^ords, the enhanced contrast provided by an MRI contrast agent is not related to signal generated by the contrast agent, rather the effect of the contrast agent on the local protons. In this respect, the mechanism of the MRI contrast agent is different from an X-ray contrast agent. The latter causes contrast due to higher absorption of the X-rays. Overall, the in vivo spatial resolution of MRI is superb, reaching a voxel resolution of about 50 [xm^. Typical clinical MRI instruments have a magnetic field strength of 0.5-2 Tesla. MRS represents a specialized capability of magnetic resonance technology. MRS is not concerned W\t\\ T l and T2 times constants, rather with accurate measurement of the chemical shifts associated with molecules that incorporate ^H, ^^C, ^^F, and ^^P. Each particular molecule has a different signature, allowing for assignment of individual metabolites. This can be very important to the understanding of disease processes, or response during therapy. For example, brain phospholipid metabolites (such as free phosphate, phosphocholine, etc.) can be studied. MRS often requires magnets of high field strength in order to separate the overlapping signals of individual metabolites. An additional disadvantage of the MRS is the relatively low sensitivity for detecting the metabolites, which requires either very long imaging times or large voxel sizes (volume area). MRS methods have been reviewed recently [14-16]. IV. Imaging and Gene-Therapy Vectors A. Gamma-Ray Imaging Gamma-ray imaging has been applied in two different ways to evaluate gene-therapy vectors in animal models. First, the in vivo location of the administered vector can be imaged following dosing. Second, the vector- dependent location of transgene expression can be imaged. This is accomplished by detection of expressed genetic reporters encoded in the vector. Both methods yield different information and may, or may not be correlated. For example, following intravenous injection an Ad vector might immediately localize in the liver. However, the extent of liver gene expression would depend on the cell type infected, the type of promoter, and the time after dosing. The two methods are reviewed in the following sections. 1. Radiolabeling the Vector Gamma camera imaging has been applied to evaluate directly labeled vectors. The in vivo distribution of ^^^In-labeled herpes simplex virions 6 6 4 Zinn and Chaudhuri was imaged following intravenous dosing [17]. This method of nonspecific labeling with ^^^In oxine showed no effect on viral infectivity; a maximum specific activity of 250 \|jiCi/10^ plague forming units (pfu) was achieved. ^^"^Tc-labeled Ad was evaluated following aerosol administration to the lung [18] or following intravenous injection [19]. The former approach [18] used nonspecific labeling with SnFi as the reductant for the ^^"^Tc ([TCO4]-). The latter approach represented a new method for radiolabeling a recombinant Ad vector with ^^"^Tc. A recombinant 6-His tag on the C-terminal knob was specifically targeting for labeling using Tc(I) carbonyl chemistry. This radiolabeling chemistry was originally described by Waibel [20]. Advantages of this system are related to the ease of radiolabeling and high stability over nonspecific methods, plus the specific attachment at the 6-His tag did not change the infectious characteristics of the Ad vector. It is anticipated that the technology will be used to image Ad vectors with modified tropism. 2. Imaging the Expression of Reporter Genes One method to evaluate gene transfer is to construct a vector encoding a suitable gene that when expressed can be targeted with a radiolabeled probe. An Ad vector encoding the human type 2 somatostatin receptor (hSSTr2) was used to infect cells growing in cell culture plates, and the expressed hSSTr2 was detected by imaging accumulation of the ^^"^Tc-labeled somatostatin analog P2045 [21]. An example of this approach is presented in Fig. 3. The in vitro method was further extended for detection of both hSSTr2 and herpes simplex virus thymidine kinase (TK) expression by simultaneously imaging "trapped" radiolabeled molecules specific for each expressed gene [22]. Imaging can also detect the location of gamma-ray emitting radiotracers that accumulate in target sites in vivo, due to localized expression of a reporter gene product. In this regard, the administered radiotracer must be cleared from the normal tissue so specific accumulation can be detected over background radioactivity. To date, this approach has been applied to image the in vivo expression of four different reporter genes, namely hSSTr2 [23-26], TK [27-39], the type 2 dopamine receptor (D2R) [35, 37, 40-42] , and the thyroid sodium/iodide symporter gene [43]. The expression of hSSTr2 has been imaged with radiolabeled peptide ligands including ^^"^Tc-P829 [23], ^̂ ^ Re- P829 [23], ^^"^Tc-P2045 [24-26], and ^i^In-octreotide [25]. Figure 4 presents images that compare two different ^^"^Tc-labeled somatostatin analogs for imaging Ad-mediated expression of hSSTr2. Several radiolabeled substrates have been applied for imaging TK expression, including ^^^I-FIAU [27, 32, 37], ^^^I-FIAU [23, 25, 30], 8- [i^F]fluoroganciclovir [29, 34, 35, 37], 8-[^^F]fluoropenciclovir [35, 37, 38, 40, 41], 9-[(3-[i^F]fluoro-l-hydroxy-2-propoxy)methyl]guanine [39], and others [37]. D2R expression has been imaged with 3-(2^-[^^F]- fluoroethyl)spiperone [35, 37, 40, 41] and [^^C]raclopride [42]. The expressed 2 2 . I m a g i n g A d e n o v i r u s - M e d i a t e d G e n e Transfer 665 Block Block A A l 1 2 3 4 5 6 7 8 9 101112 1 2 3 4 5 6 7 8 9 101112 A427 ? J t ^ 0 % ' w ^ 1 %: > W Pfl K^ X J M I SKOVSJpi 10 1^ ^ * i 100 ^ ' * ^ ^ H 100 f ^ - ^ BxPC3 ? : i . f l \| 1 € #- ^ 10 ^ ^ ^ H 10 * * * 100 '/ ^ . ^ H too *i • • B A427 SKOVSJp i BxPC3 0 MDA- 1 ' . - : • • 10 --?r-- >?y^-^;',,4v MB-468 100 j » > - ^ ^ : g # ^ f k ' . Figure 3 Imaging hSSTr2 gene transfer to tumor cell monolayers growing in 96-well plates by detection of internally bound ^^'^Tc-labeled P2045 (a somatostatin analog). Two levels of ^^"'lc-?2045 (7 nM: wells 1 - 3 , 7 - 9 ; 36 nM: wells 4-6, 10-12) were added to the two plates as shown in (A). Image (B) shows the quantity of internally bound ^^'^Tc-P2045 was dependent on the cell line and amount of Ad-hSSTr2. Cells were incubated with ^^"^Tc-P2045 for 3 h at 37°C and imaged following an acid wash to remove surface-bound activity. The cells were either uninfected (0) or infected with 1, 10, or 100 pfu/cell of Ad-hSSTr2 48 h earlier. Excess unlabeled P2045 (15 \|JLM final concentration) was added to lanes 7 - 1 2 immediately prior to addition of ^^"^Tc-P2045 in order to show that the internal binding was specific. Reprinted with permission from Zinn etol. [22].
reporters were imaged in xenograft tumors [23-28, 32, 34, 36-45], liver [29, 34-37, 39], and striatum [42]. In the majority of xenograft tumor studies, the reporter gene was transferred to the tumor cells prior to implantation in the animal [27, 28, 31, 36-38, 40, 41], or vector-producer cells were injected in an established tumor [27, 28, 31]. Transfer of the reporter gene by intratumor injection was accomplished with Ad-hSSTr2 for subcutaneous tumors [23-25,45], Ad-TK for intrahepatic tumors [32], Ad-TK for subcutaneous tumors [39], and the Ad encoding the thyroid sodium/iodide symporter gene [43]. Transfer of the TK gene to rat striatum was accomplished by direct injection of Ad-TK [42]. Most recently, ^ "̂̂ I-FIAU and PET were applied to monitor TK expression resulting from replication and spread of a replication-conditional HSV-1 vector (encoding TK) in a subcutaneous tumor [44]. A biscistronic Ad vector encoding both TK and hSSTr2 was evaluated in a tumor model where the expressions of both TK and hSSTr2 were simultaneously imaged [24, 45]. The hSSTr2 system was more sensitive than TK and showed a dose-response relative to Ad dose, while the same was not observed for TK imaging. Additional advantages of the hSSTr2 system over other genetic reporters for imaging gene transfer in cancer, include the lower 666 Zinn and Chaudhuri Figure 4 Imaging Ad-mediated gene transfer to subcutaneous tumors. (A) Picture of a mouse with two subcutaneous A-427 tumors (human lung cancer). The left tumor was injected 48 h earlier with a control Ad vector (1 x 10^ pfu intratumor) while the right tumor was injected 48 h earlier with Ad-hSSTr2 (1 x 10^ pfu intratumor). (B) Gamma camera image (pinhole collimator) at 5 h after intravenous dosing with ^^"^Tc-P829 (NeoTect™, Diatide Research Laboratories, Londonderry, NH). (C) Gamma camera image (pinhole collimator) at 5 h after intravenous dosing with ^^"^Tc-P2045, a new somatostatin analog (Diatide Research Laboratories, Londonderry, NH). The right tumors show uptake of the 99mTc-labeled somatostatin analog due to gene transfer and expression of hSSTr2. cost of ^^^Tc relative to PET radionuclides, the wider availability of SPECT relative to PET, and the negative growth effect of hSSTr2 expression on cancer proUferation and metastasis [46-48]. B. Light-Based Imaging Light-based genetic reporters are commonly used to detect in vitro gene transfer. Examples include P-galactosidase [49], green fluorescent protein (GFP) [50, 51], red-shifted GFP derivatives [52], blue- or yellow-shifted GFP derivatives [53], and luciferase [54]. Advantages include high spatial resolution and sensitivity. Light-based approaches for in vivo imaging can be applied to assess the broad physiology involving tumor growth, which includes biochemical processes, receptors, and enzymes [55-81]. Currently, two general approaches are applied for light-based imaging. The first approach uses fluorescent-based probes that specifically accumulate, or become activated, due to a tumor-specific process. This approach uses fluorescent probes 22 . Imaging Adenovirus-Mediated Gene Transfer 6 6 7 that target tumor-specific receptors or enzymes. One example reported by Jackson and group used light-based imaging to demonstrate accumulation of a tumor receptor-specific, single-chain Fv fragment labeled with Cy5 fluorescent dye in mice bearing melanoma xenografts [55]. Tumor uptake of antibodies conjugated with near infrared dyes was previously visualized by light-based technology [56, 57]. Optical imaging also detected tumor accumulation of a somatostatin-avid peptide conjugated with a near infrared fluorescent dye [58-60]. An alternate application was described by Weissleder et al. using Cy5.5 probes that were inactive (autoquenched) when injected in the mice, but became specifically activated by proteases expressed in breast xenograft tumors [61, 62]. A recent report described a quantitative light-based method for noninvasive imaging of human breast cancer [63]. In this study, the images were obtained using near-infrared diffuse optical tomography (DOT), with contrast enhancement provided by indocyanine green (ICG) that was administered to the patient. MRI was performed concurrently on the same patient and showed that ICG-enhanced optical images coregistered accurately with gadolinium-enhanced MRI, thereby validating the ability of DOT to image breast tumors. Others also used ICG and modified photodynamic agents in combination with frequency-domain photon migration techniques to detect spontaneous cancer in the canine mammary chain [64, 65]. The second general approach for light-based imaging uses reporter genes yielding protein products that achieve light emission. Luciferase is one example of a reporter gene, the expression of which can be imaged by detecting light emission following injection of luciferin [66-69]. Luciferase is normally absent in mammalian cells, but stable integration of a luciferase-containing plasmid was achieved in cancer cells [67, 68] which were implanted and detected by imaging. In a separate report, an adeno-associated viral vector was used to induce luciferase expression in utero, with detection by whole-body imaging [69]. One disadvantage to luciferase imaging is the requirement of luciferin substrate injection. However, the sensitivity is high and requires only short-term photon acquisition and integration to produce images of intact animals. Therefore, real-time studies and high-throughput in vivo screening of gene expression is possible, especially during therapeutic intervention. Several investigators have applied GFP as a light-based reporter after stable integration of the GFP gene in cancer cells prior to implantation in mice [70-81]. Light emission was achieved following excitation of the GFP protein with blue light. Chishima et al. demonstrated that GFP-expressing tumor cells were visualized after tumor-bearing mice were dissected, and the metastasis of cancer was detected in many different organs [73-77]. This work was later extended by Yang et al. to include noninvasive imaging of GFP- positive melanoma metastasis in mice [78]. In a very recent article, Hoffman and his group reported imaging results from a study where an Ad vector encoding enhanced GFP was injected into different organs of nude mice. 6 6 8 Zinn and Chaudhuri Light-based in vivo imaging showed GFP expression in different organs [79]. Enhanced GFP is not cytotoxic and has stable fluorescence signal that can be readily detected. Therefore, it is a suitable reporter molecule for imaging gene expression in animal models [80, 81]. As an example, Fig. 5 presents a light-based image of GFP expression in a subcutaneous tumor following Ad- mediated gene transfer of GFP. Advantages of GFP imaging include the high sensitivity and tremendous spatial resolution that can be achieved. A further advantage is the fact that the protein is genetically encoded, without the need for exogenous substrates. C. Magnetic Resonance Technologies For cancer applications, MRI can indirectly assess the effect of gene therapy by measuring changes in tumor size, blood flow, or extracellular fluid volume [82-85]. Direct measurement of gene expression by MRI requires contrast-enhancement. This was achieved in vitro by stable induction of melanin, a protein with high affinity for metal ions [86, 87]. For in vivo imaging, cells expressing high levels of transferrin receptor were detected on T2-weighted images after injection of transferrin conjugated with paramagnetic iron particles [88, 89]. These monocrystalline iron oxide nanoparticles (also called MIONs) were improved with a cross-linked dextran coat and better conjugation chemistry for the transferrin attachment, leading to a 10-fold improvement in in vitro cellular uptake [90, 91]. These improved nanoparticles may be better suited for imaging the transferrin receptor following gene transfer in vivo. So far this remains a potential application. An alternate strategy for imaging gene transfer was reported by Louie and Meade [92]. The basis of this approach was the construction of a MRL contrast agent that was sensitive to ^-galactosidase. Gadolinium was chelated in a manner that water was inaccessible, and therefore "inactive" as a contrast agent. Flowever, ^-galactosidase was capable of cleaving part of the molecular structure, rendering the gadolinium accessible to water, and "active" as a contrast agent on Tl-weighted MRI images. For the approach to be applicable for in vivo imaging, the contrast agent must be delivered to the site of P- galactosidase expression. Therefore, the suitability of this strategy for imaging vector-mediated gene transfer remains to be proven. There are three literature reports demonstrating the capability of MRS for noninvasive detection of enzyme-specific metabolites that are applicable to gene therapy [93-95]. The first report detected the metabolite [^^F]5-FU in cytosine deaminase-positive tumors following administration of 5-FC [93]. The subcutaneous tumor was established following implantation of HT28/yCD cells that stably expressed Saccharomyces cerevisiae cytosine deaminase. Imaging required a surface coil surrounding the tumor, and spatial information about cytosine deaminase expression in the tumor was not obtained. The second 22 . Imaging Adenovirus-Mediated Gene Transfer 6 6 9 report involved noninvasive monitoring of arginine kinase (AK) expression follov^ing Ad-mediated delivery to skeletal muscle [94]. MRS detected the metabolite [^^P]phosphoarginine in the muscle, the product of the AD enzyme. Imaging also required a surface coil surrounding the limb, and no spatial information about AK expression was obtained. The third report involved detection of [^^Pjphosphocreatine in liver of mice foUov^ing intravenous dosing of an Ad vector encoding creatine kinase [95]. The liver v^as surgically exposed for placement of a surface coil for MRS, in order for specific detection of this metabolite. V. Gene-Therapy Vectors May Advance Molecular Imaging While this chapter has focused on how imaging may advance gene therapy, the converse may also occur. Gene-therapy vectors may lead to better imaging approaches. One example relates to the need for a reliable method for early detection and monitoring of ovarian cancer. Ovarian cancer is the leading cause of death among gynecologic malignancies in United States [96, 97]. More than 23,000 new cases of ovarian cancer are diagnosed yearly, with 15,000 deaths annually [97, 98]. For gynecologists, ovarian cancer is extremely difficult to detect in early stage since no reliable screening method exists for this disease. This results in a poor prognosis. In the past decade, there was a 30% increase in the incidence of ovarian cancer and 20% increase in deaths from this disease [99]. Currently, surgical staging by histological examination and vigorous surgical debulking are routine practice for early detection and partial treatment of this disease [96]. Early detection of this disease would be the best way to improve survival. In that regard, the development of an accurate, noninvasive in vivo imaging modality with high sensitivity for the detection of small lesions is needed. Detection of small tumors using conventional techniques is difficult, thereby hindering both early diagnosis and effective therapeutic intervention. Existing technologies do not meet the need for the early detection and monitoring of ovarian cancer. Imaging technologies have improved in their sensitivity to image ovarian, breast, and other cancers noninvasively by PET, CT, MRI, SPECT, and US [98-113]. However, these methods fall short in fulfilling the need for early and accurate diagnosis of neoplastic disease. According to Wahl, PET imaging with [^^F]FDG was able to detect primary breast lesions over 1 cm in diameter [108]. Similar findings were reported by Richter et al. [109]. Grab et al. concluded that a negative finding on PET or MRI would not exclude early ovarian neoplasia [110]. Kubik- Huch et al. reported in a comparative study that, PET, CT, and MRI were not a replacement for surgery in the detection of microscopic peritoneal 6 7 0 Zinn and Chaudhuri disease [111]. While PET imaging offered less accurate spatial assignment of small lesions compared with CT and MRI, the latter two modalities were less specific than [^^F]FDG PET [111]. In a separate report, Tempany et al. reported that CT and MR were equivocal for imaging advanced ovarian cancer [112]. Kurjak et al. reported that transvaginal color Doppler and three-dimensional power Doppler ultrasound imaging improved the ability to differentiate benign from malignant ovarian masses [113]. Taken together, all currently available imaging techniques are not satisfactory for the early and accurate detection of ovarian and breast tumors smaller than 1 cm in diameter. Clinicians are searching for an effective screening method for the early detection of ovarian cancer. Our group has suggested that Ad vectors can be developed for this purpose [114]. The idea is to achieve GFP contrast in ovarian tumors and apply light-based imaging for detection (Fig. 6). For this to be realized, it will be necessary to induce GFP expression specifically in the tumors. This could be accomplished in two ways. First, it is likely that ovarian tumors express unique genes that are not found in normal tissues. The human genome project and DNA array research are likely to uncover these genes. Once a gene is discovered, the promoter element controlling the gene could be used to drive GFP expression. Intraperitoneal injection of an Ad vector encoding
the GFP gene under control of the ovarian-specific promoter would enable visualization of GFP-expressing ovarian tumors. A second general method to cause GFP reporter gene expression specifically in the tumors would be to develop Ad vectors that specifically target tumor. Ad vectors have now been produced that lack native tropism [115]. Vector targeting continues to improve, and a clear demonstration of targeting to an artificial receptor has been realized [116]. While vectors are currently not available to target tumor-specific receptors and lead to specific tumor transduction, their future development is likely. Thus, whether due to tumor-specific targeting or tumor-specific promoters, one can envision inducing GFP expression in tumors that could subsequently be detected by light-based technology. Fluorescent stereomicroscopy is adequate for noninvasive imaging in animal models, especially mice. However, this approach may not be possible in humans due to thickness of the abdominal wall. Detection of GFP expression could be accomplished with endoscopy or laparoscopy and enable physicians to detect the presence of tumor cells at an earliest stage without major surgery. This would be of great diagnostic value to gynecologists, especially in detecting intraperitoneal tumors at an early stage. In the clinical setting of second-look laparoscopy the patient could be injected 2 days earlier with an Ad vector that induced GFP expression in recurrent tumor. A fluorescent endoscope would detect GFP-positive tumors much smaller in size than what is currently detected through standard laparoscopy. 22 . Imaging Adenovirus-Mediated Gene Transfer 6 7 1 VI . Conclusion Noninvasive imaging in its various forms represents an expanding endeavor that v îll positively impact gene therapy. Gamma-ray imaging modalities have an established track record for imaging gene transfer in animal models. Human studies w îth the same systems are likely to be the next evolution. At our institution two clinical trials are planned; both include the hSSTrl reporter gene for imaging gene transfer. References 1. Orkin, S. H., and Motulsky, A. G. (1995). "Report and Recommendations of the Panel to Assess the NIH Investment in Research on Gene Therapy." Available at http://vv^v^w.nih.gov/ nev^s/panelrep.html. 2. Groch, M. W., and Erwin, W. D. (2001). Single-photon emission computed tomography in the year 2001: Instrumentation and quality control. / . NucL Med. Technol. 29, 12-18. 3. Groch, M. W., and Erwin, W. D. (2000). SPECT in the year 2000: Basic principles./. NucL Med. Technol. 28, 233-344. 4. Kastis, K., Barrett, H. H., Barber, H. B., et aL (2000). A small-animal gamma-ray imager using a CdZnTe pixel array and a high-resolution collimator. High resolution imaging in small animals with PET, MR and other modalities. In "Abstract Book," p. 17. 5. Weber, D. A., and Ivanovic, M. (1999). Ultra-high-resolution imaging of small animals: Implications for preclinical and research studies./. NucL CardioL 6, 332-344. 6. Ishizu, K., Mukai, T., Yonekura, Y., Pagani, M., Fujita, T., Magata, Y., Nishizawa, S., Tamaki, N., Shibasaki, H., and Konishi, J. (1995). Ultra-high resolution SPECT system using four pinhole collimators for small animal studies. / . NucL Med. 36, 2282-2287. 7. Turkington, T. G. (2001). Introduction to PET instrumentation./. NucL Med. TechnoL 29, 4 - 1 1 . 8. Fleming, J. S., Goatman, K. A., Julyan, P. J., Boivin, C. M., Wilson, M. J., Barber, R. W., Bird, N. J., and Fryer, T. D. (2000). A comparison of performance of three gamma camera systems for positron emission tomography. NucL Med. Commun. 21 , 1095-1102. 9. Chatziioannou, A. F., Cherry, S. R., Shao, Y., Silverman, R. W., Meadors, K., Far- quhar, T. H., Pedarsani, M., and Phelps, M. E. (1999). Performance evaluation of microPET: A high-resolution lutetium oxyorthosilicate PET scanner for animal imaging. / . NucL Med. 40,1164-1175. 10. Farkas, D. L., and Becker, D. (2001). Applications of spectral imaging: Detection and analysis of human melanoma and its precursors. Pigment Cell Res. 14, 2 - 8 . 11. Schultz, R. A., Nielsen, T., Zavaleta, J. R., Ruch, R., Wyatt, R., and Garner, H. R. (2001). Hyperspectral imaging: A novel approach for microscopic analysis. Cytometry 43, 239-247. 12. Kam, Z., Hanser, B., Gustafsson, M. G., Agard, D. A., and Sedat, J. W. (2001). Computa tional adaptive optics for live three-dimensional biological imaging. Proc. Natl. Acad. Set. USA 98, 3790-3795. 13. Farkas, D. L.,Du, C , Fisher, G. W.,Lau, C.,Niu, W., Wachman, E. S., and Levenson, R. M. (1998). Non-invasive image acquisition and advanced processing in optical bioimaging. Comput. Med. Imaging Graph. 22, 89-102. 14. Evelhoch, J. L., GiUies, R. J., Karczmar, G. S., Koutcher, J. A., Maxwell, R. J., Nal- cioglu, O., Raghunand, N., Ronen, S. M., Ross, B. D., and Swartz, H. M. (2000). Appli cations of magnetic resonance in model systems: cancer therapeutics. Neoplasia 2, 152-165. 6 7 2 Zinn and Chaudhuri 15. Gillies, R. J., Bhujwalla, Z. M., Evelhoch, J., Garwood, M., Neeman, M., Robinson, S. P., Sotak, C. H., and Van Der Sanden, B. (2000). Applications of magnetic resonance in model systems: Tumor biology and physiology. Neoplasia 2, 139-151. 16. Kurhanewicz, J., Vigneron, D. B., and Nelson, S. J. (2000). Three-dimensional magnetic resonance spectroscopic imaging of brain and prostate cancer. Neoplasia 2, 166-189. 17. Schellingerhout, D., Bogdanov, Jr., A., Marecos, E., Spear, M., Breakefield, X., and Weissleder, R. (1998). Mapping the in vivo distribution of herpes simplex virions. Hum. Gene Ther. 9, 1543-1549. 18. Lerondel, S., Le Pape, A., Sene, C., Faure, L., Bernard, S., Diot, P., Nicolis, E., Mehtah, M., Lusky, M., Cabrini, G., and Pavirani, A. (2001). Radioisotopic imaging allov^s optimization of adenovirus lung deposition for cystic fibrosis gene therapy. Hum. Gene Ther. 12, 1-11. 19. Zinn, K. R., Chaudhuri, T. R., Belousova, N., Davis, A. J., Mountz, Jr., J. D., Mountz, J. M., Curiel, D. T., and Krasnykh, V. N. (2001). In vitro and in vivo imaging of ^^"^Tc-labeled recombinant adenovirus. Mol. Ther. 3, S136. 20. Waibel, R., Alberto, R., Willuda, J., Finnern, R., Schibli, R., Stichelberger, A., Egli, A., Abram, U., Mach, J. P., Pluckthun, A., and Schubiger, P. A. (1999). Stable one-step technetium-99m labeling of His-tagged recombinant proteins with a novel Tc(I)-carbonyl complex. Nat. Biotechnol. 17, 897-901. 21. Zinn, K. R., Chaudhuri, T. R., Buchsbaum, D. J., Mountz, J. M., and Rogers, B. E. (2001). Simultaneous Evaluation of Dual Gene Transfer to Adherent Cells by Gamma-ray Imaging. Nucl. Med. Biol. 28, 135-144. 22. Zinn, K. R., Chaudhuri, T. R., Buchsbaum, D. J., Mountz, J. M., and Rogers, B. E. (2001). Detection and measurement of in vitro gene transfer by gamma camera imaging. Gene Ther. 8,291-299. 23. Zinn, K. R., Buchsbaum, D. J., Chaudhuri, T. R., Mountz, J. M., Grizzle, W. E., and Rogers, B. E. (2000). Noninvasive monitoring of gene transfer using a reporter receptor imaged with a high affinity peptide radiolabeled with ^^"^Tc or ^̂ ^ Re. / . Nucl. Med. 41 , 887-895. 24. Zinn, K. R., Buchsbaum, D. J., Chaudhuri, T. R., Mountz, J. M., Krasnykh, V. N., Curiel, D. T., and Rogers, B. E. (2000). Simultaneous in vivo imaging of thymidine kinase and somatostatin receptor expression after gene transfer with an adenoviral vector encoding both genes. Mol. Ther. 1, S44. 25. Rogers, B. E., Zinn, K. R., and Buchsbaum, D. J. (2000). Gene transfer strategies for improv ing radiolabeled peptide imaging and therapy. Q. J. Nucl. Med. 44, 208-223. 26. Chaudhuri, T. R., Rogers, B. E., Buchsbaum, D. J., Mountz, J. M., and Zinn, K. R. (2001). A non-invasive reporter system to image adenoviral-mediated gene transfer to ovarian cancer xenografts. Gyn. Oncol. 83, 432-438. 27. Tjuvajev, J. G., Finn, R., Watanabe, K., Joshi, R., Oku, T., Kennedy, J., Beattie, B., Koutcher, J., Larson, S., and Blasberg, R. G. (1996). Noninvasive imaging of herpes virus thymidine kinase gene transfer and expression: A potential method for monitoring clinical gene therapy. Cancer Res. 56, 4087-4095. 28. Tjuvajev, J. G., Avril, N., Oku, T., Sasajima, T., Miyagawa, T., Joshi, R., Safer, M., Beat- tie, B., DiResta, G., Daghighian, F., Augensen, F., Koutcher, J., Zweit, J., Humm, J., Lar son, S. M., Finn, R., and Blasberg, R. (1998). Imaging herpes virus thymidine kinase gene transfer and expression by positron emission tomography. Cancer Res. 58, 4333-4341. 29. Gambhir, S. S., Barrio, J. R., Wu, L., Iyer, M., Namavari, M., Satyamurthy, N., Bauer, E., Parrish, C , MacLare, D. C , Borghei, A. R., Green, L. A., Sharfstein, S., Berk, A. J., Cherry, S. R., Phelps, M. E., and Herschman, H. R. (1998). Imaging of adenoviral-directed herpes simplex virus type 1 thymidine kinase reporter gene expression in mice with radiolabeled ganciclovir. / . Nucl. Med. 39, 2003-2011. 30. Tjuvajev, J. G., Joshi, A., Callegari, J., Lindsley, L., Joshi, R., Balatoni, J., Finn, R., Lar son, S. M., Sadelain, M., and Blasberg, R. G. (1999). A general approach to the non-invasive 22 . Imaging Adenovirus-Mediated Gene Transfer 6 7 3 imaging of transgenes using cis-linked herpes simplex virus thymidine kinase. Neoplasia 1, 315-20. 31. Blasberg, R. G., and Tjuvajev, J. G. (1999). Herpes simplex virus thymidine kinase as a marker/reporter gene for PET imaging of gene therapy. Q. J. Nucl. Med. 43, 163-169. 32. Tjuvajev, J. G., Chen, S. H., Joshi, A., Joshi, R., Guo, Z. S., Balatoni, J., Ballon, D., Koutcher, J., Finn, R., Woo, S. L., and Blasberg, R. G. (1999). Imaging adenoviral-mediated herpes virus thymidine kinase gene transfer and expression in vivo. Cancer Res. 59, 5186-5193. 33. Hospers, G. A., Calogero, A., van Waarde, A., Doze, P., Vaalburg, W., Mulder, N. H., de Vries, E. F. (2000). Monitoring of herpes simplex virus thymidine kinase enzyme activity using positron emission tomography. Cancer Res. 60, 1488-1491. 34. Gambhir, S. S., Barrio, J. R., Phelps, M. E., Iyer, M,, Namavari, M., Satyamurthy, N., Wu, L., Green, L. A., Bauer, E., MacLaren, D. C., Nguyen, K., Berk, A. J., Cherry, S. R., and Herschman, H. R. (1999). Imaging adenoviral-directed reporter gene expression in living animals with positron emission tomography. Proc. Natl. Acad. Sci. USA 96, 2333-2338. 35. Gambhir, S. S., Barrio, J. R., Herschman, H. R., and Phelps, M. E. (1999). Assays for noninvasive imaging of reporter gene expression. Nucl. Med. Biol. 26, 481-490. 36. Gambhir, S. S., Bauer, E., Black, M. E., Liang, Q., Kokoris, M. S., Barrio, J. R., Iyer, M., Namavari, M., Phelps, M. E., and Herschman, H. R. (2000). A mutant herpes simplex virus type 1 thymidine kinase reporter gene shows improved sensitivity for imaging reporter gene expression with positron emission tomography. Proc. Natl. Acad. Sci. USA 97, 2785-2790. 37. Gambhir, S. S., Herschman, H. R., Cherry, S. R., Barrio, J. R., Satyamurthy, N., Toyokuni, T., Phelps, M. E., Larson, S. M., Balatoni, J., Finn, R., Sadelain, M., Tjuvajev, J., and Blasberg, R. (2000). Imaging transgene expression with radionuclide imaging technologies. Neoplasia 2, 118-138. 38. Iyer, M., Barrio, J. R., Namavari, M., Bauer, E., Satyamurthy, N., Nguyen, K., Toyokuni, T., Phelps, M. E., Herschman, H. R., and Gambhir, S. S. (2001). 8-[18F] Fluoropenciclovir: an improved reporter probe for imaging HSVl-tk reporter gene expression in vivo using PET. / . Nucl. Med. 42, 96-105. 39. Hustinx, R., Shiue, C. Y., Alavi, A., McDonald, D., Shiue, G. G., Zhuang, H., Lanuti, M., Lambright, E., Karp, J. S., and Eck, S. L. (2001). Imaging in vivo herpes simplex virus thymi dine kinase gene transfer to tumour-bearing rodents using positron emission tomography and [18F]FHPG. Eur. J. Nucl. Med. 28, 5-12. 40. Yu, Y., Annala, A. J., Barrio, J. R., Toyokuni, T., Satyamurthy, N., Namavari, M., Cherry, S. R., Phelps, M. E., Herschman, H. R., and Gambhir, S. S. (2000). Repetitive, non invasive imaging of the dopamine D2 receptor as a reporter gene in living animals. Nat. Med. 6, 933-937. 41. MacLaren, D. C , Gambhir, S. S., Satyamurthy, N., Barrio, J. R., Sharfstein, S., Toyo kuni, T., Wu, L., Berk, A. J., Cherry, S. R., Phelps, M. E., and Herschman, H. R. (1999). Repetitive, non-invasive imaging of the dopamine D2 receptor as a reporter gene in living animals. Gene Ther. 6, 785-791. 42. Ogawa, O., Umegaki, H., Ishiwata, K., Asai, Y., Ikari, H., Oda, K., Toyama, H., Ingram, D. K., Roth, G. S., Iguchi, A., and Senda, M. (2000). In vivo imaging of adenovirus- mediated over-expression of dopamine D2 receptors in rat striatum by positron emission tomography. Neuroreport 11, 743-748. 43. Boland, A., Ricard, M., Opolon, P., Bidart, J. M., Yeh, P., Filetti, S., Schlumberger, M., and Perricaudet, M. (2000). Adenovirus-mediated transfer of the thyroid sodium/iodide symporter gene into tumors
be TMD “ s pecialists,” the most easily understandable mecha- nisms that still correlate to the recommended treatment approaches have been chosen. Occa- sionally when simplifi ed mechanisms will not suffi ciently explain the phenomenon, psychosocial and CNS involvement are discussed. Similarly, since this is not a comprehensive textbook on TMD, it periodically warns that certain characteristics are suggestive of an uncommon disorder beyond the book’ s scope and recommends the practitioner consider referring the patient. To speed the reader ’ s synthesis of this material, questions that students frequently ask are placed at the beginning of the applicable chapters, and important concepts are highlighted throughout the book. Important terms are in bold, with many listed in the glossary. Recognizing that the general dentist is the primary provider for most TMD patients, I sincerely hope this book will be a reference that signifi cantly facilitates your TMD evaluations and therapies. Edward F. Wright xiii Introduction Temporomandibular disorder (TMD) is a collective term used for a number of clinical problems that involve the masticatory muscle, temporomandibular joint (TMJ), and/or associated structures. It has plagued humanity throughout history, and treatment has been reported even during the time of the ancient Egyptians.1 The cardinal signs and symptoms for TMD are pain in the masseter muscle, TMJ, and/or temporalis muscle regions; mouth- o pening limitation; and TMJ sounds. TMD pain is by far the most common reason patients seek treatment. 2 FOCAL POINT The cardinal signs and symptoms for TMD are pain in the masseter muscle, TMJ, and/or temporalis muscle regions; mouth- opening limitation; and TMJ sounds. TMD is an extremely common disorder that is most often reported in individuals between the ages of 20 and 40. Approximately 33% of the population has at least one TMD symptom and 3.6 – 7% of the population has TMD with suffi cient severity to cause patients to seek treatment.2 ,3 FOCAL POINT TMD is an extremely common disorder that is most often reported in individuals between the ages of 20 and 40. Approximately 33% of the population has at least one TMD symptom and 3.6– 7% has TMD with suffi cient severity that treatment is desired. TMD symptoms generally fl uctuate over time and correlate signifi cantly with masticatory muscle tension, tooth clenching, grinding, and other oral parafunctional habits . TMD symptoms are also signifi cantly correlated with an increase in psychosocial factors, e.g., worry, stress, irritation, frustration, and depression. 4 – 6 TMD can cause other symptoms that are beyond the masticatory musculoskeletal system, e.g., nonotologic otalgia (ear pain that is not caused by the ear), dizziness, tinnitus, neck pain, and toothache. TMD can contribute to migraine and tension headaches, myofascial pain in the region, and many other pain complaints. 7 QUICK CONSULT Observing TMD Symptom Correlations TMD symptoms generally fl uctuate over time and correlate signifi cantly with masticatory muscle tension, tooth clenching, grinding, and other oral parafunctional habits. TMD symptoms are also signifi cantly correlated with an increase in psychosocial factors, e.g., worry, stress, irritation, frustra- tion, and depression. xv xvi I N T R O D U C T I O N Women request treatment more often than do men, providing a female - male patient ratio between 3:1 and 9:1. 2 Additionally TMD symptoms are less likely to resolve for women than for men. 4,5 Many hypotheses attempt to account for the gender difference, but the underlying reason remains unclear.8 QUICK CONSULT Comparing the Response of Men and Women TMD symptoms are less likely to resolve for women than for men. Knowledge about TMD has grown throughout the ages. In general, treatment philosophies have moved from a mechanistic dental approach to a biopsychosocial medical model with the integration of neuroscience literature. This is comparable to the treatment philosophies of other joint and muscle conditions in the body. 1,9 Benefi cial occlusal appliance therapy and TMJ disc - recapturing surgery were reported as early as the 1800s. 1,10 The understanding of the importance to harmonize the occlusion for the health of the masticatory muscles and TMJs developed as the skills to reconstruct natural teeth advanced. As enthusiasm grew for obtaining optimum health, comfort, and function, the popularity of equilibrating the natural dentition also developed. 1,11 In the 1930s, Dr. James Costen, an otolaryngologist, brought TMD into the awareness of physicians and dentists, and readers may still fi nd TMD occasionally referred to as Costen ’ s syndrome . Dr. Costen reported that TMD pain and secondary otologic symptoms could be reduced with alterations of the occlusion.1 2 Since TMD is a multifactorial disorder (having many etiologic factors), many therapies have a positive impact on any one patient ’ s symptoms. Throughout much of the 1900s, many benefi cial therapies were independently identifi ed. Physicians, physical therapists, chiropractors, massage therapists, and others treating the muscles and/or cervical region reported positive responses in treating TMD symptoms. Psychologists working with relaxation, stress manage- ment, cognitive - behavioral therapy, and other psychological aspects reported benefi cial effects with their therapies. Orthodontists, prosthodontists, and general dentists working with the occlusion also observed the positive impact that occlusal changes provided for TMD symptoms. FOCAL POINT Since TMD is a multifactorial disorder (having many etiologic factors), many therapies have a positive impact on any one patient’ s symptoms. Surgeons reported positive benefi ts from many different TMJ surgical approaches. Many forms of occlusal appliance were tried and advocated, from which studies reveal there is similar effi cacy for different appliance forms. Medications as well as self - management strategies used for other muscles and joints in the body were also shown to improve TMD symptoms. During this observational period, TMD therapies were primarily based on testimonials and clinical opin- ions, according to a practitioner ’ s favorite causation hypothesis rather than scientifi c studies.1 ,9 Different philosophies appeared, with enthusiastic nonsurgeons “ recapturing ” discs through occlusal appliances, whereas surgeons repositioned the discs or replaced discs with autoplastic materials. The eventual breakdown of the autoplastic materials led to heartbreaking sequelae that caused many to step back from their narrowly focused treatment regimens and recognize I N T R O D U C T I O N xvii the multifactorial nature of TMD and the importance of conservative noninvasive evidence- based therapies.1 Over the last 30 years, much was learned about basic pain mechanisms and the shared neuron pool of the trigeminal spinal nucleus, other cranial nerves, and cervical nerves. This provided a better understanding of the infl uence that regional and widespread pain may have on TMD, the similarities between chronic TMD pain and other chronic pain disorders, and the need for chronic pain management from a psychosocial and behavioral standpoint. 1,13,14 Today, a large number of potentially reversible conservative therapies are available for our TMD patients. By using the information obtained from the recommended patient interview and clinical exam, practitioners can select cost- e ffective, evidence- b ased therapies that have the greatest potential to provide long - term symptom relief. The treatment selected often reduces a patient ’ s contributing factors and facilitates the patient ’ s natural healing capacity. This man- agement is consistent with treatment of other orthopedic and rheumatologic disorders. 2,7,9 QUICK CONSULT Selecting TMD Therapies Today, a large number of potentially reversible conservative therapies are available for our TMD patients. FOCAL POINT By using the information obtained from the patient interview and clinical exam, practitioners can select cost- effective, evidence- based therapies that have the greatest potential to provide long- term symptom relief for patients. The treatment selected often reduces a patient’ s contributing factors and facilitates the patient ’ s natural healing capacity. We do not fully understand TMD and the mechanisms causing or sustaining it. Practitioners should bear in mind that not all TMD therapies are equally effective, and no one treatment has been shown to be best for all TMD patients. Most TMD patients can be managed successfully by general practitioners.1 5 Most TMD patients who receive therapy obtain signifi cant symptom relief, whereas patients who do not receive treatment have minimal symptom change.1 6 TMD therapy is generally recommended for patients who have signifi cant temporal head- aches, preauricular pain, jaw pain, TMJ catching or locking, loud TMJ noises, diffi culty eating, restricted opening, diffi culty eating due to TMD, or nonotologic otalgia due to TMD. To help your hygienists better identify patients in your practice who need your help, a recommended “ Referral Criteria for Hygienists ” as provided in appendix 1 . REFERENCES 3. Okeson JP. Management of Temporomandibular Disorders and Occlusion , 6th ed . St. Louis : CV 1. McNeill C. History and evolution of TMD Mosby , 2008 : 133 . concepts . Oral Surg Oral Med Oral Pathol Oral 4. Egermark I , Carlsson GE , Magnusson T. A 20 - year Radiol Endod 1997 ; 83 : 51 – 60 . longitudinal study of subjective symptoms of 2. American Academy of Orofacial Pain . de Leeuw R temporomandibular disorders from childhood to (ed). O rofacial Pain: Guidelines for Assessment, adulthood . Acta Odontol Scand 2001 ; 59 ( 1 ): 40 – 48 . Diagnosis and Management , 4th ed . Chicago : 5. Wanman A. Longitudinal course of symptoms of Quintessence , 2008 : 131 – 133 , 158 . craniomandibular disorders in men and women: A xviii I N T R O D U C T I O N 10 - year follow - up study of an epidemiologic sample . temporomandibular joint . Ann Otol Rhinol Acta Odontol Scand 1996 ; 54 ( 6 ): 337 – 342 . Laryngol 1934 ; 43 : 1 – 15 . 6. Magnusson T , Egermarki I , Carlsson GE. A 13. Raphael KG , Marbach JJ , Klausner J. Myofascial prospective investigation over two decades on signs face pain: Clinical characteristics of those with and symptoms of temporomandibular disorders and regional vs. widespread pain . JADA associated variables. A fi nal summary . Acta Odontol 2000 ; 131 ( 2 ): 161 – 171 . Scand 2005 ; 63 ( 2 ): 99 – 109 . 14. Rammelsberg P , LeResche L , Dworkin S , Mancl L. 7. Fricton J. Myogenous temporomandibular Longitudinal outcome of temporomandibular disorders: Diagnostic and management consider- disorders: A 5- y ear epidemiologic study of muscle ations. Dent Clin North Am 2007 Jan; 51 ( 1 ): 61 – 83 . disorders defi ned by research diagnostic criteria for 8. Shinal RM , Fillingim RB. Overview of orofacial temporomandibular disorders. J Orofac Pain pain: Epidemiology and gender differences in 2003 ; 17 ( 1 ): 9 – 20 . orofacial pain . Dent Clin North Am 2007 15. Egermark I , Carlsson GE , Magnusson T. A 20 - year Jan; 51 ( 1 ): 1 – 18 . longitudinal study of subjective symptoms of 9. Ats ü SS , Ayhan - Ardic F. Temporomandibular temporomandibular disorders from childhood to disorders seen in rheumatology practices: A review. adulthood . Acta Odontol Scand 2001 ; 59 ( 1 ): 40 – 48 . Rheumatol Int 2006 ; 26 ( 9 ): 781 – 787 . 16. Anastassaki A , Magnusson T. Patients referred to a 10. Goodwillie DH. Arthritis of the temporomaxillary specialist clinic because of suspected temporoman- articulation . Arch Med 1881 ; 5 : 259 – 263 . dibular disorders: A survey of 3194 patients in 11. Dawson PE. Functional Occlusion: From TMJ to respect of diagnoses, treatments, and treatment Smile Design . St Louis : CV Mosby , 2007 . outcome . Acta Odontol Scand 12. Costen JB. A syndrome of ear and sinus symptoms 2004 ; 62 ( 4 ): 183 – 192 . dependent upon disturbed function of the Manual of Temporomandibular Disorders Second Edition Part I Initial Evaluation The goals of the initial examination are to identify a patient ’ s primary diagnosis; secondary, tertiary, etc., diagnoses; contributing factors; and symptom patterns. FOCAL POINT The goals of the initial examination are to identify a patient’ s primary diagnosis; secondary, tertiary, etc., diagnoses; contributing factors; and symptom patterns. The primary diagnosis is the diagnosis for the disorder most responsible for a patient ’ s chief complaint. This diagnosis can be of temporomandibu- lar disorder (TMD) origin (e.g., myofascial pain, TMJ
infl ammation, or acute temporomandibular joint [TMJ] disc displacement without reduc- tion) or from a different source (e.g., pulpal pathosis, sinusitis, or cervico- genic headache). 1 FOCAL POINT The primary diagnosis is the diagnosis for the disorder most responsible for a patient’ s chief complaint. Secondary , tertiary , etc. diagnoses are other TMD diagnoses that gen- erally contribute to the TMD symptoms. Typically the primary diagnosis will be of TMD origin (e.g., myofascial pain), and the secondary and tertiary diagnoses will be other TMD diagnoses (e.g., TMJ infl ammation and TMJ disc displacement with reduction) that contribute to a patient’ s chief complaint. When a non - temporomandibular disorder (non - TMD) (e.g., fi bromyalgia) contributes to a TMD primary diagnosis, the non - TMD disorder is designated as a contributing factor to the TMD diagnosis and not as secondary or tertiary diagnosis.1 3 4 P A R T I I N I T I A L E V A L U A T I O N FOCAL POINT Secondary, tertiary, etc., diagnoses are diagnoses for other disorders that contribute to the primary diagnosis. During the initial exam, we also attempt to identify the p erpetuating contributing factors . These are elements that perpetuate the disorder (not allowing it to resolve), e.g., nighttime parafunctional habits, gum chewing, daytime clenching, stress, or neck pain.1 ,2 Additionally, we attempt to identify the s ymptom patterns that include the period of the day in which the symptoms occur or are most intense (e.g., worse upon awaking) and the location pattern (e.g., begins in the neck and then moves to the jaw). FOCAL POINT Perpetuating contributing factors are elements that are not allowing the disorder to resolve, e.g., nighttime parafunctional habits, gum chewing, daytime clenching, stress, or poor posture. Symptom patterns include the period of the day in which the symptoms occur or are most intense (e.g., worse upon awaking) and the location pattern (e.g., begins in the neck and then moves to the jaw). This non - TMD example may help you better understand how these terms are used. A patient complains to her physician about wrist pain. Through palpation of her wrist area, her physician determines the primary cause for her pain is the tenderness within the wrist joint (its diagnosis would be the primary diagnosis). Her physician also fi nds the muscles around the wrist are painful but less tender than the wrist joint (the muscle diagnosis would be the secondary diagnosis). By asking questions, the physician fi nds that this pain consistently begins approximately half an hour after she starts using the computer and continues as long as she uses the computer, suggesting computer use is prob- ably the major contributing factor for her wrist pain. The physician also knows the patient has a systemic arthritic condition, which he suspects makes her more susceptible to developing the wrist pain (a second contribut- ing factor). To treat the wrist pain, her physician decides the best initial approach is to (1) refer the patient to a therapist to teach her about computer keyboard and mouse ergonomics, and (2) prescribe her an NSAID short term. The physician decides to not escalate therapy for the systemic arthritic condi- tion because of potential side effects from the escalated therapy. P A R T I I N I T I A L E V A L U A T I O N 5 The therapy choices can change with different contributing factors. For example, if the wrist pain only occurs upon awakening and lasts half an hour, this suggests nocturnal wrist activity is the major contributing factor. Her physician now decides the best initial therapy is to prescribe her a wrist splint to wear at night to ensure the wrist stays in a neutral position during sleep. The initial TMD evaluation involves interviewing the patient about his or her symptoms, potential contributing factors, and potential non - TMD. The interview most infl uences the patient ’ s fi nal treatment approach and generally brings to light concerns that the practitioner will need to evaluate during the clinical examination. The clinical examination will help to confi rm or rule out the structures involved in the patient ’ s complaints and other suspected disorders that may contribute to these complaints. Imaging may be appropriate, but, in my experience, it rarely changes the treatment approach derived from the patient interview and examination. In the late 1980s, an experience demonstrated that patients with TMD symptoms needed to be evaluated more thoroughly for potential non - TMD. A physician asked if I knew that one of the dentists who worked for me had diagnosed someone with TMD when the patient actually had meningitis. After reviewing the patient ’ s dental record, I found she had been referred by the emergency room physician for possible TMD. The patient told the dentist she had been previously diagnosed with TMD, had an occlusal appliance, and believed she was having a relapse of this disor- der. The dentist palpated her masticatory muscles and TMJs and found the muscles were tight and tender to palpation. The dentist confi rmed for the patient that she had TMD, gave her TMD self - management instruc- tions, and told her she should see her civilian dentist to have her appliance adjusted (as she was not an active - duty military patient). At the time, it appeared to me the dentist performed an appropriate evaluation and drew a fi tting conclusion. The emergency room record was then reviewed to obtain a better per- spective of what had transpired. It was documented that the patient also told the emergency room physician that she had previously been diagnosed with TMD, had an occlusal appliance, and believed she was having a relapse of this disorder. The physician found she had fi rm masticatory and 6 P A R T I I N I T I A L E V A L U A T I O N cervical muscles and a fever, and referred her to the dentist for a TMD evaluation and to a neurologist. When the patient saw the neurologist, he did a spinal tap and found she had meningitis. This disheartening experience inspired me to research everything I could concerning disorders that mimic TMD. Lists were made of how their symptoms differed from TMD and a fairly brief list of questions was fi nally formulated that dentists can use to warn themselves that a patient may have a non - TMD condition that is mimicking TMD.3 This question- naire has been used ever since and modifi ed as new information became available. 4,5 This questionnaire is certainly not foolproof, but it is the best I can formulate to alert me of potential non- T MD disorders, contributing factors, and symptom patterns. REFERENCES non - craniomandibular disorders that may infl uence a patient ’ s CMD symptoms . Cranio 1. Fricton J . Myogenous temporomandibular disorders: 1992 ; 10 ( 3 ): 228 – 234 . Diagnostic and management considerations . Dent 4. Wright EF , Gullickson DC . Identifying acute Clin North Am 2007 Jan; 51 ( 1 ): 61 – 83 . pulpalgia as a factor in TMD pain. J ADA 2. American Academy of Orofacial Pain . de Leeuw R 1996 ; 127 : 773 – 780 . (ed). O rofacial Pain: Guidelines for Assessment, 5. Wright EF , Des Rosier KE , Clark MK , Bifano SL . Diagnosis and Management , 4th ed . Chicago : Identifying undiagnosed rheumatic disorders among Quintessence , 2008 : 158 – 159 . patients with TMD . JADA 1997 ; 128 ( 6 ): 738 – 744 . 3. Wright EF . A simple questionnaire and clinical examination to help identify possible Chapter 1 Patient Interview FAQs Q: What should be done if a patient reports having a TMJ Tefl on - Proplast implant, or Silastic implant, or total TMJ prostheses? A: A specifi c protocol has been recommended for TMJ Tefl on - Proplast and Silastic implants and total joint prostheses. Follow- u p for these is beyond the scope of this book. If the practitioner is unsure of the implant type or management, it is recommended the practitioner refer the patient to, or work in conjunction with, someone who has greater expertise in this area. Q: What is secondary gain and how common is it among TMD patients? A: Secondary gain is a situation in which the patient is rewarded for having TMD; e.g., the patient receives disability payments or is excused from undesirable chores or work. Clinically this is not a commonly observed situation, but, if it is present, the patient may not relate improvement from any therapy. Q: What should be done when a patient appears to have a tooth causing or contributing to the TMD symptoms? A: A recommended approach to determine whether a tooth is causing or contributing to a patient ’ s TMD symptoms is provided in “ Intraoral Examination ” in chapter 3 . A recommended “ Initial Patient Question- time spent interviewing patients. The practi- naire ” is provided (appendix 2 ) and may be tioner ’ s customary medical history form reproduced for your patients to complete. The should be used in conjunction with this questionnaire is designed to effi ciently use the questionnaire. 7 8 P A R T I I N I T I A L E V A L U A T I O N QUICK CONSULT TECHNICAL TIP Collecting Symptom History Assisting Patient Recall T he “ Initial Patient Questionnaire” is designed to F or better patient recall, it appears best if the effi ciently use the time spent interviewing patients patient arrives 15 minutes prior to the appoint- and should be used in conjunction with the ment and completes the questionnaire just prior practitioner ’ s customary medical history form. to the appointment. The practitioner may desire to add an Chapter 2 , “ Review of the ‘ Initial Patient additional page to obtain medical and dental Questionnaire, ’ ” presents the key points for insurance information and the name and each of the questions and is designed to help a address of the individual who recommended practitioner quickly evaluate a patient’ s that the patient come to your offi ce, in addition responses. Many of the questions are self - to the name and address of the patient ’ s explanatory, but additional discussion for physician and dentist. It is comforting to a some of the questions, as well as supplemen- referring provider to receive a letter acknowl- tary information, is provided below: edging that the referral was appropriate and Item 1 (On the diagram below, please providing the practitioner ’ s fi ndings and shade the areas of your pain:) provides a quick recommended treatment. This also tends to overview of the patient ’ s pain locations. From encourage the referring provider to recommend the patient ’ s shaded areas, I observe whether your offi ce the next time a patient with a the patient ’ s pain appears to be from (1) the similar complaint needs treatment. A copy of masseter muscle or TMJ (the most common this letter is often sent to the patient ’ s physician TMD pain locations); (2) the posterior neck and dentist (if not the referring doctor); a region and locations where neck pain com- release statement is included in the “ Initial monly causes referred pain (e.g., periorbital, Patient Questionnaire ” for this purpose. forehead, and temporalis regions1 ); (3) the The questionnaire appears to keep patients anterior neck region, in which I will attempt from elaborating in nonproductive discussions to identify whether this is due to a local or becoming irritated by the number of ques- problem or referred pain (6% of patients with tions asked, and prevents the practitioner from cardiac ischemia only have craniofacial pain forgetting to ask relevant information. Clinical and the anterior neck region is the most experience suggests a patient ’ s responses are not common location for referred ischemia pain always accurate and the examiner needs to to appear among these patients 2 ); or (4) other review the answers with the patient. For better types of pain patterns (e.g., sinus pain). patient recall, it appears
best if the patient Item 6 (What treatments have you arrives 15 minutes prior to the appointment received?), with additional inquiries, gives an and completes the questionnaire just prior to indication of which treatments were previ- the appointment. During the patient interview, ously benefi cial for the patient. For example, the practitioner usually needs to ask the patient if the patient found that an occlusal appliance to elaborate on some of the answers. (which the patient no longer has) resolved the symptoms, then fabricating another appliance QUICK CONSULT should be very benefi cial. Reinforce to the Confi rming Patient Responses patient that using the treatments (e.g., Cl inical experience suggests a patient ’ s responses application of heat) he or she previously are not always accurate and the examiner needs to found benefi cial can again be benefi cial. If the review the answers with the patient. patient has previously received the therapies C H A P T E R I P A T I E N T I N T E R V I E W 9 the practitioner traditionally provides, without much the pain is affecting the patient’ s life. satisfactory benefi t, the practitioner may desire This may correlate with how motivated the to refer the patient to someone with greater patient will be to participate in therapy and expertise in this area. the level of therapy the patient may be TMJ implants composed of Tefl on - Proplast interested in receiving. Occasionally this and Silastic have a history of fragmenting, answer is out of proportion with other causing a foreign - body response that results in features of the examination; e.g., the patient is progressive degeneration of the condyle and unable to work, but has only minimal palpa- glenoid fossa. A specifi c protocol has been tion tenderness. Additional questions may recommended for these implants and total joint reveal the patient continues to participate in prostheses.3 Follow - up for these is beyond the other activities, such as yelling at basketball scope of this book. If a practitioner is unsure of games. This inconsistency may suggest that the implant type or management, it is recom- other factors are involved, commonly referred mended the practitioner refer the patient to, or to as secondary gain .4 work in conjunction with, someone who has Item 9 (Is your pain … ) helps identify some greater expertise in this area. possible conditions for a patient ’ s pain. Patients Item 7 (When is your pain the worst?) will most commonly characterize TMD pain as often help identify the time when signifi cant having an ache, pressure, or dull pain quality. If contributing factors are present. Patients with throbbing is one of the components, generally nighttime parafunctional habits usually have the patient ’ s disorder falls within one or more an increase in pain when they fi rst awake, of the following three situations: whereas patients with daytime parafunctional First, some patients report their pain is an habits have an increase in pain during the day ache, pressure, or of dull quality and, when it or evening. The examiner may be able to elicit worsens, its quality changes to throbbing. The more specifi c periods, e.g., during or after patient may have nausea, photophobia, and/or driving, or when using the computer. phonophobia associated with the throbbing pain. For these patients, clinically it appears FOCAL POINT that, if the ache, pressure, or dull pain can be Patients with nighttime parafunctional habits satisfactorily reduced, this can prevent the usually have an increase in pain when they fi rst pain sequence from escalating to the throb- awake, whereas patients with daytime parafunc- bing level. tional habits have an increase in pain during the day or evening. QUICK CONSULT QUICK CONSULT Reducing Throbbing Pain Observing for Signifi cant C linically it appears that, if a patient relates the ache, pressure, or dull pain worsens to Contributing Factors throbbing and can be satisfactorily reduced, W hen discussing a patient ’ s symptom pattern, this prevents the pain from escalating to the an examiner may be able to elicit specifi c throbbing level. periods when signifi cant contributing factors are present, e.g., during or after driving, or when using the computer. In a second situation, the patient does not report that an ache, pressure, or dull pain Item 8 (What does the pain keep you from progresses into throbbing pain. The source of doing?) gives the practitioner a sense for how the two types of pain may be from different 10 P A R T I I N I T I A L E V A L U A T I O N Figure 1.1. A depiction of central convergence enabling tooth pulp pain to be perceived as masseter muscle pain. sources and the throbbing pain may not QUICK CONSULT respond to TMD therapy. In this situation, Observing for Throbbing Pain the practitioner may desire to perform an Sources occlusal appliance therapy trial and, if it is not T hrobbing pain may be referred pain from an effective, consider a referral to the patient ’ s acute pulpalgia. physician or neurologist for a probable migraine. Studies suggest some migraines Innervations from tooth pulps and the respond to TMD therapy, but characteristics masticatory musculoskeletal system appear to for identifying which migraines respond are travel along similar pathways, so pain from one not well established.5 can sensitize common areas within the CNS, For other patients, the throbbing pain may causing the pain to be perceived as from the be r eferred pain from an oral problem (most other. There are also more nerves that enter the commonly a tooth). Sometimes the perceived CNS than there are neurons to transfer the painful site (e.g., masseter muscle and/or information to higher CNS centers, requiring TMJ) appears as the source to the patient, pain input to converge from multiple sources whereas the actual source (e.g., a tooth) has (Figure 1.1 ). This may also cause pain from minimal symptoms. This is similar to how a one source to be perceived as from the other. patient suffering from a heart attack may Additionally, muscles often respond to pain in perceive pain only in the left arm, whereas the the region by tightening, increasing the TMJ pain ’ s source is the heart. Treatment for the loading, causing pain in the masticatory pain must be directed toward the source, not muscles as well as the TMJ. Clinically, this the site where it is felt. sequence of events may manifest as a C H A P T E R I P A T I E N T I N T E R V I E W 11 masticatory muscle or the TMJ being perceived high probability of benefi ting the patient or as the source of the odontogenic pain and upon whether this treatment may delay the evalua- palpating the tender structure identifi ed as the tion for another, more probable, disorder. pain ’ s site, the patient relates this reproduced Item 10 attempts to identify whether the or intensifi ed the chief complaint. practitioner should be suspicious that odonto- A study of patients suspected of having genic pain, neck pain, or sinus congestion TMD by their dentists, but whose TMD pain may be contributing to the patient’ s com- upon additional examination was found plaint. Clinical experience has shown that primarily to be referred odontogenic pain, TMD pain rarely wakes patients up at night, reported that (1) none of the periapical but odontogenic pain and neck pain com- radiographs revealed apical pathosis, and (2) monly wake patients up at night. The patient patients related that palpating the perceived may not be aware that the neck is the source painful site often reproduced their pain. 6 and may only perceive pain at a different The study found four helpful characteristics referred pain location. Identifying referred for identifying patients who have a tooth pain from the neck is discussed further in causing or contributing to their TMD symp- “ TMD Palpations ” in chapter 3 . toms: (1) throbbing is a component of the pain, Patients with sinus congestion tend to fi nd an (2) the pain wakes the patient at night, (3) the aggravation when they change their head pain increases when the patient lies down, and position, i.e., lie down or bend forward. If the (4) the pain increases when the patient drinks patient responds positively to this question, it is hot or cold liquids. Evaluating and treating recommended that the practitioner further referred odontogenic pain are discussed further inquire as to whether sinus congestion appears to in Item 10 and in “ Intraoral Examination ” in contribute to the pain; e.g., whether the patient chapter 3 . A case scenario of a patient with this fi nds decongestants or antibiotics help relieve the disorder is presented in “ C ase 1” in part V. pain. If the patient is unaware of the impact B urning is infrequently reported by TMD from these and the practitioner suspects sinus patients, whereas most neuropathic pains congestion involvement, the practitioner may include a burning quality. 7,8 Clinical experience desire to provide a trial with an oral deconges- has shown that, if burning is combined with tant, nasal spray decongestant, and/or antibiotic the typical TMD pain qualities (ache, pressure, (e.g., Sudafed [pseudoephedrine HCl] 60 mg, 1 or dull pain), usually the burning correspond- tab q 4 – 6 hours; Afrin [oxymetazoline HCl] ingly resolves with the ache, pressure, or dull 0.05%, two sprays in each nostril q 12 hours; pain from TMD therapy. If burning is the and/or Augmentin [amoxicillin/clavulanate] patient ’ s most prominent pain quality or did 500 mg, 1 tab b.i.d. for 10 days [all have generic not resolve from initial TMD therapy, the formulations]). Eliciting pain from palpating practitioner may desire to refer the patient to over the sinuses can rule in the probability of someone with greater expertise in this area to sinus involvement, but not eliciting pain upon evaluate the patient for neuropathic pain. A palpation cannot rule out sinus involvement.7 A method for identifying these practitioners is case scenario of a patient with chronic sinusitis provide in “ Practitioners with TMD Expertise is presented in “ Case 2 ” in part V. and Fellowship Programs ” in appendix 13 . In addition to those already discussed, many QUICK CONSULT other pain qualities are possible, e.g., an Observing for Sinus Congestion electrical or stinging sensation. Knowledge of a Contribution patient ’ s pain qualities will help a practitioner P atients with sinus congestion tend to fi nd determine whether treatment for TMD has a an aggravation when they change their 12 P A R T I I N I T I A L E V A L U A T I O N head position, i.e., lie down or bend every day, but not constantly), “ weekly ” forward. (occurs every week, but not daily), etc. Duration may be momentary, the average Historically patients with odontalgia tend to number of seconds to hours, or constant. The report their pain wakes them at night, increases pain may vary greatly and can be diffi cult to when they lie down, and/or increases when quantify accurately. For brevity, it is often they drink hot or cold liquids. If a patient clinically satisfactory to just document the responds positively to one or more of these average intensity and frequency in the questions or has throbbing pain, this should patient ’ s record, but in some situations the raise a suspicion that a tooth may be causing or practitioner may want to include the extremes contributing to the TMD symptoms.6 and/or durations. QUICK CONSULT Item 14 attempts to identify unusual Observing for Odontalgia symptoms, which may be suggestive of other Contribution disorders that could mimic or coexist with H istorically patients with odontalgia tend to TMD. For example, a progressively increasing report their pain wakes them at night, increases open bite of the anterior teeth may be from when they lie down, and/or increases when they the TMJ losing its vertical height, generally drink hot or cold liquids. due to severe TMJ osteoarthritis. As the condylar height collapses, the most posterior Sometimes patients incorrectly answer ipsilateral (affected side) tooth becomes the “ Yes ” to
the question, “ Does your pain fi rst tooth to contact, acts as a fulcrum, and increase when you drink hot or cold liquids? ” progressively creates an open bite for the When these patients elaborate, it becomes remaining dentition. The open bite generally apparent that cold only causes tooth discom- begins on the contralateral (nonaffected side) fort rather than aggravating their facial pain. anterior teeth and progressively spreads Clinical experience has shown that thermal bilaterally until the only tooth that contacts is sensitivity of the teeth is common among the most posterior ipsilateral tooth. This TMD patients. disorder and its treatment are complicated When the practitioner suspects that a tooth and beyond the scope of this book. Practitio- may be causing or contributing to the TMD ners observing this complaint may desire to symptoms, further evaluation is indicated. A refer the patient to someone with greater recommended evaluation approach and expertise in this area. treatment considerations are provided in It is not uncommon for a patient to relate “ Intraoral Examination ” in chapter 3 . autonomic changes, which are induced by Items 11, 12, and 13 attempt to quantify central sensitization produced by the pain. the pain, requiring the patient to delineate its These can include the face becoming red, intensity, frequency, and duration. The fi rst puffy, or having thermal changes near the area two questions introduce patients to rating of the pain; the eye becoming bloodshot or their pain intensity from 0 to 10 and give the tearing; and/or the nose running or becoming practitioner a sense of the patient’ s pain congested. These autonomic changes occur history. This numerical rating system is the when the pain is aggravated and should most effective manner we have at this time for resolve when it lessens or resolves.1 0 They are rating pain intensity. 9 A concise and com- sometimes reproduced when the practitioner monly used terminology for frequency is aggravates the pain during the palpation “ constant ” (always present), “ daily ” (occurs evaluation. C H A P T E R I P A T I E N T I N T E R V I E W 13 Table 1.1. Recommendations for chronic headaches patients. With headache diagnoses of tension- type, migraine without aura, migraine with aura, or combinations of these headaches Presentation T herapy If the patient has signifi cant TMD pain that is worthy of Provide TMD therapy and the patient may obtain receiving TMD therapy, signifi cant headache improvement from this treatment. If the patient has signifi cant neck pain that is worthy of Refer patient for neck therapy and the patient may receiving neck TMD therapy, obtain signifi cant headache improvement from this treatment. If patient ’ s headaches cannot be adequately controlled Provide TMD therapy or refer patient for neck with medications by physicians and the patient has therapy, starting with the more tender area. The masticatory or neck tenderness, patient may obtain signifi cant headache improvement from one or both of these treatments. Headache is another symptom patients been identifi ed for which patients are more write for this item. If the patient relates this likely to obtain headache improvement from is a new severe headache, there are many TMD or cervical therapies. 11,12 serious disorders that can cause this symptom, My recommendations for chronic head- and the patient needs to see a physician to aches patients are provided in Table 1 .1. evaluate the patient for these potential Items 15, 16, and 17 provide a rapid tool causes. to screen for a non- T MD that may be the This book recommends treatment for cause of the pain or negatively impact it. 13,14 TMD and cervical pain. There is an interrela- The practitioner can skip each question the tionship between TMD pain, cervical pain, patient answers with a “ N o,” but needs to and chronic headaches, and many therapies inquire further and consider the comments in used to treat TMD and cervical pain are also a “ Review of the ‘ Initial Patient Question- used to treat chronic headaches. naire ’ ” (chapter 2 ) for each question with a I recommend you treat the patient’ s TMD “ Yes ” answer. pain and refer for cervical pain as outlined in Two disorders that are moderately prevalent this book, and inform the patient that there is among TMD patients, often negatively potential it may also benefi t the chronic infl uence TMD symptoms and treatment, and headache. If the patient does not obtain the practitioner must be very observant to satisfactory headache benefi t, I recommend identify them. The fi rst is cervical pain ; one the patient be referred to a neurologist for study found that 51% of TMD patients had pharmaceutical management. cervical pain. 15 Cervical pain may not only Treatment of TMD and the cervical region directly affect the masticatory system and its has been shown to be benefi cial for tension ability to respond to therapy, but it may also type, migraine without aura, and migraine cause referred pain to the masticatory struc- with aura headaches. The degree of headache tures, which can add to a patient’ s TMD improvement is quite varied among these symptoms or be the sole cause of the TMD studies, and no clinical characteristics have symptoms.1 ,14 14 P A R T I I N I T I A L E V A L U A T I O N QUICK CONSULT advance to other disorders, such as multiple Observing Cervical Pain and sclerosis.2 1 Fibromyalgia Effects on TMD Items 18, 19, and 20 ask about TMJ noise Therapy and the inability to open or close the mouth. C ervical pain and fi bromyalgia often negatively The latter can be of muscle or TMJ origin. A infl uence TMD symptoms and treatment “ TMJ Disc Displacements ” diagram is response. provided as appendix 3 and may be repro- duced for your patients. It is helpful for Recommended cervical palpation tech- explaining the cause of their TMJ noise and/ niques to identify referred pain from the or inability to open or close. cervical region to the head and face are provided in “ TMD Palpations ” in chapter 3 . QUICK CONSULT The scope of clinical practice for TMD has Explaining Mechanical Disorder been determined to include the diagnosis and A “ TMJ Disc Displacements” diagram is treatment of disorders affecting the entire provided as appendix 3 and is helpful for head and neck. This is consistent with the explaining the cause of a patient ’ s TMJ noise historical precedent in dentistry and within and/or inability to open or close. the scope of current dental practice. 16 The other disorder that practitioners must The diagram is broken into four sections, be very astute in identifying is fi bromyalgia . with the top left section providing a view of the It is characterized by widespread body pain, skull with the zygomatic arch cut so the entire multiple tender points over the body, poor temporalis muscle can be visualized. This sleep, stiffness, and generalized fatigue. Only enables the provider to demonstrate how the about 4% of the general population has temporalis muscle functions and how clenching fi bromyalgia, whereas 18 – 23% of TMD or other oral habits can overuse this muscle, patients have it. 14,17 thereby causing pain similar to that caused by It has been shown that TMD patients with overuse of any muscle in the body. The fi bromyalgia, widespread body pain, or neck zygomatic arch can be drawn in and the pain do not respond as well to TMD therapies masseter muscle drawn over the ramus, and a as do those without these comorbid disor- similar discussion about muscle - overuse pain ders. 18 – 20 Therefore, it is important to identify can be provided. The lateral pterygoid muscle patients with these disorders and inform them can also be drawn to explain the symptoms and about the potential negative impact this may treatment for lateral pterygoid myospasm have on their treatment. If it appears a patient (explained in chapter 9 , “ Lateral Pterygoid is not receiving adequate therapy for the Myospasm ” ). The articular eminence is also coexisting disorder, it is recommended the displayed so that condylar dislocation (the patient discuss treatment alternatives with his condyle catches or locks in front of the emi- or her medical provider or be referred to nence) and its treatment may be demonstrated. someone who specializes in the area. Conservative therapies for dislocation are It is recommended that patients suspected provided in chapter 11 , “ TMJ Dislocation. ” of having fi bromyalgia be referred to a To orient the patient for the next section of physician for defi nitive diagnosis and manage- the diagrams, point to the ear on the skull and ment. There have been instances in which then to the ear in the top right section. This patients diagnosed with fi bromyalgia by drawing provides an avenue to explain the rheumatologists have had their fi bromyalgia “ normal ” disc - condyle alignment. If the patient C H A P T E R I P A T I E N T I N T E R V I E W 15 has a TMJ click or pop, the most probable without reduction ; see chapter 5 for an situation is that the elastic ligament (the explanation of this terminology.2 3 A more retrodiscal tissue, in addition to its attachment accurate assessment of the disc- c ondyle complex) is stretched and the disc - condyle alignment can be obtained by magnetic alignment looks like the top drawing in the resonance imaging (MRI) of the TMJ, but the bottom left section in which the disc is dis- fi ndings rarely change the treatment approach, placed. 22,23 As the condyle translates forward and MRI is rarely indicated at the initial (e.g., during opening), it moves into the center TMD evaluation. 25 For more information on of the disc (the reduced position), and, as the TMJ imaging, see chapter 4 , “ Imaging. ” individual closes, the condyle retrudes off the disc. This is commonly referred to as TMJ disc QUICK CONSULT displacement with reduction , which is the Requesting M RI s terminology that is used in this book. M RI fi ndings rarely change the treatment This section can visually explain the approach, and MRI is rarely indicated at the opening and/or closing click. Sometimes initial TMD evaluation. patients are also informed about how the tension in the closure muscles (temporalis, The inability to open wide (Item 19) is masseter, and medial pterygoid) brace the generally due to either a TMJ disorder (e.g., condyle in a superior position, which may acute disc displacement without reduction) or a promote a greater mechanical interference muscle disorder. Discussing the onset and its between the condyle and disc. Clinically history is often benefi cial and may aid in patients report this effect by their TMJ click, determining the cause. If this limitation is catch, or lock occurring more frequently or intermittent, patients with an acute disc with greater intensity when they are stressed, displacement without reduction are usually while eating, or after clenching their teeth. aware that the TMJ is blocked at the opening For patients experiencing limited transla- where the TMJ normally clicks or pops. tion due to the disc blocking their normal Typically they suddenly have a restricted opening ( acute TMJ disc displacement opening, which just as abruptly releases, without reduction ), the bottom right allowing them to obtain their normal opening diagram can help visually explain the mechan- once again. The acute disc displacement ical problem and treatment. This is discussed without reduction may be persistent, but often in chapter 5 , “ TMD Diagnostic Categories, ” has a history of being intermittent. Conversely and in chapter 1 0, “ A cute TMJ Disc Dis- an intermittent muscle disorder generally placement without Reduction. ” develops and resolves slowly for each episode. Many patients report the presence or FOCAL POINT history of TMJ noises (Item 18), since TMJ If a TMJ disc intermittently blocks a patient from clicking or popping is very prevalent among opening wide, the patient is usually aware that the TMD and general
populations. 24 These the TMJ is blocked at the opening where the noises may occur with opening and/or closing, TMJ normally clicks or pops, it suddenly occurs, can fl uctuate in intensity, and occur sporadi- and just as abruptly releases; conversely an cally. If a patient has TMJ clicking or intermittent muscle disorder generally develops popping, the most likely diagnosis is TMJ disc and resolves slowly for each episode. displacement with reduction. 22,23 If the joint noise is coarse crepitus, then the most likely If a patient has a restricted opening, the diagnosis is chronic TMJ disc displacement practitioner may be able to determine its 16 P A R T I I N I T I A L E V A L U A T I O N It should be kept in mind that there are other potential, though less common, causes for patients having a restricted opening. Generally these patients complain only about a restricted opening, not pain.4 Some exam- ples of these are TMJ ankylosis, myofi brotic contracture, and coronoid process impedance. These disorders are beyond the scope of this book, and if the practitioner suspects the patient may have one of them, he or she may desire to refer the patient to someone with greater expertise in this area. Patients may report episodes of being unable to close their mouth (Item 20). From clinical experience, there are several common causes for a positive response to this question. If the patient reports the TMJ catches or locks at an opening of 45 mm or wider, the condyle has the potential of being in front of the eminence Figure 1.2. Stretching a restricted opening to (TMJ dislocation). Among patients with this determine the origin of the restriction. complaint, multiple disc - condyle relations have been observed, and investigators have postu- origin by stretching the mouth wider. This is lated that the catching or locking is due to (1) usually done by placing the index fi nger over the articular eminence obstructing the posterior the incisal edges of the mandibular incisors movement of the disc - condyle unit, (2) the disc and the thumb over the incisal edges of the obstructing the posterior movement of the maxillary incisors and pressing the teeth apart condyle, or (3) a combination of the two.2 6 by moving the fi ngers in a scissor - type motion Traditional TMD therapies have been shown (Figure 1.2 ). The patient will usually feel to improve this condition. 27 Conservative tightness or pain at the location of the treatments for TMJ dislocation are provided in restriction, and the patient is asked to point chapter 11 , “ TMJ Dislocation. ” to this source. From clinical experience, not If the patient ’ s TMJ catches or locks during all patients accurately point to the stretched closure in a range of approximately 10 – discomfort location, and it is necessary to 35 mm, the articular eminence should not be palpate the TMJ and musculature to repro- involved, and it would most probably be only duce the stretched discomfort in order to the disc that is obstructing the posterior accurately identify its origin. movement of the condyle. There is no consistent disc- c ondyle relationship for this TECHNICAL TIP interference, but it is speculated the most Determining Origin of a Patient’ s common scenario is that the patient has a Restricted Opening TMJ disc displacement with reduction. The T he practitioner may be able to determine a interference occurs during closure when the patient ’ s restricted opening origin by stretching condyle is in the reduced position and the the mouth wider and determining the location of condyle has diffi culty moving or is temporar- the created discomfort. ily unable to move below the posterior band C H A P T E R I P A T I E N T I N T E R V I E W 17 of the disc; this is the typical location of the with the patient (e.g., gum chewing, caffeine closing click. This closing catch or lock occurs consumption, or stomach sleeping). This similarly to the way in which an opening handout is provided as appendix 4 . click ’ s mechanical interference worsens to Poor sleep may constitute the inability to fall become an opening catch or lock. The bottom asleep, stay asleep, or awake feeling rested (Item left diagram of the “ T MJ Disc Displace- 21). Poor sleep has been shown to correlate ments ” handout (appendix 3 ) may help to with increased muscle pain and can be a visually explain this mechanical interference to predictor of patients who will respond poorly patients. From clinical experience, this to TMD therapy.2 9 – 31 A good system to use to problem resolves with traditional conservative evaluate poor - sleep severity is to ask the patient TMD therapies. to rate his or her sleep quality between 0 and A third common cause of patients reporting 10. Intuitively, when most of us do not get an inability to close is a lateral pterygoid adequate sleep, we tend to feel more aches and myospasm . In this situation, the inferior pain, be more irritable, etc. The effects of lateral pterygoid muscle is in constant invol- inadequate sleep tend to contribute to a TMD untary contraction at a partially shortened patient ’ s symptoms on both a physical and position. This is similar to the calf muscle psychosocial basis.3 1 From clinical experience, cramp that has awakened many of us in the when a patient relates that poor sleep is primar- middle of the night. Upon awaking, the ily due to TMD pain, it has been observed that, individual notes the calf pain and calf cramp when the TMD pain resolves, generally the in which he or she has diffi culty and increased sleep problem also resolves. To ensure a pain when attempting to move the foot up or patient ’ s needs and desires are met, when other down. A patient with a lateral pterygoid causes of poor sleep are involved, the provider myospasm similarly has diffi culty and may ask the patient to discuss this with his or increased pain when attempting to translate her physician, refer the patient for relaxation the condyle forward or retrude the jaw so the therapy, or refer the patient to someone who teeth fi t into maximum intercuspation. The specializes in sleep disorders. If the patient has patient usually complains of the inability to poor sleep and awakes with morning TMD put the ipsilateral posterior teeth together pain, the practitioner may desire to prescribe without excruciating pain, the teeth are amitriptyline or nortriptyline; see “ Tricyclic usually separated by a fraction of a millimeter Antidepressants ” in chapter 17 for additional to a few millimeters, and the fi rst tooth information. contact is in the area of the contralateral Patients may relate they do not sleep well canine (if the patient has normal tooth due to post traumatic stress disorder (PTSD), alignment).2 8,29 Since the patient has diffi culty in which they may awake with nightmares translating forward, he or she usually also has where they re - experience the traumatic event. a marked limited opening. A diagnostic test PTSD is strongly linked with TMD symp- and treatments are provided in chapter 9 , toms, 32 and if these patients have not received “ Lateral Pterygoid Myospasm. ” pharmaceutical and psychological therapies to Items 21 through 27 ask about potential help control this disorder, they should be contributing factors to a patient ’ s TMD. Some referred for these services. Some PTSD contributing factors are not asked about in this patients who are “ m aximally pharmaceutically questionnaire, but will become apparent when managed ” and receiving psychological therapy the provider or staff member reviews the still awake from their PTSD nightmares with “ TMD Self - Management Therapies ” handout all of the muscles in their body intensely 18 P A R T I I N I T I A L E V A L U A T I O N contracted. My clinical experience with these TMD symptoms. Some dentists train a PTSD patients is that a maxillary acrylic psychologist or staff member to help patients stabilization appliance helps reduce the recognize and break their daytime contribut- amount of masticatory pain they awake with ing habits. A diary in which patients hourly from these nightmares. If they do not receive record their TMD symptoms and tension suffi cient benefi t from this, they may fi nd an levels often helps patients learn about these opposing mandibular soft thermoplastic associations and thereby provides the motiva- stabilization appliance, as described in “ S oft tion to change their tension levels. Thermoplastic Stabilization Appliance ” in Psychosocial stress may also increase the chapter 1 2, provides additional benefi t.3 3 nocturnal parafunctional activity. In one Patients with fi bromyalgia may also relate study,3 6 subjects wore devices to bed that that they do not sleep well. These patients recorded the nocturnal EMG activity, and have widespread body muscle pain and subjects were able to correlate higher noctur- fi bromyalgia is discussed above under Items nal EMG activity with stressful life events 15, 16, and 17. (Figures 1.3 and 1.4 ). Occasionally patients relate their TMD symptoms awake them from their sleep. Clinical experience suggests that pain of this severity is generally not due to TMD, but most commonly due to tooth pulp or cervical pain being referred to the masticatory muscu- loskeletal system. FOCAL POINT Poor sleep has been shown to correlate with an increase in muscle pain and can be a predictor of patients who will respond poorly to TMD therapy. The usual portion of the day in which a Figure 1.3. Correlation of increased nocturnal patient feels most tense, aggravated, or masseter muscle activity with stressful life events. 36 frustrated (Item 22) is an indicator as to the impact these feelings may have on the TMD symptoms. Patients with TMD tend to hold more tension in their jaws, clench their teeth, or engage in other nonfunctional activities during these times, 34,35 and some may be aware of these habits. Some patients may hold their teeth together throughout the day and squeeze them during these times, whereas others may swear they never touch their teeth, but after observing for these habits will later fi nd they clench or tighten their masticatory muscles during such times. It is a challenge to Figure 1.4. Correlation of increased and help patients understand their unconscious decreased nocturnal masseter muscle activity with daytime habits that are contributing to their more and less stressful life events, respectively. 36 C H A P T E R I P A T I E N T I N T E R V I E W 19 TECHNICAL TIP the impact that depression may have on the Reducing Tension Levels patient ’ s TMD symptoms. Clinical experience A diary in which patients hourly record their suggests that patients who are depressed and TMD symptoms and tension levels often helps not open to discussing or receiving treatment patients learn about these associations and for their depression minimize their answer with thereby provides the motivation to change their “ Seldom ” or “ Never. ” For patients who mark tension levels and habits. “ Always ” or “ Half the time, ” it is recom- mended the practitioner discuss the patient ’ s Clinically it has been observed that TMD depression and referral options, i.e., primary patients often deny having stress because they medical provider (to discuss treatment relate the term “ stress ” to more signifi cant options), psychologist (primarily treats through events than they have in their lives. Terms discussions), and/or psychiatrist (a physician that patients seem to acknowledge having that who primarily treats with medications). Based tend to be associated with these habits are on clinical experience, when a patient relates “ tension, ” “ aggravations, ” “ frustrations, ” the depression is primarily due to TMD pain, “ concerns, ” “ busyness, ” “ more of life ’ s stuff, ” the depression generally resolves when the or “ more of life ’ s situations. ” TMD pain resolves. Once patients recognize they have one of these feelings, it is
recommended their FOCAL POINT preferred term be used in future discussions. Depression negatively infl uences TMD Discuss the likelihood that this psychosocial symptoms. contributor is associated with their pain, because patients tend to hold more tension in Suicide is one of the three leading causes of their jaw muscles (also neck and shoulders if death for individuals aged 15 – 34 years.3 8 If a they also have pain or tenderness in these patient relates he or she has thoughts of hurting areas) during such times. himself or herself, or committing suicide (Item There are two approaches patients can use 24), you must determine lethality. Ask the to reduce the symptoms related to these patient whether he or she has a plan, a time psychosocial contributors. They can learn to selected, and the means selected of carrying this reduce the psychosocial contributors (using out (pills, gun, etc.). If the answer is “ Yes ” to coping strategies, stress management, etc.) any of these, the patient must immediately be and/or become very aware of their propensity evaluated by someone trained in psychosocial to tighten their muscles during such times and suicide assessment to determine whether break this habit. A combination is generally suicide is imminent, i.e., a clinical social used when patients are referred for treatment worker, psychologist, psychiatrist, your local of this problem. hospital ’ s suicide prevention team, the author- Sometimes a patient ’ s concerns are over- ity received by calling 911, or the police whelming, and the patient desires to discuss department ’ s emergency psychiatric evaluation them with a trained professional and learn team. Do not allow the patient to leave without coping skills. Two examples of referrals to a an escort (i.e., a staff member, responsible psychologist are provided in appendix 1 1. family member, police, or hospital personnel Depression has been shown to negatively sent to your offi ce) unless he or she has been impact a patient ’ s perception of pain,3 7 and the cleared by an appropriate person. Clearly portion of the day in which a patient usually document your fi ndings, actions, and follow up feels depressed (Item 23) is an indicator as to on your referral. Your local suicide prevention 20 P A R T I I N I T I A L E V A L U A T I O N hotline can provide information about resources available in your community, and you can obtain more information from the American Foundation for Suicide Prevention (AFSP; www.afsp.org ). A considerable amount of time spent singing or playing a musical instrument (Item 25) may also signifi cantly contribute to a patient ’ s TMD symptoms. The impact will vary with the instruments and the amount of time spent in the activity. It has been specu- lated that wind instruments, some string Figure 1.5. Alerted TMD patients and healthy instruments (violin and viola), and singing control subjects every 20 minutes from 8 a.m. to 10 have the greatest potential for contributing to p.m. and found TMD patients were signifi cantly TMD symptoms.3 9 A patient ’ s symptom time more often engaged in a nonfunctional tooth contact activity.3 5 pattern should give an indication of the impact singing or playing the musical instru- ment has on the symptoms. Sometimes these recurring habit, as the day becomes busy, activities are the patient’ s sole source of frustrating, or irritating, the individual would income, so the patient will have to weigh the most likely unconsciously squeeze his or her cost and benefi t of limiting or changing the fi ngertips into the palm and overuse these intensity of these activities. muscles even more. If the individual were to go Studies that inquired numerous times to a physician and complain about my forearm throughout the day as to whether subjects pain, he or she would wonder why this muscle were engaged in a nonfunctional tooth is so tender and painful compared to the other contact activity found TMD subjects have muscles in my body. The physician would need their teeth in contact signifi cantly more often to realize this localized pain was caused by that than non - TMD subjects. 35,40 It is common habit and would conclude the best way to treat for many individuals to allow their opposing this muscle disorder is for the individual to teeth to contact, but it appears when this break the habit. behavior is excessive that it may be a signifi - If the patient does not have a widespread cant contributor to TMD symptoms body disorder (e.g., fi bromyalgia), I touch his (Figure 1.5 ). 35 It is recommended patients or her biceps and forearm while I say, “ Y our never hold their teeth together except momen- biceps and forearm are not tender, so there tarily when swallowing (Item 26). This must be something you are doing to overuse question nicely leads into discussing the your jaw muscles. If your jaw muscles were patient ’ s daytime habits and the importance relaxed, your jaw would drop away from your of breaking them. The following analogy is upper teeth, just as we allow our arms to hang used, demonstrating with my arm, to help the loose and drop (at the same time I allow my patient understand the impact holding the arms to go limp and drop). Your jaw should teeth together may have on his or her pain. be hanging loose all day with your lips just Whenever my fi ngertips touch the palm of lightly touching (unless the patient is a mouth my hand, the muscles in my forearm must fl ex. breather). ” If one were to hold this, the muscles would If patients are aware of clenching, grinding, eventually tire and start to hurt. If this were a or any other oral habit (Items 27 and 28), C H A P T E R I P A T I E N T I N T E R V I E W 21 they should be informed of how these nega- questions. Consider giant cell arteritis when a tively affect their TMD symptoms. Sometimes patient relates unexplainable scalp tenderness, breaking these habits and using the “ TMD unexplainable or unintentional weight loss, Self - Management Therapies ” handout (appen- signifi cant morning stiffness lasting longer dix 4 ) will satisfactorily decrease a patient ’ s than a half hour, and visual symptoms or TMD symptoms. visual loss.4 1 Item 31 helps a practitioner determine A fever (previously asked about in the whether a patient might have giant cell questionnaire) is also more prevalent among arteritis (temporal arteritis).4 1,42 Giant cell people who have giant cell arteritis. 41 If the arteritis may mimic mild TMD symptoms, fever is not due to a dental condition and has has been misdiagnosed as TMD, and may not been evaluated by a physician, it is cause blindness within a relatively short time recommended that the patient be referred for if not treated. 43 As many as 20 – 60% of an evaluation. Another sign of giant cell inadequately treated or untreated patients lose arteritis is an abnormal temporal artery, which their vision. 42 It is better to err with an is evaluated by comparing the left and right unnecessary referral than allow this disorder to temporal arteries. Relative to the other side, go undiagnosed. If you suspect a patient has an abnormal vessel would be more visible, giant cell arteritis, it is recommended the have no pulse, or have palpable nodes. patient see a physician that day. The onset of the disease is frequently abrupt and may be bilateral. A frequent QUICK CONSULT complaint is a new headache and scalp pain Observing for Giant Cell Arteritis that cause the patients to sit up in a chair all G iant cell arteritis may mimic mild TMD symp- night and local infl ammation and tenderness toms, has been misdiagnosed as TMD, and may in the head or neck area. 42 cause blindness within a relatively short time if It is very unlikely that a patient would not treated. come to a dentist ’ s offi ce for treatment of these symptoms, but if this occurs, it is Giant cell arteritis is almost exclusively important to realize the symptoms are not found in people over the age of 50. It causes a suggestive of TMD and that the patient be reduction in the blood fl ow to the structures referred to the emergency room. Other of the head and neck (including the mastica- potential causes for similar symptoms might tory muscles and eyes). The decreased masti- be an intracranial hemorrhage, meningitis, catory muscle blood fl ow causes the muscles encephalitis, etc. to tire easily, producing a tired, cramped feeling that resolves within 1– 2 minutes after REFERENCES use. Some TMD patients without giant cell arteritis may report similar symptoms, and 1. Wright EF . Patterns of referred craniofacial pain in these questions will help to differentiate the TMD patients . JADA 2000 ; 131 ( 9 ): 1307 – 1315 . 2. Kreiner M , Okeson JP , Michelis V , Lujambio M , two disorders.4 1 If a patient has had symptoms Isberg A . Craniofacial pain as the sole symptom of suggestive of giant cell arteritis for over a year, cardiac ischemia: A prospective multicenter study. it is highly unlikely that he or she has giant JADA 2007 ; 138 (1): 74 – 79 . cell arteritis. 3. American Association of Oral and Maxillofacial “ Yes ” to the fi rst two questions suggests jaw Surgeons . Recommendations for management of claudication, but a patient with mild TMD patients with temporomandibular joint implants. symptoms may respond positively to both Temporomandibular Joint Implant Surgery 22 P A R T I I N I T I A L E V A L U A T I O N Workshop . J Oral Maxillofac Surg and signs of temporomandibular disorders . Cranio 1993 ; 51 ( 10 ): 1164 – 1172 . 2007 ; 25 ( 2 ): 114 – 126 . 4. Okeson JP . Management of Temporomandibular 16. The scope of TMD/orofacial pain (head and neck Disorders and Occlusion , 6th ed . St. Louis : CV pain management) in contemporary dental practice. Mosby , 2008 : 222 , 455 – 461 . Dental Practice Act Committee of the American 5. Wright EF , Clark EG , Paunovich ED , Hart RG . Academy of Orofacial Pain . J Orofac Pain Headache improvement through TMD stabilization 1997 ; 11 ( 1 ): 78 – 83 . appliance and self - management therapies . Cranio 17. Klippel JH , Stone JH , Crofford LJ , White PH . 2006 ; 24 ( 2 ): 104 – 111 . Primer on the Rheumatic Diseases , 13th ed . New 6. Wright EF , Gullickson DC . Identifying acute York : Springer , 2008 : 87 – 89 . pulpalgia as a factor in TMD pain. J ADA 18. Raphael KG , Marbach JJ , Klausner J . Myofascial 1996 ; 127 : 773 – 780 . face pain: clinical characteristics of those with 7. Merrill RL . Differential diagnosis of orofacial pain . regional vs. widespread pain . JADA In: Laskin DM , Greene CS , Hylander WL . 2000 ; 131 ( 2 ): 161 – 171 . Temporomandibular Disorders: An Evidence - Based 19. Raphael KG , Marbach JJ . Widespread pain and the Approach to Diagnosis and Treatment . Hanover effectiveness of oral splints in myofascial face pain. Park, IL : Quintessence , 2006 : 299 – 317 . JADA 2001 ; 132 ( 3 ): 305 – 316 . 8. Lewis MA , Sankar V , De Laat A , Benoliel R . 20. Rammelsberg P , LeResche L , Dworkin S , Mancl L . Management of neuropathic orofacial pain . Oral Longitudinal outcome of temporomandibular Surg Oral Med Oral Pathol Oral Radiol Endod disorders: a 5- y ear epidemiologic study of muscle 2007 ; 103 Suppl: S32.e1 – 24 . disorders defi ned by research diagnostic criteria for 9. Conti PC , de Azevedo LR , de Souza NV , Ferreira temporomandibular disorders. J Orofac Pain FV . Pain measurement in TMD patients:
evaluation 2003 ; 17 ( 1 ): 9 – 20 . of precision and sensitivity of different scales . J Oral 21. Harden RN . Muscle pain syndromes . Am J Phys Rehabil 2001 ; 28 ( 6 ): 534 – 539 . Med Rehabil 2007 ; 86 ( 1 ): S47 – S58 . 10. Okeson JP . Bell ’ s Orofacial Pains: The Clinical 22. Yatani H , Sonoyama W , Kuboki T , Matsuka Y , Management of Orofacial Pain , 6th ed . Carol Orsini MG , Yamashita A . The validity of clinical Stream, IL : Quintessence , 2005 : 75 – 76 , 449 – 517 . examination for diagnosis of anterior disc 11. Wright EF , Clark EG , Paunovich ED , Hart RG . displacement with reduction. O ral Surg Oral Med Headache improvement through TMD stabilization Oral Pathol Oral Radiol Endod 1998 ; 85 : 647 – 653 . appliance and self - management therapies . Cranio 23. Schiffman E , Anderson G , Fricton J , Burton K , 2006 ; 24 ( 2 ): 104 – 111 . Schellhas K . Diagnostic criteria for intraarticular 12. Bronfort G , Nilsson N , Haas M , Evans R , T.M. disorders . Community Dent Oral Epidemiol Goldsmith CH , Assendelft WJJ , Bouter LM . 1989 ; 17 ( 5 ): 252 – 257 . Non - invasive physical treatments for chronic/ 24. Ribeiro RF , Tallents RH , Katzberg RW , Murphy recurrent headache. Cochrane Pain, Palliative and WC , Moss ME , Magalhaes AC , Tavano O . The Supportive Care Group Cochrane Database of prevalence of disc displacement in symptomatic and Systematic Reviews. 4, 2007 . asymptomatic volunteers aged 6 to 25 years. J 13. Wright EF . A simple questionnaire and clinical Orofac Pain 1997 ; 11 ( 1 ): 37 – 47 . examination to help identify possible non- 25. Brooks SL , Brand JW , Gibbs SJ , Hollender L , Lurie craniomandibular disorders that may infl uence a AG , Omnell K - A , Westesson P - L , White SC . patient ’ s CMD symptoms . Cranio Imaging of the temporomandibular joint: a position 1992 ; 10 ( 3 ): 228 – 234 . paper of the American Academy of Oral and 14. Wright EF , Des Rosier KE , Clark MK , Bifano SL . Maxillofacial Radiology . Oral Surg Oral Med Oral Identifying undiagnosed rheumatic disorders Pathol Oral Radiol Endod 1997 ; 83 : 609 – 618 . among patients with TMD . JADA 26. Yoda T , Imai H , Shinjyo T , Sakamoto I , Abe M , 1997 ; 128 ( 6 ): 738 – 744 . Enomoto S . Effect of arthrocentesis on TMJ 15. Cooper BC , Kleinberg I . Examination of a large disturbance of mouth closure with loud clicking: a patient population for the presence of symptoms preliminary study . Cranio 2002 ; 20 ( 1 ): 18 – 22 . C H A P T E R I P A T I E N T I N T E R V I E W 23 27. Kai S , Kai H , Nakayama E , Tabata O , Tashiro H , masticatory myofascial pain: A polysomnographic Miyajima T , Sasaguri M . Clinical symptoms of study . J Orofac Pain 2008 ; 22 ( 3 ): 190 – 200 . open lock position of the condyle: relation to 35. Chen CY , Palla S , Erni S , Sieber M , Gallo LM . anterior dislocation of the temporomandibular joint. Nonfunctional tooth contact in healthy controls Oral Surg Oral Med Oral Pathol and patients with myogenous facial pain. J Orofac 1992 ; 74 ( 2 ): 143 – 148 . Pain 2007 ; 21 ( 3 ): 185 – 193 . 28. Dupont JS . Acute malocclusion . Gen Dent 36. Rugh JD , Robbins JW . Oral habits disorder . In: 2006 ; 54 ( 2 ): 102 – 104 . Ingersoll BD (ed). Behavioral Aspects of Dentistry . 29. Fricton J . Myogenous temporomandibular Norwalk, CT , Appleton - Centry - Crafts , 1982 . disorders: diagnostic and management 37. Turner JA , Holtzman S , Mancl L . Mediators, considerations . Dent Clin North Am 2007 moderators, and predictors of therapeutic change in Jan; 51 ( 1 ): 61 – 83 . cognitive - behavioral therapy for chronic pain . Pain 30. Kafas P , Leeson R . Assessment of pain in 2007 ; 127 ( 3 ): 276 – 286 . temporomandibular disorders: the bio- p sychosocial 38. McGirr A , Turecki G . The relationship of impulsive complexity . Int J Oral Maxillofac Surg aggressiveness to suicidality and other depression - 2006 ; 35 ( 2 ): 145 – 149 . linked behaviors . Curr Psychiatry Rep 31. Yatani H , Studts J , Cordova M , Carlson CR , 2007 ; 9 ( 6 ): 460 – 466 . Okeson JP . Comparison of sleep quality and clinical 39. Yeo DK , Pham TP , Baker J , Porters SA . Specifi c and psychologic characteristics in patients with orofacial problems experienced by musicians . Aust temporomandibular disorders. J Orofac Pain Dent J 2002 ; 47 ( 1 ): 2 – 11 . 2002 ; 16 ( 3 ): 221 – 228 . 40. Glaros AG , Williams K , Lausten L , Friesen LR . 32. Afari N , Wen Y , Buchwald D , Goldberg J , Plesh O . Tooth contact in patients with temporomandibular Are post - traumatic stress disorder symptoms and disorders . Cranio 2005 ; 23 ( 3 ): 188 – 193 . temporomandibular pain associated? Findings from 41. Hayreh SS . Masticatory muscle pain: an important a community - based twin registry . J Orofac Pain indicator of giant cell arteritis. S pec Care Dent 2008 ; 22 ( 1 ): 41 – 49 . 1998 ; 16 ( 2 ): 60 – 65 . 33. Wright EF , Thompson RL , Paunovich ED . Post 42. Zachariades N , Skoura C , Spanoua A , Machera H . traumatic stress disorder: considerations for Temporal arteritis: report of a case . Oral Surg Oral dentistry . Quintessence Int 2004 ; 35 ( 3 ): 206 – 210 . Med Oral Pathol Oral Radiol Endod 34. Rossetti LM , Pereira de Araujo Cdos R , Rossetti 2006 ; 102 ( 2 ): 192 – 197 . PH , Conti PC . Association between rhythmic 43. Lee AG . Jaw claudication: A sign of giant cell masticatory muscle activity during sleep and arteritis . JADA 1995 ; 126 : 1028 – 1029 . Chapter 2 Review of the “ Initial Patient Questionnaire ” 1. On the diagram below, please shade the areas of your pain: Right Left This forces the patient to think where the pain is located. 2. When did your pain/problem begin? Indicates the chronicity of the disorder. If it is of recent onset, the fi rst occurrence, and mild to moderate pain, you may want to only prescribe TMD self- m anagement therapy and ibuprofen, and observe to see if it resolves. 3. What seemed to cause it to start? This answer may indicate a major contributing factor that can be changed. 25 26 P A R T I I N I T I A L E V A L U A T I O N 4. What makes it feel worse? Intuitively, these should be activities that traditionally aggravate TMD, i.e., eating, clenching, stress, etc. This list can help you motivate the patient to change these activities. Observe for activities that should not worsen TMD and suggest the patient may have a disorder other than TMD, e.g., symptoms worse when bear down for a bowel movement. 5. What makes it feel better? Reinforce the use of these activities. Also, look for activities that suggest the patient may have a disorder other than TMD, e.g., better when taking antibiotics. 6. What treatments have you received? Were these treatments benefi cial? These indicate the level of care the patient will need. Did patient receive a TMJ implant that should be followed? 7. When is your pain the worst? When fi rst wake up ___ Later in the day ___ No daily pattern ___ Other ___ Helps identify the signifi cance of nighttime and/or daytime contributing factors and gives a guide to therapy considerations (see “ Integrating Conservative Therapies ” in chapter 19 ). 8. What does the pain keep you from doing? Refl ects how much it affects the patient and may correlate with how motivated the patient will be to participate in therapy and the level of therapy the patient may be interested in receiving. 9. Is your pain (check as many as apply): Ache ___ Pressure ___ Dull ___ Sharp ___ Throbbing ___ Burning ___ Other ___ “ Ache, ” “ pressure, ” or “ dull ” are the usual qualities of TMD pain. Sharp usually occurs intermittently and is often associated with the TMJ or lateral pterygoid muscle. Throbbing pain occurs in one or more of the following three situations: a. Ache, pressure, or dull is the primary pain quality and when the pain worsens, it changes to throbbing pain. If treatment of the ache, pressure, or dull can adequately keep it from escalating into the throbbing pain, the throbbing pain will be eliminated. b. The patient does not report that the ache, pressure, or dull pain progresses into throbbing pain. This pain may be due to a source outside of the dentist’ s realm of C H A P T E R 2 R E V I E W O F T H E “ I N I T I A L P A T I E N T Q U E S T I O N N A I R E ” 27 treatment. The practitioner may desire to perform a trial with occlusal appliance therapy and if it is not effective, consider a referral to the patient’ s physician or neurologist for the probable migraine. Studies suggest some migraines respond to TMD therapy. c. Referred tooth pain; items suggestive of this are asked in item 10. I f burning is in the background of ache, pressure, or dull pain, the burning generally resolves as the TMD improves. If burning is the primary pain quality, this suggests it may be neuropathic pain. 10. Does your pain: Wake you up at night? Yes ___ No ___ TMD rarely awakes patients from their sleep, but cervical pain and referred tooth pain will commonly awake patients. Increase when you lie down? Yes ___ No ___ Could be related to how the mandible is positioned on a pillow, but also sinus conges- tion or referred tooth pain. Increase when you bend forward? Yes ___ No ___ Could be related to gravity ’ s pull on the mandible, but also to sinus congestion. Increase when you drink hot or cold beverages? Yes ___ No___ TMD pain does not often increase when hot or cold beverages are drunk. What tooth or area does it touch that elicits this response? This response could be due to referred tooth pain. See “ I ntraoral Examination” in chapter 3 for more information on referred tooth pain. 11. Please circle the number below to indicate your present pain level. (No pain) 0 - 1 - 2 - 3 - 4 - 5 - 6 - 7 - 8 - 9 - 10 (The worst pain imaginable) 12. Please circle your average pain level during the past 6 months. (No pain) 0 - 1 - 2 - 3 - 4 - 5 - 6 - 7 - 8 - 9 - 10 (The worst pain imaginable) 13. Is your pain always present? Yes ___ No ___ How often do you have it? 14. Please describe any other symptoms that you associate with your problem. Look for anything that does not make sense (may be suggestive of non - TMD), e.g., blacking out, decrease in visual fi eld, etc. 28 P A R T I I N I T I A L
E V A L U A T I O N A progressively increasing open bite of the anterior teeth is suggestive of severe osteoar- thritis causing the condyle to lose its vertical height, and is beyond the scope of this book. A posterior open bite or midline shift could be suggestive of many disorders; see “ Intraoral Examination ” in chapter 3 for more information. Items #15 – 17 evaluate for non - TMD. Talk to the patient about any “ Yes ” answer and consider the comments noted after the items. 15. Have you had: Head or neck surgery? Yes ___ No ___ Is patient ’ s complaint a surgical complication or recurrence from this? Whiplash or trauma to your head or neck? Yes ___ No ___ Is patient ’ s TMD related to this event? If so, was patient adequately evaluated? Does the patient have a neck disorder contributing to the TMD? Shingles on your head or neck? Yes ___ No ___ Does the patient have postherpetic neuralgia? 16. Do you have: A fever? Yes ___ No ___ TMD does not cause an elevated temperature. Does patient have another disorder that may be causing this, e.g., meningitis, sinus infection, etc.? Consider referring patient to physician if this has not been evaluated. Nasal congestion or stuffi ness? Yes ___ No ___ Is sinus pain the cause for the complaint or contributing to the TMD pain? Movement diffi culties of your facial muscles, eyes, mouth, or tongue? Yes ___ No ___ Does the patient have a neurological disorder? Patients often report diffi culty moving their more painful structures. Numbness or tingling? Yes ___ No ___ Is it something more than TMD causing this neurological defi cit? Patients often report small areas of numbness or tingling with a temporal and spatial relationship to their TMD complaint, which correlates with their TMD pain and resolves with TMD therapy. Observe to ensure it resolves. C H A P T E R 2 R E V I E W O F T H E “ I N I T I A L P A T I E N T Q U E S T I O N N A I R E ” 29 Problems with your teeth? Yes ___ No ___ Does patient have a tooth problem causing or contributing to the TMD? Swelling over your jaw joint or in your mouth or throat? Yes ___ No ___ Evaluate the swelling; it may be causing or contributing to the TMD pain. TMD patients often report swelling over their painful TMJ or masticatory muscles (see chapter 1 and item 14), but this swelling is diffi cult to visually discern (often only 1 – 2 mm). If it is in a different location or more signifi cant, further evaluation is needed. A certain spot that triggers your pain? Yes ___ No ___ Does the patient have trigeminal neuralgia or some other localized problem? If the patient only has TMD, this spot is often the source of the primary diagnosis. Recurrent swelling or tenderness of joints other than in your jaw joint? Yes ___ No ___ Does patient have arthritis or some other systemic disorder contributing to the TMD? Morning stiffness in your body, other than with your jaw? Yes ___ No ___ This can be of muscle and/or joint origin, may be related to a systemic disorder, and may contribute to the TMD. Keep in mind patients with widespread body pain do not respond as well to TMD therapy. Muscle tenderness in your body (other than in your head or neck) for more than 50% of the time? Yes ___ No ___ Does patient have fi bromyalgia, myofascial pain, or a systemic disorder? 17. Is your problem worse: When swallowing or turning your head? Yes ___ No ___ Consider: cervical pain, Eagle ’ s syndrome, glossopharyngeal neuralgia, subacute thy- roiditis, etc. After reading or straining your eyes? Yes ___ No ___ Patient may need a new eyeglass prescription or reading glasses, may have a cervical disorder exacerbated by poor posture during the activity, or may clench during this activity. 30 P A R T I I N I T I A L E V A L U A T I O N 18. Do your jaw joints make noise? Yes ___ No ___ If yes, which: Right ___ Left ___ If yes, the patient most likely has a disc displacement. 19. Have you ever been unable to open your mouth wide? Yes ___ No ___ If yes, please explain: Could be due to a TMJ disorder (e.g., acute disc displacement without reduction) or a muscle disorder. If present, practitioner may need to stretch patient ’ s mouth beyond the restriction to determine location of restriction; see “ Additional Evaluations ” in chapter 3 for more information. 20. Have you ever been unable to close your mouth? Yes ___ No ___ If yes, please explain: If it occurred at an opening over 45 mm, the condyle was probably in front of the eminence and the eminence and/or disc was interfering with the condyle’ s posterior movement. I f it occurred at an opening 10 – 35 mm, the condyle was probably unable to move under the posterior band of the disc and return onto the retrodiscal tissue. I f it occurred at an opening less than 5 mm, it was probably a lateral pterygoid myospasm. 21. Do you sleep well at night? Yes ___ No ___ Please explain: Patients should wake up feeling rested. TMD patients who do not sleep well are less likely to obtain TMD symptom improvement from TMD therapy. Individuals with fi bromyalgia or post traumatic stress disorder (PTSD) often report they do not sleep well. You may want to consider asking the patient to discuss this with his or her physician, or referring the patient for relaxation therapy or to someone who specializes in sleep disorders. If the patient also wakes up with morning TMD pain, you may want to prescribe amitriptyline or nortriptyline. 22. How often are you tense, aggravated, or frustrated during a usual day? Always ___ Half the time ___ Seldom ___ Never ___ If always or half the time is checked, consider referring patient for stress management to learn coping skills. Patients tend to hold more tension in their jaws or clench their teeth during these times. 23. How often do you feel depressed during a usual day? Always ___ Half the time ___ Seldom ___ Never ___ If always or half of the time is checked, consider referring patient for an evaluation. I let patients choose whether they prefer to see a psychologist (treat through talking with C H A P T E R 2 R E V I E W O F T H E “ I N I T I A L P A T I E N T Q U E S T I O N N A I R E ” 31 patients), psychiatrist (a physician who primarily treats through medications that provide temporary relief ), or both. 24. Do you have thoughts of hurting yourself or committing suicide? Yes ___ No ___ If yes, determine lethality by asking the patient whether he or she has a plan, a time selected, and the selected means of carrying this out (pills, gun, etc.). If the answer is yes to any of these, the patient must immediately be evaluated by someone trained in this area. A good option is to telephone your local hospital ’ s suicide prevention team and discuss whether immediate referral is necessary. If it is, the patient must be escorted (i.e., by a staff member, responsible family member, or a staff member sent by the hospital). Document your fi ndings, actions, and follow up on your referral. 25. Do you play a musical instrument and/or sing more than 5 hours in a typical week? Yes ___ No ___ This often contributes to the patient ’ s TMD symptoms. 26. What percent of the day are your teeth touching? ____% As patients hold their teeth together, there is a tendency to unconsciously squeeze as life becomes busy, intense, etc. Encourage patients to keep their teeth apart and relax their jaws. 27. Are you aware of clenching or grinding your teeth: When sleeping? ___ While driving? ___ When using a computer? ___ Other times? ___ Not aware? ___ Encourage the patient to stop clenching or grinding at checked times and become aware of other times he or she may be doing this. 28. Are you aware of oral habits such as: Chewing your cheeks? ___ Chewing objects? ___ Biting your nails or cuticles? ___ Tapping your teeth together? ___ Thrusting your jaw? ___ Other habits? ___ Not aware? ___ Encourage the patient to break checked oral habits. 29. What treatment do you think is needed for your problem? Recommend you discuss the patient ’ s treatment expectations. 32 P A R T I I N I T I A L E V A L U A T I O N 30. Is there anything else you think we should know about your problem? 31. If your age is 50 or older, please circle the correct response: Does your pain occur only when you eat? Yes ___ No ___ Are you pain free when you open wide? Yes ___ No ___ Do you have unexplainable scalp tenderness? Yes ___ No ___ Are you experiencing unexplainable or unintentional weight loss? Yes ___ No ___ Do you have signifi cant morning stiffness lasting more than a half hour? Yes ___ No ___ Do you have visual symptoms or a visual loss? Yes ___ No ___ These features are more prevalent among individuals who have giant cell arteritis (temporal arteritis). Giant cell arteritis is almost exclusively found in people over the age of 50. It causes a reduction in the blood fl ow to the structures of the head and neck. The decreased masticatory muscle blood fl ow causes the muscles to tire easily, producing a tired, cramped feeling that resolves within 1– 2 minutes after use. This symptom is also observed among some TMD patients without giant cell arteritis, and these questions are to help differentiate the cause. If the patient has had this symptom for over a year, it is highly unlikely that he or she has giant cell arteritis. Giant cell arteritis is an important disorder not to miss because it may progress to cause blindness. It is better to err with an unnecessary referral than allow this disorder to go undiagnosed. If you suspect the patient has giant cell arteritis, he or she should see a physician that day. A “ Yes ” response to the fi rst two questions is suggestive of jaw claudication, but a TMD patient with mild TMD symptoms may positively respond to both questions. Consider giant cell arteritis when the patient relates unexplainable scalp tenderness, unexplainable or unintentional weight loss, signifi cant morning stiffness lasting more than a half hour, and visual symptoms or visual loss. A fever (previously asked in the questionnaire) is also more prevalent among individuals who have giant cell arteritis. If this is not due to a dental condition and has not been evaluated by a physician, I recommend he or she be referred for an evaluation. Another sign of giant cell arteritis is an abnormal temporal artery. This is evaluated by comparing the left and right temporal arteries. Relative to the other side, an abnormal vessel will be more visible, have no pulse, or have palpable nodes. Chapter 3 Clinical Examination FAQs Q: Which should be performed fi rst: measurement of the range of motion or palpation? A: The range of motion should be measured prior to palpating, because palpation often aggravates the masticatory muscles and/or TMJs, which may cause a decrease in a patient ’ s range of motion. Q: What is considered to be the minimum of normal range of motion? A: A general guide for minimum of normal is 40 mm opening (including the overlap), 7 mm right and left lateral, and 6 mm protrusive movements. Q: Can a dentist write prescriptions or refer a patient for neck pain? A: Cervical treatment and referrals are within a dentist ’ s scope of clinical practice for TMD. Q: If
odontogenic pain is suspected of contributing to a patient ’ s TMD pain, what are the clinical observations that may aid in locating the offending tooth? A: Anterior teeth (canine to canine) have been observed referring odontogenic pain bilaterally, whereas the premolars and molars have been observed referring pain only to the ipsilateral side. Substantial information should have been strong suspicions as to which structures are obtained from the patient interview suggesting concerns and need further evaluation. whether the patient has TMD, other disorders that could contribute to TMD (e.g., odontal- QUICK CONSULT gia, sinusitis, neck pain, or cervicogenic Obtaining Suspicions of Structures headaches), many TMD contributing factors, That Are a Concern and the symptom location and time patterns. Fr om the patient interview, the practitioner should Consequently, prior to performing the clinical have strong suspicions as to which structures are examination, the practitioner should have concerns and need further evaluation. 33 34 P A R T I I N I T I A L E V A L U A T I O N The primary purpose of the clinical exami- patient with a frontal sinus headache that can nation is to gather additional information to be exacerbated by palpating a cervical trigger help confi rm or rule out structures involved in point (due to referred pain) may desire to a patient ’ s complaints and other suspected have an anesthetic injection of the trigger disorders that may contribute to these com- point to determine the amount the trigger plaints. A potential source can be verifi ed by point is contributing to the sinus pain. observing whether stimulating (e.g., palpation, cold to a tooth) a structure causes the pain to be reproduced (if not present) or exacerbated RANGE OF MOTION (if present), or whether anesthetically blocking or alleviating the structure by other means The patient ’ s range of motion should be decreases the pain. measured prior to palpating, because palpa- tion often aggravates the masticatory muscles QUICK CONSULT and/or TMJs, which may cause a decrease in Verifying Potential Sources the range of motion. Recording the range of A potential source can be verifi ed by observing motion enables the practitioner to determine whether stimulating a structure causes the pain whether the patient has a signifi cant decrease to be reproduced (if not present) or exacerbated (suggestive of certain disorders) and to follow (if present), or whether anesthetically blocking or an objective measure for improvement. (An alleviating the structure by other means increase in a restricted range of motion decreases the pain. suggests improvement.) Many range - of - motion measures can be performed, e.g., Typically palpation is used to stimulate the assisted, unassisted, without pain, and despite masticatory muscles and the TMJs. Generally pain. more than one structure is the source of a The opening measurement routinely TMD patient ’ s pain. Some practitioners grade obtained is the distance (in millimeters) the palpation tenderness between 0 and 3 for between the incisal edge of the maxillary more defi nitive documentation and to help central incisors and the incisal edge of the prioritize a structure ’ s contribution. mandibular central incisors when I request of Some of the procedures used to anestheti- the patient, “ O pen as wide as you can” cally block or alleviate potential pain sources (Figure 3.1 ). Since practitioners may follow a are (1) a trigger - point anesthetic injection for patient ’ s opening measures from appointment an individual myofascial trigger point, (2) an to appointment, it is important that practitio- anesthetic infi ltration or block for a tooth, ners try to be consistent in how the patient is and (3) a trial of antibiotics and decongestants asked to open. Therefore, the phrase and (e.g., Augmentin [amoxicillin/clavulanate] intonation should be consistent at every 500 mg, 1 tab b.i.d. for 10 days and Sudafed appointment. [pseudoephedrine HCl] 60 m g, 1 tab 4– 6 hours [both have generic formulations]) for the suspected contribution of sinus conges- TECHNICAL TIP tion. Obviously one limiting factor for the Opening Consistency anesthetic test is that the pain must be present S ince a patient ’ s opening may be followed from when the test is performed. appointment to appointment, practitioners Sometimes structures are both stimulated should try to be consistent in how the patient is and injected with anesthetic. For example, a asked to open. C H A P T E R 3 C L I N I C A L E X A M I N A T I O N 35 Figure 3.1. Measuring the opening incisal edge to Figure 3.2. Measuring the vertical overlap of the incisal edge. central incisors. The true distance a patient opens includes the maxillary incisors and pressing the teeth the vertical overlap of the central incisors. apart by moving the fi ngers in a scissor - type This can easily be determined by asking the motion (Figure 1.2 ). The patient will usually patient to close into maximum intercuspation feel tightness or pain at the location of the (MI), placing a fi ngernail on the facial surface restriction. Clinical experience has shown that of the mandibular central incisor against the not all patients accurately point to the stretched maxillary central incisor ’ s incisal edge, asking discomfort location, and it is necessary to the patient to open, and measuring the palpate the TMJ and musculature to reproduce distance from the mandibular central incisor’ s the discomfort to identify its origin. incisal edge to the fi ngernail (Figure 3 .2 ). Only the vertical overlap is routinely docu- TECHNICAL TIP mented at the initial appointment, and the Determining Origin of Patient ’ s incisal- t o - incisal openings are followed at Restricted Opening future appointments. Measuring and adding I f a patient’ s mouth opening is signifi cantly the overlap at each appointment adds poten- restricted, the practitioner may be able to tial for error, and it rarely changes throughout determine the restriction ’ s origin by stretching treatment. the mouth wider. If a patient ’ s mouth opening is signifi cantly restricted, the practitioner may be able to A patient who has a signifi cantly limited determine the restriction ’ s origin by stretching opening is told about the practitioner’ s need the mouth wider, usually by placing the index to look down the patient ’ s throat. Place the fi nger over the incisal edges of the mandibular head of a mouth mirror against the posterior incisors and the thumb over the incisal edges of portion of the tongue, press down on the 36 P A R T I I N I T I A L E V A L U A T I O N Figure 3.3. Measuring lateral movement. mirror, and ask the patient to say “ Ah ” and Figure 3.4. Measuring the distance the open as wide as possible. Occasionally a mandibular incisors are in front of the maxillary patient who could open only 21 m m may now incisors. open 45 mm. There are many potential The protrusive movement can be obtained reasons the patient did not previously open as by asking the patient to close in MI and wide, and these need to be discussed to the measuring the anterior overjet. The patient is practitioner ’ s satisfaction. then asked to slide the lower jaw as far Lateral movements can be measured by forward as possible while the practitioner asking the patient to close into MI and measures the distance the mandibular incisors placing a ruler over the maxillary central are in front of the maxillary incisors and incisors with the mandibular central incisors’ adding the two numbers together embrasure lined with one of the prominent (Figure 3.4 ). ruler marks (e.g., the 30 - mm mark). The As the patient makes these movements, the patient is asked to move his or her mandible practitioner observes for the translation of as far as possible to one side while the practi- each condyle. If it is suspected that translation tioner observes the distance the embrasure has is restricted on one or both condyles, it is moved on the ruler; then the patient is asked recommended he or she feel the condyles for to move the mandible in the other direction their translations. This is performed by (Figure 3.3 ). In general, people do not placing the palmar surface of the index or consciously move their mandible laterally, so middle fi nger over the condyle and asking the some have diffi culty when asked to do so. patient to open, close, and move the mandible This can usually be resolved by the practitio- in right lateral, left lateral, and protrusive. ner demonstrating these movements and asking the patient to practice them in a hand TECHNICAL TIP mirror. Observing Restricted T MJ Translation I f the practitioner suspects a patient’ s condylar TECHNICAL TIP translation is restricted, it is recommended the Enabling a Patient to Make practitioner feel the condyles for their Excursive Movements translations. I f a patient has trouble making lateral or protru- sive movements, asking him or her to practice Slight to moderate restriction in the range these by looking into a hand mirror is usually of motion is commonly observed among benefi cial. TMD patients. However, range of motion C H A P T E R 3 C L I N I C A L E X A M I N A T I O N 37 varies with a patient ’ s stature, and the degree of restriction is not always related to severity of TMD symptoms. No minimum of normal ranges has been established, but a general guide for minimum of normal is 40 m m opening (including the overlap), 7 m m right and left lateral, and 6 mm protrusive movements.1 TMJ NOISE TMJ clicks and pops are very prevalent Figure 3.5. Roughness on the condylar surface among TMD patients as well as in the general with a portion of the articular fi brous connective population.2 ,3 Crepitus is a grating or crack- tissue removed to expose the osseous surface. ling noise similar to the sound that is created when one walks over gravel. These noises may other side several times. The click or pop is occur with opening and/or closing, fl uctuate generated during the translation phase, and in intensity, and occur sporadically.3 ,4 It is whichever TMJ was translating when the noise common for patients to report having a was generated is the source. history of TMJ noise but be unable to Clicking and popping are most commonly reproduce it during the examination. 4 related to a disc displacement with reduc- Practitioners vary in the degree to which tion,5 ,6 while crepitus is most commonly they try to verify the TMJ noise. Some related to roughness on the articular palpate for the noise by placing the fi nger ’ s surface(s), which could be secondary to palmar surface over the TMJ as the patient osteoarthritis (Figure 3.5 ), chronic disc opens, closes, and moves through lateral and displacement without reduction, or polyarthri- protrusive excursions. Others use a stetho- tides. 7 Crepitus is sometimes subcategorized as scope to listen for the noise during these either coarse or fi ne crepitus, based upon how movements. The bell - shaped portion of the pronounced the noise is. For additional stethoscope should be used because, when the information on these diagnoses, see “ T MJ fl at portion of the stethoscope is used, a hair Articular Disorders ” in chapter 5 . or whisker stub under the fl at portion often TMJ noise rarely changes my treatment sounds remarkably similar to TMJ crepitus. approach, so spending extensive time or using Some practitioners use even more sensitive specialized equipment to verify the noise is equipment (e.g., Doppler) in an attempt to unwarranted. In general, TMJ noise is no verify the TMJ noise. 1 more of a concern than is noise in any other Sometimes the patient and the practitioner joint in the body, and asymptomatic TMJ have trouble distinguishing which TMJ is noise does not need to be treated. 7 If the noise generating the click or pop, because the is associated with catching or intermittent vibration can travel through the mandible and locking, I am concerned this may
progress to be perceived in the contralateral TMJ. This can a permanent lock, 8 so I recommend TMD usually be differentiated by having the patient therapy that would most effectively eliminate start in MI and move the mandible lateral to this; see chapter 1 0, “ A cute TMJ Disc Dis- one side several times and then lateral to the placement without Reduction. ” 38 P A R T I I N I T I A L E V A L U A T I O N QUICK CONSULT The muscle and TMJ palpations attempt to Understanding T MJ Noise stimulate these structures suffi ciently so that, Signifi cance if they are contributing to the pain, the In general, TMJ noise is no more of a concern palpation will reproduce (if the pain is not than is noise in any other joint in the body, and present) or exacerbate (if the pain is present) TMJ noise alone does not need to be treated. it. The extent to which the practitioner must palpate varies with the ease of reproducing the TMJ noise generally decreases with TMD patient ’ s symptoms; e.g., a patient with therapy but is less responsive to therapy than exquisite tenderness generally relates light are most TMD symptoms.9 It tends to touch reproduces the pain, whereas a muscu- fl uctuate over time and correlates with jaw lar man who has not had the pain for a fatigue, tooth clenching, and tooth grinding. 10 couple of weeks may need forceful palpation The percentage of patients observing improve- to reproduce his pain. ment varies from study to study along with As a point of reference, the TMD Research the procedures used to measure the noise. If a Diagnostic Criteria1 1 recommend using 2 patient were to ask for the probability that his pounds for extraoral muscles and 1 pound on or her noise would decrease, as a general the TMJ and intraoral muscles, but more conservative guide I would inform the patient force may be necessary to generate a patient’ s that from occlusal appliance therapy approxi- chief complaint. It is the author’ s teaching mately a third of patients report signifi cant experience that most practitioners are initially noise reduction or elimination, a third report reluctant to use suffi cient force to reproduce minor improvement, and a third report no the TMD symptoms. Conversely, excessive improvement. 8 There are no established force causes unnecessary palpation and predictors to suggest a specifi c individual ’ s postexamination pain. results. QUICK CONSULT TMD PALPATIONS Palpating Force I t is the author ’ s teaching experience that most The masticatory and cervical muscles and practitioners are initially reluctant to use suffi - TMJs are generally palpated with the fi ngertip cient force to reproduce the TMD symptoms. or palmar surface of the index or middle Conversely, excessive force causes unnecessary fi nger. If applicable, the forces placed on the palpation and postexamination pain. head are balanced by simultaneously palpating both sides or stabilizing the head by placing Palpation may generate pain within or the palm of the nonpalpating hand on the beyond the structure and/or generate referred contralateral side. It is recommended the pain to a distant location. A variety of palpa- practitioner face the patient during the tion techniques provide varying degrees of palpation rather than stand behind the stimulation to the structure. The degree of patient. In this position the practitioner can stimulation in addition to the sensitivity of observe the patient ’ s eyes and facial expres- the structure govern which of these responses sions, for the eyes generally start to open occur. In general, three palpation techniques wider or start to close as tenderness is gener- are used to provide different stimulation ated. The muscles and TMJs are palpated intensities: (1) nonspecifi c palpation in a with the muscles relaxed, and healthy muscles predetermined location; (2) palpation of a do not hurt when palpated.8 trigger point or nodule of spot tenderness C H A P T E R 3 C L I N I C A L E X A M I N A T I O N 39 within the muscle (these are localized, fi rm, hyperirritable nodules that feel like fi rm knots within the muscle and are more tender than the surrounding muscle); and (3) fi rm, sustained palpation of these tender nodules. It is recommended a tiered palpation approach be used. Initially palpate the anterior region of the temporalis muscles, TMJs, and masseter muscles bilaterally in predetermined locations and attempt to generate referred pain from the carotid artery, thyroid, and the muscles just below the occipital protuberance. Start by palpating the anterior region of the temporalis muscle, TMJs, and masseter muscle; begin with light pressure and slowly increase the force until the patient’ s eyes or facial expressions convey that the patient is experiencing discomfort. Clinical experience has shown the eyes and face express discom- fort prior to patients verbally responding to Figure 3.6. Palpation of the anterior region of the the discomfort. As the practitioner palpates, temporalis muscle. the patient is asked whether the palpation is causing discomfort and whether this is his or regions. The muscle fi ber direction and the her pain complaint. direction the fi bers move the mandible vary with each region segment. All three regions TECHNICAL TIP may be tender to palpation, have tender Reducing Palpation Discomfort nodules, and be a source of the pain. Bilater- I t is recommended the practitioner face the ally palpate the anterior region of the patient during the palpation, so he or she can temporalis muscle approximately 1 and better observe the patient ’ s eyes and facial 1/2 inches behind the eye canthus and a half expressions; these generally express discomfort inch above the zygomatic arch (Figure 3.6 ). prior to patients verbally responding to the If the anterior region of the temporalis discomfort. or any other muscle is tender to palpation, the most probable diagnosis is myofascial After palpating these structures, rule out pain. Ideally the practitioner would identify other specifi c disorders by palpating the trigger points to arrive at this diagnosis, but carotid arteries, the thyroid, and the suboc- they may be diffi cult to discern, even for cipital protuberance area of the splenius practitioners experienced in palpating capitis and trapezius muscles. Additional muscles.1 2 From a clinically practical view- specifi c guidance regarding the palpation of point, if the muscle is tender to palpation and this fi rst tier, as well as supplementary infor- no other muscle diagnosis in chapter 5 mation, is provided below, and a synopsis is ( “ TMD Diagnostic Categories ” ) better provided in Table 3.1 . describes the patient’ s condition, it is recom- The temporalis muscle is often segmented mended the muscle tenderness be diagnosed into the anterior, middle, and posterior as myofascial pain. 40 P A R T I I N I T I A L E V A L U A T I O N Table 3.1. Recommended initial palpations. Anterior region of the Bilaterally palpate approximately 1½ inches behind the eye canthus and 1/2 inch above temporalis muscle the zygomatic arch (Figure 3 .6 ). TMJ T hree areas of the TMJ need to be palpated bilaterally, and any one of these can be tender without tenderness of the others. A common mistake is not having the patient open suffi ciently to adequately palpate the TMJ. (1) Ask the patient to open approximately 20 mm and palpate the condyle’ s lateral pole. (2) Ask the patient to open as wide as possible and palpate the depth of the depression behind the condyle with the fi ngertip. (3) With the fi nger in the depression, pull forward to load the posterior aspect of the condyle (Figure 3 .7 ). Masseter muscle Bilaterally palpate the center of the masseter muscle (Figure 3 .8) . If unsure of the muscle ’ s extent, ask the patient to clench, and its extent can easily be felt. Carotid artery Bilaterally palpate the carotid arteries on both sides of the thyroid cartilage (Figure 3 .9 ). This rules out carotidynia as a contributor for patients who relate this palpation does not reproduce their pain complaint. Thyroid I nitially touch the suprasternal notch and then bilaterally palpate approximately 1 inch superior and 1 inch lateral to the notch (Figure 3 .10) . This rules out thyroiditis as a contributor for patients in whom this palpation does not reproduce their pain complaint. Splenius capitis This muscle is located in the depression just posterior to the sternocleidomastoid muscle muscle along the base of the skull. Find the fi rm nodules within this muscle along the skull base. Palpate approximately 1 inch below the skull so these nodules are compressed up against the skull base. Press to patient tolerance and hold for approximately 5 seconds, attempting to generate referred pain. The head is stabilized during palpation by placing the palm of the other hand over the forehead (Figure 3.12 ). Trapezius muscle Find the fi rm nodules within this muscle along the base of the skull. Palpate approximately 1 inch below the skull so these nodules are compressed up against the skull base. Press to patient tolerance and hold for approximately 5 seconds, attempting to generate referred pain. The head is stabilized by placing the palm of the other hand over the forehead (Figure 3.13 ). It is estimated that, among the TMD Diagnostic Categories” ) better describes the patients I evaluate who have muscle tender- patient ’ s condition. ness, more than 95% of the time I diagnose the muscle tenderness as myofascial pain. Clinically it has been observed that the Also, masticatory muscle is the most common TMJ needs to be palpated in three locations. source of TMD pain, so myofascial pain is the Tenderness in one of these locations is not most common diagnosis for TMD pain. 13 necessarily associated with tenderness in another. Palpate the fi rst location by asking FOCAL POINT the patient to open approximately 20 m m and Muscle palpation tenderness generally provides palpating the condyle’ s lateral pole. Then ask a clinical diagnosis of myofascial pain, unless the patient to open as wide as possible while another muscle diagnosis in chapter 5 ( “ TMD you palpate the depth of the depression C H A P T E R 3 C L I N I C A L E X A M I N A T I O N 41 Figure 3.8. Palpation of masseter muscle. sections of the muscle (Figure 3 .8) . If the practitioner is unsure of the muscle’ s center, it can easily be delineated by asking the patient to clench his or her teeth while the practitio- ner palpates the extent of the muscle. If the muscle is tender to palpation and no other Figure 3.7. Palpation of the TMJ. muscle diagnosis in chapter 5 ( “ TMD Diag- nostic Categories ” ) better describes the behind the condyle with your fi ngertip. patient ’ s condition, it is recommended the Finally, with the fi nger in the depression and muscle tenderness be diagnosed as myofascial the mouth open wide, pull forward to load pain. the posterior aspect of the condyle The carotid arteries are palpated on both (Figure 3.7 ). sides of the thyroid cartilage to determine Tenderness of the TMJ suggests the patient whether stimulating these structures repro- has capsulitis and/or synovitis, but this cannot duces a patient ’ s pain (Figure 3.9 ). This area be differentiated clinically, so the clinical is tender for most individuals, so, prior to this diagnosis is TMJ infl ammation. Clinical palpation, it is recommended that the practi- training experience has shown that most tioner has palpated this structure on himself practitioners do not adequately palpate the or herself to determine the force that would TMJ, and the most common mistake is that not cause undue discomfort. The patient may the patient ’ s mouth is not open wide enough. relate the palpation generates discomfort, but TMJ infl ammation is the second most this is different from his or her pain. If this common diagnosis for TMD pain. 13 palpation brings on the patient’ s pain com- plaint, it suggests carotidynia is causing or
FOCAL POINT contributing to the pain and a referral should TMJ palpation tenderness provides a clinical be made to the patient’ s physician. diagnosis of TMJ infl ammation. Bilaterally palpate the t hyroid . If unsure of its location, fi rst touch the suprasternal notch The masseter muscle is composed of a to establish the landmarks and then bilaterally superfi cial portion and a deep portion. palpate the thyroid at approximately 1 i nch Bilaterally palpating the center of the masseter superior and 1 i nch lateral to the notch muscle will simultaneously stimulate both (Figure 3.10 ). If this palpation reproduces the 42 P A R T I I N I T I A L E V A L U A T I O N It is important to attempt to generate referred pain from the s plenius capitis (located in the depression just posterior to the sternocleidomastoid muscle along the base of the skull) and trapezius muscles , because referred cervicogenic pain is relatively prevalent among TMD patients. A study of 230 TMD patients found palpation of the splenius capitis and trapezius muscles generated referred pain to the temporalis muscle region in 18 and 31 patients, respectively. This study observed that palpating these muscles just below the occipital protuberance was one of the most common sources for generating referred pain to the forehead, periorbital, vertex, temple, occipital, postauricular, and ear.1 4 QUICK CONSULT Identifying Referred Pain from Figure 3.9. Palpation of the carotid arteries. the Neck R eferred pain from the neck is relatively preva- lent among TMD patients. Palpating the neck muscles just below the occipital protuberance most commonly generates referred pain to the forehead, periorbital, vertex, temple, occipital, postauricular, and ear. TMD pain commonly occurs in the temporalis and/or masseter muscle region, and I have observed some dentists automatically diagnosing patients with pain in this location as having TMD. It is not uncommon to observe patients with pain in this location having mild to moderate temporalis and/or masseter muscle palpation tenderness, and then when their suboccipital muscles are palpated, their eyes “ l ight up” with the temporalis or masseter muscle pain complaint. As explained in chapter 1 , central sensitization and convergence are the primary mechanisms Figure 3.10. Palpation of the thyroid. behind referred pain and can cause neck pain to appear as typical TMD pain (Figure 3 .11) . pain, this suggests thyroiditis is causing or If these patients were treated with traditional contributing to the pain and a referral should TMD therapies, there is a low probability that be made to the patient’ s physician. they would obtain satisfactory symptom relief. C H A P T E R 3 C L I N I C A L E X A M I N A T I O N 43 Figure 3.11. A depiction of central convergence enabling cervical pain to be perceived as temporalis and masseter muscle pain. This is one of the reasons I evaluate every TMD patient for referred cervical pain. F OCAL POINT The neck can be the source for referred pain to the temporalis or masseter muscle region, which is the most common location for TMD pain. Prior to attempting to generate referred pain from either the splenius capitis or trapezius muscles, palpate the muscle to fi nd the most tender nodules within the muscle Figure 3.12. Palpation of the splenius capitis along the skull base. Then press the fi ngertip muscle. approximately 1 inch below the skull, up against the skull base, so each nodule is the patient whether pain is being felt in any compressed between the fi ngertip and skull location other than the palpation site. base. Press to patient tolerance (a considerable T he forehead and periorbital (in, behind, or amount of force may be needed) and hold for around the eyes) areas are very common sites approximately 5 seconds. The head is stabi- to which these muscles refer pain. It is lized during the palpation by placing the palm believed that practitioners who have not of the other hand over the forehead. See previously palpated these muscles in this Figure 3 .12 for palpation of the splenius manner will be surprised by the frequency capitis muscle and Figure 3 .13 for the trape- with which referred pain is generated from the zius muscle. As these muscles are palpated, ask cervical region. A case scenario of a patient 44 P A R T I I N I T I A L E V A L U A T I O N Once found, apply pressure to each nodule. This will generate more intense pain within that muscle, generate pain that may go beyond the structure, and will sometimes refer pain to distant locations. If such a nodule cannot be found, then fi rmly palpate any tender areas within the muscle. The TMJ can be similarly stimulated more intensely by palpating its tender locations more vigorously. If this second tier did not reproduce the patient ’ s pain and the practitioner believes this Figure 3.13. Palpation of the trapezius muscle. location is the source of the pain, a more intense palpation can be employed, which is typically used when attempting to generate with chronic forehead pain referred from the referred pain. This is accomplished by fi rst neck is presented in “ Case 3 ” in part V. identifying the tender nodules within the Clinically it has been observed that the vast muscle or locations within the TMJ, applying majority of TMD patients have their pain sustained pressure to these sites up to patient reproduced by employing only these initial tolerance, and holding it for at least 5 seconds recommended palpations. If a patient ’ s pain or until the anticipated pain is elicited. This was reproduced by palpating these sites, it is generates greater local pain that may go felt that additional masticatory muscle palpa- beyond the structure and/or referred pain to tion would only cause more discomfort and distant locations. To determine where referred have little likelihood of changing the diagno- pain is being generated to a distant location, ses and treatment plan. Stopping the palpa- ask the patient whether pain is being felt at a tion evaluation for these patients is justifi ed location other than where the practitioner is because (1) the initial recommended palpa- pressing. Each nodule within a muscle may tions have demonstrated the pain is from refer pain to a different location; therefore, masticatory structures, (2) most conservative this palpation technique may need to be TMD therapies treat all the masticatory repeated for each tender nodule. structures, (3) a muscle and joint contribution The choice of whether to more intensely comparison can be made with the information palpate in the same location or attempt to obtained, and (4) other structures that reproduce the patient ’ s pain from a different commonly refer to the masticatory system or location varies with the practitioner’ s suspi- whose source is important to rule out are part cions and clinical experience. For practitioners of the initial recommended palpations. who have not yet developed this clinical If the initial palpations were not able to experience, Figure 3 .14 provides maps of reproduce the patient ’ s pain, more extensive palpation locations that have been shown to palpation is needed. A good technique for generate referred pain to the labeled anatomi- more intensely palpating muscles involves cal areas of the head and face.1 4 fi nding and loading the trigger points or For instance, with a patient complaining of nodules of spot tenderness within the muscle. maxillary dentition pain in which no local These nodules feel like fi rm knots within the etiology can be found, the practitioner may muscle and are more tender than the sur- desire to test whether it might be due to rounding muscle. referred pain from the masticatory or cervical C H A P T E R 3 C L I N I C A L E X A M I N A T I O N 45 Figure 3.14. Map of palpation locations that can generate referred pain to the labeled anatomic areas. muscles or TMJ. In Figure 3 .14, the map muscle more intensely is most likely to for “ Maxillary Dentition ” has areas of the generate referred pain to the maxillary denti- temporalis muscle, TMJ, and masseter muscle tion. If palpation of this location does not marked on the head, in addition to the lateral generate the desired referred pain, it is pterygoid area and medial pterygoid muscle recommended the practitioner palpate more annotated below. (These are intraoral intensely as previously described or try one of muscles that could not be drawn on the the less common sources. For additional head.) The masseter muscle is the location information about tooth pain not due to local marked with the color designated as the more pathology, see “ Intraoral Examination ” in this common source, so palpating the masseter chapter. 46 P A R T I I N I T I A L E V A L U A T I O N Figure 3.15. Map of palpation pain distribution generated by the labeled areas. Techniques for palpating sources not part 2 inches above the TMJs (Figure 3.16 ). The of the initial palpations are described below posterior region of the temporalis muscle is and summarized in Table 3.2 . The practitio- similarly palpated bilaterally in its central ner may fi nd the maps of palpation pain portion, above and behind the ears (Figure distribution in Figure 3 .15 helpful for identi- 3.17 ). If the predetermined location did not fying to which locations each structure has reproduce the patient’ s pain and the practitio- been shown to refer pain. ner suspects the patient ’ s pain may be from The temporalis muscle can visually be these structures, the practitioner should fi nd divided into its three segments. The middle and load the tender nodules with momentary or region of the temporalis muscle is palpated sustained pressure to increase the pain intensi- bilaterally in its central portion, approximately ties and probability of generating referred pain. Table 3.2. Additional palpations. Middle temporalis The temporalis muscle can visually be divided into its three segments. Bilaterally muscle palpate the central portion of the middle temporalis, approximately 2 inches above the TMJs (Figure 3.16) . Referred pain may be generated by locating and applying sustained pressure to the tender nodules within this segment. Posterior temporalis Bilaterally palpate the central portion of the posterior temporalis, above and behind the muscle ears (Figure 3 .17 ). Referred pain may also be generated by locating and applying sustained pressure to the tender nodules within this segment. Anterior digastric The anterior digastric muscle runs from the lingual surface of the chin, near the midline to muscle the hyoid bone. I cannot delineate this muscle from the surrounding tissue, but palpate superiorly the area this muscle transverses (Figure 3 .18) . If tenderness is observed, rule out an oral disorder causing this tenderness. If tenderness is not due to an oral disorder, referred pain may be generated by applying sustained pressure to the tender area. Posterior digastric The posterior digastric muscle runs from the hyoid sling medial to the muscle sternocleidomastoid muscle and attaches medial to the mastoid process. Place a fi ngertip posterior to the angle of the mandible and medial to the sternocleidomastoid muscle and apply the palpation force posteriorly (Figure 3 .19) . If tenderness is observed, referred pain may be generated by applying sustained pressure. Sternocleidomastoid Bilaterally palpate the sternocleidomastoid muscles by squeezing each between the muscle thumb and index fi nger. If tender, holding for 5 seconds may generate referred pain. Clinically, the more superior portions of the muscle are more likely to generate referred pain to the head and face (Figure 3 .20 ). Additional muscle Place the palm of the nondominant hand over the patient’ s forehead and the 4 cervical palpation fi ngertips of the dominant hand just below the occipital protuberance. Press in several millimeters and slowly slide fi ngertips down the neck muscles, feeling for tender nodules (Figure 3.21) . To each tender nodule, apply fi rm, steady pressure up to patient tolerance for 5 seconds, inquiring about discomfort referred to another area (Figure 3
.22 ). Similar to the sternocleidomastoid muscle, clinically the superior region tends to refer to the head and face, whereas the inferior region tends to refer into the upper back and shoulders. Lateral pterygoid area Slide the fi fth digit along the lateral side of the maxillary alveolar ridge to the most posterior region of the vestibule (the location for the posterior superior alveolar injection). Palpate by pressing in a superior, medial and posterior direction (Figure 3 .23) . If tenderness is observed, referred pain may be generated by applying heavier sustained pressure. Medial pterygoid Slide the index fi nger a little posterior to the traditional insertion site for an inferior muscle alveolar injection, until you feel muscle, and press laterally. If the patient gags, the fi nger is too posterior (Figure 3.24) . If tenderness is observed, referred pain may be generated by applying heavier sustained pressure. Coronoid process S lide the index fi nger superiorly along the anteromedial border of the ramus; as the fi nger approaches the superior extent, palpate the temporalis muscle’ s tendon overlaying the coronoid process (Figure 3 .25) . If tenderness is observed, referred pain may be generated by applying heavier sustained pressure. Stylomandibular Palpate with a blunt instrument or fi ngertip medial to the posterior border of the ligament mandible and 10– 15 mm above the angle of the mandible in an anteromedial direction (Figure 3 .26) . If tenderness is observed, referred pain may be generated by applying heavier sustained pressure. 47 48 P A R T I I N I T I A L E V A L U A T I O N Figure 3.16. Palpation of the central portion of Figure 3.18. Palpation of the anterior digastric the middle region of the temporalis muscle. muscle. The digastric muscle has an anterior and posterior belly with an intermediate tendon that slides through a fi brous sling attached to the hyoid bone. These are primarily opening muscles, and clinically I cannot delineate these muscles from the surrounding tissue. The anterior digastric muscle attaches lingual to the chin and runs near the midline to the hyoid sling. Based on the anatomical knowledge, palpate the location that the anterior digastric muscle transverses and observe for tenderness (Figure 3.18 ). If there is tenderness in this region, the practitioner should consider and rule out an oral disorder to ensure lymphade- nopathy is not the cause of this tenderness. The posterior digastric muscle runs from the hyoid sling, medial of the sternocleido- mastoid muscle, and attaches medial to the mastoid process. Palpate this muscle by placing a fi ngertip posterior to the angle of the mandible and medial to the anterior edge Figure 3.17. Palpation of the central portion of of the sternocleidomastoid muscle and press the posterior region of the temporalis muscle. posteriorly (Figure 3 .19) . If tenderness is C H A P T E R 3 C L I N I C A L E X A M I N A T I O N 49 Figure 3.19. Palpation of the posterior digastric Figure 3.20. Palpation of the sternocleidomastoid muscle. muscle. observed, referred pain may be generated by 3.20 ). If it is suspected that a patient ’ s pain applying heavier sustained pressure. The may be from these structures, any tender posterior digastric muscle is an opening region should be held and squeezed for 5 muscle and clinical experience has shown that seconds in an attempt to generate referred the posterior digastric muscle may be very pain. tender when a patient has recently developed The suboccipital protuberance area should a restricted opening (e.g., acute TMJ disc have been assessed during the initial palpa- displacement without reduction). In this tions, but the additional cervical muscle situation, the posterior digastric muscle is palpation can appraise the remainder of the most likely painful from the patient’ s repeated neck muscles. The cervical musculature has forcible attempts to open wider. several layers of muscles overlapping each Referred pain to the temple, masseter, ear, other that are nearly impossible to differenti- and TMJ areas can be generated by the ate. It is common for the most superfi cial sternocleidomastoid muscle , although the muscle to indicate the region (e.g., trapezius splenius capitis and trapezius muscles more muscle), although the designated problem commonly refer pain to these sites. 14 Clinical may actually be located in one of the deeper experience has shown that the more superior muscles. region of the sternocleidomastoid muscle is Tender nodules within the remainder of the more likely to generate referred pain to the neck can be identifi ed and palpated. Begin by head and face. Bilaterally palpate the sterno- placing the palm of the nondominant hand cleidomastoid muscles by simultaneously over the patient ’ s forehead and the four squeezing each between the thumb and index fi ngertips of the dominant hand just below fi nger along the length of the muscle (Figure the occipital protuberance. Press in several 50 P A R T I I N I T I A L E V A L U A T I O N Clinically the superior region tends to refer pain to the head and face, whereas the inferior region tends to refer pain into the upper back and shoulders. When I was lecturing in the U.S. Air Force, it was common to be asked to evaluate their TMD patients who were not responding to their therapies. One of these patients who had unilateral TMD symptoms localized to the masseter muscle region had received several years of TMD therapy, but the symptoms had not improved. During my initial recom- mended palpations and more intense palpa- tion of the masseter muscle, the patient’ s pain could not be reproduced. While performing these additional cervical palpations, several tender nodules within the neck muscles were found that referred pain to distant locations, but only one of these nodules reproduced the Figure 3.21. Palpation of additional cervical patient ’ s masseter muscle pain complaint. muscles. This experience confi rmed the necessity to fi nd and test each tender nodule. My evalua- tion suggested that the patient’ s masseter muscle region pain would respond best from the therapy directed to the neck. QUICK CONSULT Directing Therapy at the Source I f the patient’ s TMD pain is primarily from the neck, therapy primarily needs to be directed to the neck. Even though cervical muscle palpation Figure 3.22. Firm, steady pressure applied to reproduces a patient ’ s pain, the source of the tender nodule identifi ed in cervical musculature. neck muscle tenderness may actually be a disorder within the spinal column. Spinal millimeters and slowly slide your fi ngertips column disorders tend to cause the muscles in down the neck muscles, feeling for tender the region to become painful; this is the nodules (Figure 3 .21) . For each tender reason the chiropractor is able to adjust the nodule, apply fi rm, steady pressure up to vertebrae and relieve muscle pain. Similarly patient tolerance for 5 seconds, inquiring painful muscles tend to cause a malalignment about discomfort referred to another area of the vertebrae, which may be the reason the (Figure 3.22 ). Continue this process through- chiropractor ’ s treatment may not be long out the cervical region, as each of the tender term. Dental practitioners can attempt to nodules may refer pain to a different location. palpate the spinal column, but it is preferred C H A P T E R 3 C L I N I C A L E X A M I N A T I O N 51 to refer the patient to an individual who of the lateral pterygoid area is generally tender specializes in treating the cervical region and for most TMD patients and also the most let the specialist determine the diagnoses, likely masticatory palpation to be tender for contributing factors, and treatment. non - TMD patients.1 5 The lateral (external) pterygoid muscle A practitioner whose fi ngernails are not well cannot be directly felt or palpated, but trimmed will more than likely get a painful pressure applied to the lateral pterygoid area response. When asked, sometimes the patient appears to put pressure on structures that will respond, “ The pain was due to your transmit the load to the lateral pterygoid fi ngernail digging into my gum. ” As an muscle. Clinical experience has shown that alternative, some practitioners use the head of when the symptoms (e.g., the patient cannot a mouth mirror to palpate this area. close the posterior teeth together because of a Room to palpate this area is limited, so the lateral pterygoid myospasm) suggest the lateral right or left fi fth digit, which will fl ex to curve pterygoid muscle should be relatively tender, along the alveolar ridge, is used. Occasionally the palpation of this area has shown corre- the patient is asked to move the mandible to sponding tenderness. Functional tests for the the ipsilateral side to provide more room. If lateral pterygoid muscle have not been found the practitioner fi nds space is still tight, the to be as reliable as palpating this area. head of a mouth mirror can be used to To palpate the lateral pterygoid area, slide palpate this area. the fi fth digit along the lateral side of the When teaching this palpation to residents, maxillary alveolar ridge to the most posterior the fi fth digit is placed on a skull in the area region of the vestibule (the location for the of the palpation. The skull is turned to view it posterior superior alveolar injection). Palpate from the bottom, visualize the lateral ptery- by pressing in a superior, medial, and poste- goid muscle traversing from the lateral rior direction (Figure 3 .23) . If tenderness is pterygoid plate to the fovea on the condyle observed, referred pain may be generated by neck ’ s anteromedial surface, and a discussion applying heavier sustained pressure. Palpation is held regarding the relative closeness of this palpation to the muscle. The medial (internal) pterygoid muscle is similar to the masseter muscle, but traverses medial to the ramus and therefore has very limited access. A small area of the medial pterygoid muscle can be palpated intraorally (a little posterior to the traditional insertion site for an inferior alveolar nerve block), and the extreme inferior portion can be palpated extraorally. Clinical experience has shown that the extraoral palpation is not as reliable as the intraoral palpation. Intraorally, to palpate the medial pterygoid muscle, slide the index fi nger a little posterior to the traditional insertion site for an inferior alveolar nerve block, to where muscle is felt, Figure 3.23. Palpation of the lateral pterygoid and press laterally (Figure 3.24 ). If the patient area. gags, the fi nger is too posterior. Extraorally 52 P A R T I I N I T I A L E V A L U A T I O N Figure 3.24. Palpation of the medial pterygoid Figure 3.25. Palpation of the coronoid process. muscle. the medial pterygoid muscle is palpated by Tenderness of this structure suggests sliding the index fi nger medial to the inferior tendonitis, and clinically it correspondingly border of the ramus, pressing superior until improves, with the other masticatory struc- resistance is met, and then pulling lateral to tures, from conservative TMD therapy. If the load the medial pterygoid muscle. If tender- pain is limited to this area and is recalcitrant ness is observed in the medial pterygoid to TMD therapy, the practitioner may desire muscle, and the patient’ s pain is suspected to to prescribe an oral anti - infl ammatory medica- be from this structure, heavier sustained tion or inject an anti - infl ammatory medica- pressure will generate more intense and tion into the tendon. possibly referred pain. Occasionally patients report the pain source The temporalis muscle inserts into the is located medial to the ramus and 10– 1 5 m m mandible on the medial and anterior surfaces of anterior and superior to the angle of man- the coronoid process. Tenderness of the dible. Tendonitis of the stylomandibular temporalis muscle tendon is evaluated by this ligament has been reported as a source of palpation. Palpate this structure by sliding the pain in this location, in addition to
causing index fi nger superiorly along the anteromedial referred pain to other areas. The diagnosis of border of the ramus; as the fi nger approaches this disorder has been designated Ernest the superior extent, palpate the temporalis syndrome .1 6 muscle ’ s tendon overlying the coronoid process Palpate this structure with a blunt instru- (Figure 3.25 ). If tenderness is observed, and the ment or fi ngertip medial to the posterior pain is suspected to be from this structure, border of the mandible and 10 – 15 mm above heavier sustained pressure will generate more the angle of the mandible anteromedially intense and possibly referred pain. (Figure 3.26 ). Clinical experience has shown C H A P T E R 3 C L I N I C A L E X A M I N A T I O N 53 the ear pain was due to TMD. During the TMD evaluation, the practitioner will need to determine the source of the ear pain. It is recommended the practitioner palpate the locations mapped in Figure 3.14 under “ Ear. ” If the splenius capitis muscle was found to be the only area that could generate referred pain to the ear, this would suggest that therapy for the neck would have the highest probability of resolving the patient ’ s ear pain. If palpating the masticatory muscles and/or the TMJ generated referred pain to the ear, but the ear pain could not be reproduced by palpating the cervical muscles, then TMD therapy would have the highest probability of resolv- ing the ear pain. If both the cervical and masticatory regions could generate referred pain to the ear, this would suggest that ear pain may be perceived Figure 3.26. Palpation of the stylomandibular when the patient stimulates either of these ligament. regions (e.g., cervical stimulation through poor posture or masticatory stimulation through oral habits). Therapy recommenda- it correspondingly improves, with the other tions are a clinical judgment based on factors masticatory structures, from conservative such as (1) understanding that TMD and TMD therapy. If the pain is limited to this cervical pain can negatively infl uence each area and is recalcitrant to therapy, the practi- other and treatment for one may benefi t the tioner may desire to prescribe an oral adminis- other; (2) knowledge of the patient’ s symptom tration and/or injection of anti - infl ammatory patterns (e.g., whether the masticatory or medication.8 cervical region becomes painful fi rst and Referred pain frequently causes confusion then the pain moves to the other location); for both the practitioner and the patient. (3) knowledge of whether the masticatory or There is the potential that the nonreproduced cervical region more readily reproduces portion of the pain may be referred from a the pain and is more tender to palpation; distant location. Referred pain is commonly (4) effi cacious experiences of the practitioner seen with a heart attack; the site of the pain and patient for TMD and cervical treatments; may be in the left arm or shoulder, while the and (5) understanding that many TMD pain ’ s source is the heart. Treatment for the patients report improvement of cervical pain must be directed toward the source, not symptoms following occlusal appliance the site where it is felt. therapy. Discussing this information with the To demonstrate the clinical relevance of patient, the practitioner may elect to institute determining a referred pain’ s source, assume TMD therapy fi rst, cervical therapy fi rst, or that a patient with ear pain, whose physician both together. Observational studies report has ruled out ear pathology, was referred to that combining therapies enhances the the dentist because the physician suspected potential for success.1 7,18 54 P A R T I I N I T I A L E V A L U A T I O N Cervical treatment and referrals are be visually appraised for pathology, e.g., within a dentist’ s scope of clinical practice for swelling, defl ection of the soft palate, etc. Ask TMD.1 9 Many therapies have been shown to the patient to say “ A h,” place the head of a be benefi cial in treating cervical pain, and the mouth mirror against the posterior portion of practitioner ’ s clinical experience generally the tongue, press down on the mirror, and dictates the approach the practitioner uses, observe the pharynx and whether the soft e.g., prescription of the practitioner ’ s preferred palate uniformly raises bilaterally. A nasopha- medication, instruction on cervical exercises, ryngeal carcinoma may present as TMD (e.g., referral to a physician, or referral to a physical limited opening, masticatory muscle pain and therapist. It is recommended that the chosen tenderness to masticatory muscle palpation), treatment give patients the ability to control but the most common difference one would their cervical pain on their own and not observe is asymmetry (ipsilateral paralysis) of require them to continually return to a the soft palate.2 0 provider to maintain relief. When evaluating patients for TMD or Occlusal Changes TMD - like pain, sometimes the palpations will not reproduce it. The practitioner needs to The responses to the “ Initial Patient Ques- balance the discomfort created by the palpa- tionnaire ” generally inform the practitioner of tions and the probability of identifying the other specifi c intraoral areas that need to be pain source through these palpations. If evaluated, e.g., a developing anterior open unable to reproduce the pain through these bite, developing anterior midline shift, and/or palpations, at some point the practitioner will developing posterior open bite. When evaluat- need to proceed to the structures or tests ing perceived occlusal changes, I check all described in “ Intraoral Examination ” and occluding teeth by placing shim stock along “ Additional Evaluations ” in this chapter. the occlusal surface, asking the patient to close on the shim stock and try to hold it with the opposing teeth (Figure 3 .27) . I then record INTRAORAL EXAMINATION which maxillary teeth are able to hold the shim stock; I might later use this information The responses to the “ Initial Patient Ques- to determine whether the occlusal change is tionnaire ” should alert a practitioner that an improving or worsening. oral disorder may be causing or contributing to a patient ’ s TMD - like symptoms, but the questionnaire is not infallible. If intraoral palpations were necessary, it is assumed these were previously performed. It is imperative that dentists observe for dental disorders contributing to pain, because nondentists treating patients for TMD generally assume that, if the patient has been evaluated by a dentist for TMD, a dental disorder would have been identifi ed. Figure 3.27. Patient holding shim stock between It is recommended the practitioner begin tooth 4 and its opposing tooth. This technique is used to determine which maxillary teeth have the intraoral exam by performing a general suffi ciently close contacts enabling shim stock to oral screening. The entire oral cavity should be held. C H A P T E R 3 C L I N I C A L E X A M I N A T I O N 55 A progressively increasing anterior open QUICK CONSULT bite, if not due to local factors, is suggestive of Developing Posterior Open Bite or severe osteoarthritis causing the condyle to Midline Shift lose its vertical height. As the condyle loses I f the posterior open bite or midline shift is its height, the mandible tends to rock around intermittent and associated with the patient ’ s the most posterior ipsilateral tooth contact TMD pain, appropriate TMD therapy is likely to and an anterior open bite progressively resolve it. increases. Eventually the most posterior ipsilateral tooth will be the only tooth that TMD Pain Caused by a Tooth occludes. This disorder can occur bilaterally and the open bite may be symmetrical. This is The nervous system shares the neurological a diffi cult condition to manage and is beyond circuitry for deep pain (produced by musculo- the scope of this book, and practitioners skeletal, neural, vascular, and visceral struc- observing this complaint may desire to refer the tures) among many structures. This enables patient to someone with greater expertise in pain from oral disorders to be perceived in the this area.2 1 A method for identifying these masticatory muscles and/or TMJs.1 4,16,25 practitioners is provided in “ Practitioners with A practitioner who is not aware of a patient ’ s TMD Expertise and Fellowship Programs ” in dental caries and periodontal disease status may appendix 13 . desire to make dental radiographs to evaluate A posterior open bite or midline shift could these in addition to clinically evaluating the be suggestive of many disorders2 2 – 24 in which teeth for cavities and periodontal disease. By something is pushing or pulling the condyle far, the most common oral disorder that I see anterior. As the condyle is pushed or pulled, it misdiagnosed as TMD is referred odontogenic translates anterior along the downward slope of pain. Bear in mind that a patient may have the articular eminence, causing the mandible to odontogenic pain even though the teeth are move inferior, and hence a posterior open bite caries and restoration free and the periodontal occurs. If this disorder tends to be intermittent health is within normal limits. Patients might and associated with the patient ’ s TMD pain, it have odontogenic pain from a tooth with a is likely due to TMJ infl ammation pushing the history of trauma or incomplete fracture.2 6 condyle anterior, and/or the lateral pterygoid Patients with an incomplete tooth fracture muscle pulling the condyle anterior. The generally report a sharp lancinating pain upon appropriate TMD therapy is likely to resolve biting or releasing tough or crunchy foods the posterior open bite or midline shift com- (e.g., bacon, crust of bread). plaint. Since there are many other potential causes for this complaint, the practitioner must QUICK CONSULT ensure this disorder resolves or the practitioner Observing for an Odontalgia may desire to refer the patient to someone with Contribution greater expertise in this area. B y far, the most common oral disorder that I If posterior open bite or midline shift is see misdiagnosed as TMD is referred odonto- a slow progressive disorder, it is probably genic pain. not due to TMJ infl ammation or the lateral pterygoid muscle and the practitioner A dental disorder may not only contribute may desire to immediately refer the patient to a patient ’ s TMD pain, but may also alter to someone with greater expertise in this the patient ’ s treatment plan, for any restora- area. tions that are placed after the occlusal 56 P A R T I I N I T I A L E V A L U A T I O N appliance is fabricated may require the FOCAL POINT practitioner to alter the appliance. If a patient If a patient reports that pain increases when is diagnosed with TMD and needs restora- drinking hot or cold liquids, this should lead the tions, the practitioner may choose (1) to delay practitioner to suspect a tooth may be contribut- appliance therapy until the restorations are ing to the pain. completed and control the nocturnal para- functional activity through medications (e.g., The offending tooth should be identifi ed diazepam, nortriptyline, amitriptyline), (2) to through percussion and thermal tests (hot or fabricate the appliance on an arch that is (or cold, depending on which stimulus reproduces becomes) caries free and adjust the appliance’ s the pain). In a study of referred odontogenic occlusal surface as the opposing restorations pain, all patients diagnosed with odontogenic are placed, or (3) to fabricate and adjust a pain contributing to their complaint had temporary appliance (e.g., soft appliance) until tenderness to percussion of the offending the restorations are completed. tooth.2 8 Some patients with a positive thermal If odontogenic pain is suspected to be test relate it caused only lingering pain within contributing to the pain (as represented in the tooth (hyperresponsive reaction), and Figure 1.1 ), the dentist will need to search for others relate it referred pain to the location of the offending tooth. A few clinical observations their chief complaint, whereas still others may aid in locating the offending tooth. relate the test
reproduced the sequential pain Anterior teeth (canine to canine) have been pattern they described during the interview. observed referring odontogenic pain bilaterally, If the thermal test is positive, a ligamentary whereas the premolars and molars have been injection to the suspected tooth will help observed referring pain to the ipsilateral side.2 7 determine the impact the hyperresponsive Bilateral pain does not exclude the possibility tooth may be having on the pain. When that the patient may have odontogenic pain performing the thermal and anesthetic tests, it from a posterior tooth. It is common to observe has been helpful for the patient to grade the a patient with odontogenic pain whose com- pain intensity on a 0– 1 0 scale, where 0 is no plaint is bilateral ache, pressure, and/or dull pain and 10 is the worst pain imaginable. pain in addition to unilateral throbbing pain. If the ligamentary injection dramatically The offending tooth is subsequently identifi ed reduces or eliminates the pain, odontogenic as a posterior tooth on the throbbing side, and pain is apparently contributing signifi cantly to the bilateral ache, pressure, and/or dull pain is the complaint. The ligamentary injection, due to coexisting TMD. 28 rather than the traditional dental anesthetic If a patient reports the pain increases when injection, is recommended for the anesthetic drinking hot or cold liquids, ask which tooth test. A maxillary infi ltration or inferior the liquid touches to cause the increase. The alveolar nerve block may cause symptom answer should indicate a quadrant to evaluate reduction due to the anesthetic ’ s direct effect initially for a dental source. It is common for on the lateral pterygoid or medial pterygoid patients with symptomatic muscles to report muscle. that their pain increases when the muscles get chilled, so it is not surprising that some TMD FOCAL POINT patients report that their pain increases when If the ligamentary injection dramatically reduces the cold liquid touches the medial pterygoid or eliminates a patient ’ s pain, odontogenic pain muscle rather than a tooth. In this situation, an is apparently contributing signifi cantly to the odontogenic contributor is usually not present. complaint. C H A P T E R 3 C L I N I C A L E X A M I N A T I O N 57 It is important for practitioners to realize pulpitis, the pulpitis is often caused by the that a ligamentary injection does not anesthe- patient continually aggravating the tooth with an tize only the tooth injected. It provides intraos- opposing tooth. seous distribution of the anesthetic, which may cause pulpal anesthesia of as many as two teeth For patients whose offending tooth pain is on each side of the injected tooth.2 9 Therefore, believed to be a reversible pulpitis caused by a prior to administering the injection, it is habit, there are generally three choices of imperative to identify the offending tooth by therapy: (1) Ask the patient to observe and percussion and thermal testing. Careful break the rubbing or bumping habit. Some diagnostic testing must also be used to rule out patients are unwilling or unable to do so, or it adjacent teeth as possible contributors. could be a nocturnal habit outside of the Recommended criteria for classifying a patient ’ s ability to change. (2) Adjust the tooth as an odontogenic contributor to a occlusion; e.g., remove the excursive contact patient’ s TMD pain are (if both are positive) on a posterior tooth. (3) Fabricate an occlusal (1) the thermal test caused lingering tooth appliance, which will interpose the opposing pain or generated the TMD pain, and (2) the teeth so the habit cannot be performed. ligamentary injection dramatically reduced or Once the odontogenic pain is resolved, a eliminated the TMD pain. 28 signifi cant reduction or elimination of the TMD symptoms should be observed. 27,28 Once the offending tooth is identifi ed, the If a practitioner must determine whether the patient is interested in pursuing treatment of odontogenic pain is due to a reversible or a the residual TMD symptoms, the symptoms nonreversible disorder. Examples of nonrevers- have probably substantially changed, requiring ible conditions include deep caries or restora- the practitioner to reevaluate the remaining tions for which endodontic therapy is TMD symptoms and contributing factors. indicated, an incomplete tooth fracture with pulpal involvement, and a combined peri- Tooth Pain without Local Pathology odontal - endodontic condition. Offending teeth with nonreversible conditions should It is common for both dental and TMD receive the traditional dental treatments for patients to have a combination of dental and the disorder, generally involving endodontic TMD - type pains. 8,30 Patients generally focus therapy or extraction. their complaint on the aspect they believe is Clinical experience has shown that a their pain source, but the two may be reversible pulpitis in an offending tooth is interrelated. often caused by a patient continually aggravat- Patients with primary dental pain should ing this tooth with an opposing tooth. This fi rst be evaluated to identify whether the source could be from a habit of rubbing or bumping is dental pathology, e.g., caries, periodontal the opposing teeth together, a high restoration disease, or incomplete tooth fracture. If these causing the tooth to be the fi rst or only pathological conditions are ruled out as the closure contact, etc. source of the pain, other causes for dental pain should be considered, e.g., nasal mucosal pain QUICK CONSULT secondary to sinusitis,3 1 periodontal ligament Observing Teeth with Reversible infl ammation secondary to parafunctional Pulpitis activity, 31 – 33 reversible pulpitis secondary to C linical experience has shown when a TMD parafunctional activity,8 ,33,34 or pain referred patient ’ s pain is primarily from a reversible from the masticatory muscles or TMJs.1 4,33 58 P A R T I I N I T I A L E V A L U A T I O N The degree nasal mucosal pain is contribut- The referred pain from the masticatory ing to the tooth (usually maxillary) pain can be structures can be verifi ed by palpating the tested by a trial of antibiotics and decongestants masticatory structures and observing whether (e.g., Augmentin [amoxicillin/clavulanate] this reproduces the patient ’ s tooth pain. The 500 mg, 1 tab b.i.d. for 10 days and Sudafed referred pain is often not limited to the tooth, [pseudoephedrine HCl] 60 m g, 1 tab 4– 6 hours but also causes pain to be perceived in the [both have generic formulations]). gingiva and alveolar process, even in edentu- Once local pathology and nasal mucosal lous areas. pain have been ruled out, multiple teeth with The nervous system shares the neurological percussion tenderness, multiple teeth with circuitry between pulpal pain and musculosk- pain, and tooth pain that moves between eletal pain. Similar to how central sensitiza- various teeth are speculated to be a result of tion and central convergence can cause tooth signifi cant parafunctional habits. This is pulpal pain to be perceived as masticatory especially true when it involves opposing musculoskeletal pain (Figure 1 .1) , masticatory arches or is bilateral. The pain source can be musculoskeletal pain can be perceived as tooth periodontal ligament infl ammation, reversible pulpal pain (Figure 3.28 ). pulpitis, referred pain from the masticatory In Figure 3.14 , the map for “ Maxillary structures, or any combination of these. Since Dentition ” has areas of the temporalis muscle, the primary contributing factor to each of TMJ, and masseter muscle marked on the these is the same (signifi cant parafunctional head, in addition to the lateral pterygoid area habits), traditional TMD therapy will reduce and medial pterygoid muscle annotated below. this contributing factor, and it is generally not (These are intraoral muscles that could not be necessary to determine the percent each is drawn on the head.) The masseter muscle is contributing to the symptoms. the location marked with the color designated as the more common source, so intensely FOCAL POINT palpating the designated area of the masseter One of the goals in TMD therapy is to decrease muscle is most likely to generate referred pain the parafunctional activity and its effects on the to the maxillary dentition. This also helps the masticatory system. Therefore, many of the patient to realize the source of the pain is not therapies used in treating TMD may also be from the tooth, but from the masseter muscle. benefi cial for patients with dental pain caused by Patients with these symptoms may not fi nd signifi cant parafunctional habits. practitioners who understand this concept and The periodontal ligament infl ammation can able to demonstrate the true source of the be verifi ed by applying an apical or lateral pain. Occasionally these patients are able to load to the tooth, e.g., by percussing the tooth convince their dentists to treat their tooth with the end of a mouth- m irror handle. It is pain with endodontic therapy, which does not common for TMD patients to have multiple provide improvement, and for various reasons teeth tender to percussion, and about one - the pain may then be perceived as from third of my TMD patients have generalized another tooth (Figure 3.29 ). percussion tenderness of their teeth. Another way to demonstrate this to the It is common for many of my TMD patient is to anesthetize the tooth with a patients to complain of thermal sensitivity of ligamentary injection and show the patient that their teeth.3 4 This is probably due to a the tooth is numb, but the pain is still present. reversible pulpitis secondary to signifi cant Conversely, if you anesthetize a tooth to treat it parafunctional habits and can generally be for a pain, be sure the anesthesia eliminated the verifi ed by blowing cold air on these teeth. pain prior to treating the tooth. C H A P T E R 3 C L I N I C A L E X A M I N A T I O N 59 Figure 3.28. A depiction of central convergence enabling masseter muscle pain to be perceived as tooth pulp pain. Figure 3.29. Radiograph of a TMD patient who perceived her TMD pain to be of pulpal origin and convinced dentists to treat her pain with endodontic therapy. QUICK CONSULT about proceeding with a root canal or Treating a Tooth without Dental extraction to appease the patient; the pain Pathology may be due to referred masticatory muscle I f a patient complains of tooth pain and no or TMJ pain. dental pathology is identifi ed, be cautious 60 P A R T I I N I T I A L E V A L U A T I O N ADDITIONAL EVALUATIONS fi bromyalgia by rheumatologists have had their disorders advance to other disorders, During the patient interview, the practitioner such as multiple sclerosis. A case scenario of a may have developed suspicions for disorders patient with fi bromyalgia as a contributing that have not yet been evaluated and may not factor is presented in “ C ase 9” in part V. be within the practitioner’ s ability to evaluate. Occasionally the information gathered Sometimes the practitioner may prefer to refer during the patient interview suggests the patients directly to their physician for this, patient has TMD, but palpating the mastica- whereas at other times the practitioner may tory and cervical muscles and TMJs (as wish to obtain additional information to described previously) cannot reproduce the support or rule out the suspected disorder. pain. A less specifi c test can be used to If one wishes to evaluate for sinus conges- stimulate the masticatory system in order to tion, bear in mind that sinus congestion demonstrate that the pain is probably of cannot be ruled out by lack of tenderness masticatory origin. This involves asking the from palpating the maxillary and frontal patient to put his or her teeth into MI and sinuses. Even though a patient may have sinus squeeze them together hard. The patient is congestion contributing to his or her pain, the asked to continue squeezing until the fi rst sign maxillary and frontal sinuses are not always that the pain is starting or until 1 minute tender to palpation, and the problem could be elapses. This technique stimulates the mastica- from a sinus that is not able
to be palpated, tory system (including the dentition), so the e.g., the ethmoid sinus. Therefore, the practitioner needs to be sure the dentition is practitioner may desire to test the patient’ s not the pain ’ s source. response from a trial of antibiotics and On rare occasions, the interview suggests decongestants (e.g., Augmentin [amoxicillin/ the patient has TMD, and all other traditional clavulanate] 500 m g, 1 tab b.i.d. for 10 days causes for the pain are ruled out to the degree and Sudafed [pseudoephedrine HCl] 60 mg, 1 possible, but none of the aforementioned tab 4 – 6 hours [both have generic formula- techniques can reproduce the pain. This tions]) or refer the patient to his or her generally occurs with a patient who only physician for evaluation and management of occasionally has the complaint. The patient is sinus congestion. As mentioned earlier, an informed that a TMD origin for the pain increase in pain with bending forward may could not be verifi ed, but the signs, symp- predict sinus congestion involvement. toms, aggravating activities, and alleviating Some practitioners attempt to substantiate activities are traditionally observed with the suspicion of fi bromyalgia by determining TMD. The patient is offered a trial occlusal whether at least 11 of a possible 18 fi bromyal- appliance to determine whether it might have gia tender points (different from trigger a benefi cial effect. If the practitioner observes points) are tender to palpation. Palpation of that a trial appliance does not have a benefi - fi bromyalgia tender points is beyond the scope cial effect, it is recommended the patient be of this book, and it is recommended that a referred to someone with greater expertise in patient who has not been appropriately this area or to the patient ’ s physician for diagnosed or treated for widespread muscle evaluation for atypical causes of the pain. pain (suggestive of fi bromyalgia) be referred to The literature is fi lled with case reports of his or her medical provider, internal medicine patients with TMD symptoms who actually physician, or rheumatologist. It has been had a brain tumor, eye disease, throat cancer, observed that patients diagnosed with etc. This may be a comorbid condition in C H A P T E R 3 C L I N I C A L E X A M I N A T I O N 61 which appliance therapy might reduce the T.M. disorders . Community Dent Oral Epidemiol TMD symptoms satisfactorily so the comor- 1989 ; 17 ( 5 ): 252 – 257 . bid disease becomes recognizable. It could also 7. American Academy of Orofacial Pain . de Leeuw R be that the TMD therapies are not benefi cial (ed). Orofacial Pain: Guidelines for Assessment, because the primary source for the pain was Diagnosis and Management , 4th ed . Chicago : Quintessence , 2008 : 145 – 151 . missed and the practitioner may desire to refer 8. Okeson JP . Management of Temporomandibular the patient to someone with greater expertise Disorders and Occlusion , 6th ed . St. Louis : CV in this area. Throughout TMD therapy, it is Mosby , 2008 : 229 , 244 , 286 , 410 , 438 . imperative to continually monitor the symp- 9. Wassell RW , Adams N , Kelly PJ . The treatment of toms because the primary disorder may resolve temporomandibular disorders with stabilizing splints and a secondary problem (e.g., cervical pain) in general dental practice: One - year follow - up . may become the primary disorder. JADA 2006 ; 137 ( 8 ): 1089 – 1098 . 10. Magnusson T , Egermarki I , Carlsson GE . A QUICK CONSULT prospective investigation over two decades on signs Monitoring Symptoms throughout and symptoms of temporomandibular disorders and Therapy associated variables. A fi nal summary . Acta Odontol T hroughout TMD therapy, it is imperative that Scand 2005 ; 63 ( 2 ): 99 – 109 . the practitioner continually monitor the patient’ s 11. Dworkin SF , LeResche L . Research diagnostic symptoms because the primary disorder may criteria for temporomandibular disorders: Review, criteria, examinations and specifi cations, critique . J resolve and a secondary problem (e.g., cervical Craniomandib Disord 1992 ; 6 ( 4 ): 301 – 355 . pain) may become the primary disorder. 12. Sciotti VM , Mittak VL , DiMarco L , Ford LM , REFERENCES Plezbert J , Santipadri E , Wigglesworth J , Ball K . Clinical precision of myofascial trigger point 1. Dawson PE . Functional Occlusion: From TMJ to location in the trapezius muscle . Pain Smile Design . St Louis : CV Mosby , 2007 : 70 , 271. 2001 ; 93 ( 3 ): 259 – 266 . 2. Ribeiro RF , Tallents RH , Katzberg RW , Murphy 13. Fricton J . Myogenous temporomandibular WC , Moss ME , Magalhaes AC , Tavano O . The disorders: Diagnostic and management prevalence of disc displacement in symptomatic and considerations . Dent Clin North Am 2007 asymptomatic volunteers aged 6 to 25 years. J Jan; 51 ( 1 ): 61 – 83 . Orofac Pain 1997 ; 11 ( 1 ): 37 – 47 . 14. Wright EF . Patterns of referred craniofacial pain in 3. Egermark I , Carlsson GE , Magnusson T . A 20 - year TMD patients . JADA 2000 ; 131 ( 9 ): 1307 – 1315 . longitudinal study of subjective symptoms of 15. Turp JC , Minagi S . Palpation of the lateral temporomandibular disorders from childhood to pterygoid region in TMD— w here is the evidence? J adulthood . Acta Odontol Scand 2001 ; 59 ( 1 ): 40 – 48 . Dent 2001 ; 29 ( 7 ): 475 – 483 . 4. Magnusson T , Egermark I , Carlsson GE . A 16. Shankland II WE . Common causes of nondental longitudinal epidemiologic study of signs and facial pain . Gen Dent 1997 ; 45 ( 3 ): 246 – 253 . symptoms of temporomandibular disorders from 15 17. Fricton JR , Dall ’ Arancio D . Myofascial pain of the to 35 years of age . J Orofac Pain head and neck: Controlled outcome study of an 2000 ; 14 ( 4 ): 310 – 319 . interdisciplinary pain program. J Musculoske Pain 5. Yatani H , Sonoyama W , Kuboki T , Matsuka Y , 1994 ; 2 ( 2 ): 81 – 99 . Orsini MG , Yamashita A . The validity of clinical 18. Gil IA , Barbosa CMR , Pedro VM , Silverio KCA , examination for diagnosis of anterior disc Goldfarb EP , Fusco V , Navarro CM . displacement with reduction. O ral Surg Oral Med Multidisciplinary approach to chronic pain from Oral Pathol Oral Radiol Endod 1998 ; 85 : 647 – 653 . myofascial pain dysfunction syndrome: A four - year 6. Schiffman E , Anderson G , Fricton J , Burton K , experience at a Brazilian center. C ranio Schellhas K . Diagnostic criteria for intraarticular 1998 ; 16 ( 1 ): 17 – 25 . 62 P A R T I I N I T I A L E V A L U A T I O N 19. The scope of TMD/orofacial pain (head and neck 26. Wright EF , Gullickson DC . Dental pulpalgia pain management) in contemporary dental practice. contributing to bilateral preauricular pain and Dental Practice Act Committee of the American tinnitus . J Orofac Pain 1996 ; 10 ( 2 ): 166 – 168 . Academy of Orofacial Pain . J Orofac Pain 27. Wright EF . Pulpalgia contributing to 1997 ; 11 ( 1 ): 78 – 83 . temporomandibular disorder- l ike pain: A literature 20. Reiter S , Gavish A , Emodi - Perlman A , Eli I . review and case report . JADA Nasopharyngeal carcinoma mimicking a 2008 ; 139 ( 4 ): 436 – 440 . temporomandibular disorder: A case report. J 28. Wright EF , Gullickson DC . Identifying acute Orofac Pain 2006 ; 20 ( 1 ): 74 – 81 . pulpalgia as a factor in TMD pain. J ADA 21. Pogrel MA , Chigurupati R . Management of 1996 ; 127 : 773 – 780 . idiopathic condylar resorption . In: Laskin DM , 29. Walton RE . Distribution of solutions with the Greene CS , Hylander WL . Temporomandibular periodontal ligament injection: Clinical, anatomical, Disorders: An Evidence - Based Approach to and histological evidence. J Endod Diagnosis and Treatment . Hanover Park, IL : 1986 ; 12 : 492 – 500 . Quintessence , 2006 : 533 – 540 . 30. Falace DA , Reid K , Rayens MK . The infl uence of 22. Chen YJ , Shih TT , Wang JS , Wang HY , Shiau YY . deep (odontogenic) pain intensity, quality, and Magnetic resonance images of the duration on the incidence and characteristics of temporomandibular joints of patients with acquired referred orofacial pain . J Orofac Pain open bite. O ral Surg Oral Med Oral Pathol Oral 1996 ; 10 ( 3 ): 232 – 239 . Radiol Endod 2005 ; 99 ( 6 ): 734 – 742 . 31. Okeson JP . Bell ’ s Orofacial Pains: The Clinical 23. Xiang S , Rebellato J , Inwards CY , Keller EE . Management of Orofacial Pain , 6th ed . Carol Malocclusion associated with osteocartilaginous Stream, IL : Quintessence , 2005 : 271 , 273 . loose bodies of the temporomandibular joint . JADA 32. Fricton JR . A unifi ed concept of idiopathic orofacial 2005 ; 136 ( 4 ): 484 – 489 . pain: Clinical features. J Orofac Pain 24. Kademani D , Bevin C . A mass in the 1999 ; 13 ( 3 ): 185 – 189 . temporomandibular joint . JADA 33. Yount K . Diagnosis and management of nondental 2008 ; 139 ( 3 ): 301 – 303 . toothache . Dent Today 2002 ; 21 ( 11 ) 130 – 185 . 25. Gremillion HA . Multidisciplinary diagnosis and 34. Wilson TG . Bruxism and cold sensitivity . management of orofacial pain. G en Dent Quintessence Int 2002 ; 38 ( 8 ): 559 . 2002 ; 50 ( 2 ): 178 – 186 . Chapter 4 Imaging There is a wide choice of imaging procedures QUICK CONSULT that can be used for patients with TMD, and Stopping Radiographic Osseous they vary considerably in cost, availability, and Changes quality of information that can be obtained. It is relatively common for TMD patients to have This chapter provides an overview of these radiographic osseous changes, which are procedures, followed by imaging generally in response to TMJ infl ammation from recommendations. TMJ overload, i.e., parafunctional habits. As a The osseous portion of the TMJ is often patient ’ s TMJ infl ammation resolves, the demin- assessed with plain radiographs, panoramic eralization correspondingly stops. radiograph, axially corrected sagittal tomogra- phy, computed tomography (CT), and cone beam computed tomography (CBCT). It is FOCAL POINT relatively common for TMD patients to have Radiographic changes generally lag behind the some radiographic osseous change 1 and clinical symptoms by as much as 6 months. changes typically begin on the condyle’ s lateral pole. 2 The soft - tissue portion of the TMJ is Osseous changes generally occur in response generally assessed with MRI, and attention is to TMJ infl ammation,3 ,4 which is clinically often directed at identifying the position of identifi ed by TMJ palpation tenderness or the disc when the mouth is closed and pain. 5 The clinical symptoms are generally maximally opened. caused by TMJ overload from activities such as parafunctional habits. 6 As the TMJ pain PLAIN RADIOGRAPHS and infl ammation resolve, demineralization correspondingly stops. 7 These radiographic Several plain radiographic projections can changes lag behind the clinical symptoms by image the osseous portion of the TMJ. as much as 6 months. 5,8 Therefore, a TMD However, these images have such signifi cant patient ’s most current status is generally best distortion and superimposition from other determined by the patient’ s current signs and structures that they can be used only to screen symptoms and not by
the radiographic for gross degenerative changes and to evaluate fi ndings; similarly, TMD therapy needs to be condylar translation. The signifi cant distortion directed toward the patient ’ s symptoms and also makes it impossible to determine the not toward the radiographic fi ndings. condyle ’ s position in the glenoid fossa. 63 64 P A R T I I N I T I A L E V A L U A T I O N In dental offi ces, the most commonly QUICK CONSULT performed plain radiographic TMJ projection Viewing Panoramic Radiographs is the transcranial projection, which can be The view of the condyle ’ s lateral pole (generally taken with the standard dental x- r ay unit the fi rst area to show degenerative changes) is using a positioning device that is often superimposed within the head of the condyle available from the manufacturer. The image and not visible on the panoramic radiograph. projected by this procedure enables the lateral pole to be evaluated for early osseous changes. It is common to view a well - circumscribed radiolucent area on the anterior aspect of the PANORAMIC RADIOGRAPH condyle in a panoramic radiograph (Figure 4.1 ). These condylar pseudocysts are formed The panoramic radiograph provides a screen- primarily by the cupping of the condyle’ s ing image of the TMJs, maxilla, mandible, lateral pterygoid muscle fovea, and one survey maxillary sinuses, teeth, and periodontium. It found them in 18% of panoramic radiographs can identify fractures (including a subcondylar from children.1 1 fracture) and screen for gross degenerative changes of the TMJ and gross pathological AXIALLY CORRECTED SAGITTAL changes of the maxilla and mandible. An old TOMOGRAPHY nonreduced condylar or subcondylar fracture is not suggestive that the fracture was missed These radiographs are true lateral projections by the provider, that the patient received poor of the condyle without superimposition that treatment, or that it is the primary factor enable practitioners to view osseous changes of contributing to the patient’ s TMD. Open the articular surface. Images with the mouth reduction may not have been indicated, and closed and maximally opened are routinely nonreduced condylar or subcondylar fractures made, enabling practitioners to view the range rarely cause a problem. 9,10 the condyles translate. Through frontal images As the TMJ is imaged, the x - ray beam the lateral and medial poles can be assessed. travels from the posterior - inferior direction, Condylar position has been shown not to be causing the condyle’ s lateral pole to be able to predict disc position reliably.1 2 superimposed within the head of the condyle, Cost and inconvenience (tomography is so one cannot view early condylar demineral- rarely available in a dental offi ce) are the ization. Similarly the articular eminence is primary disadvantages of these radiographs. obstructed by superimposition on the pan- oramic radiograph. Superimposition of the COMPUTED TOMOGRAPHY glenoid fossa over the condyle can be mini- mized by asking the patient to open maxi- This technology uses x - ray to obtain sectional mally during imaging, but this prevents most images of the TMJs. These sections enable the of the mandible from being imaged. total TMJ to be evaluated and can be used to Some panoramic machines allow two to form a three - dimensional image of the TMJ. four projections of the TMJ to be imaged on CT scans may be useful for viewing TMJ one fi lm, which may enable condylar mobility ankylosis, neoplastic conditions, and to be visualized. The x - ray beam for these anomalies. images generally travels along the pathway of Although CT images are valuable for the panoramic image, projecting the condyle’ s identifying hard - tissue and soft - tissue abnor- lateral pole within the head of the condyle. 8 malities and pathology in the head and neck, C H A P T E R 4 I M A G I N G 65 Figure 4.1. Condylar pseudocysts, formed primarily by the cupping of the condyle’ s lateral pterygoid muscle fovea, are common on panoramic radiographs. the CBCT images are higher resolution any surface. This imaging provides the best images for viewing hard- t issue, and MRI view for evaluating the TMJ ’ s hard tissues. images are much better for viewing soft tissue CBCT units may be found in most dental (e.g., identifying disc position). 13,14 CT scans schools, radiographic imaging centers, and are used only in special situations with TMD some dental implant and TMD specialty patients. offi ces. To separate this category from the next category of CT imaging, this category is MAGNETIC RESONANCE IMAGING referred to as “ medical ” CT, because these CT machines are large, expensive machines, MRI uses a magnetic fi eld and radiofrequency primarily used for evaluating other parts of impulses instead of radiation to produce its the body, and generally only found in hospi- image. For TMD patients, it is primarily used tals and large medical imaging centers. to identify the disc position, usually viewed in both closed and maximal open positions. The CONE BEAM COMPUTED TOMOGRAPHY accuracy of identifying the disc position may reach 95%. 1,16,17 This is a relatively new technology providing Practitioners should bear in mind that the higher resolution TMJ images (better than identifi cation of a displaced disc does not “ medical ” CT images) using low radiation suggest this is the source of the TMD symp- (equivalent to a full mouth periapical series) toms. It is estimated that 9 – 31% of asymp- on a comparatively small, inexpensive unit.1 3,15 tomatic TMJs have a disc displacement, while At the present time, the CBCT can only 26 – 31% of TMD patients have a disc dis- provide a view of the hard tissues. Most placement.1 8 Also, the primary source for a software programs are able to provide a TMD patient ’ s pain is the muscle.1 9 three - dimensional view of the TMJ, with In addition to disc position, the MRI also the capability of rotating the image to observe provides information about joint fl uid, bone 66 P A R T I I N I T I A L E V A L U A T I O N marrow changes, and bone structure at the space.1 3 The soft - tissue imaging is also plagued various sections made of the TMJ. An MRI is with unsatisfactory results, e.g., poor accuracy contraindicated for patients who have a in identifying the disc position compared with pacemaker, intracranial vascular clips, or metal the MRI.1 8 particles in the eye or in other vital structures.1 7 High - resolution ultrasound is a noninvasive, This imaging procedure is the best imaging inexpensive, and easily accessible technology method for identifying the disc position, joint for imaging the TMJ. Unfortunately, results of fl uid, and bone marrow changes. Cost and current studies suggest signifi cant limitations inconvenience are the primary disadvantages to using this technology for evaluating the of obtaining this image. TMJ’ s hard and soft tissues. New technologi- cal developments seem promising, but it will QUICK CONSULT probably always have diffi culty evaluating the medial aspect of the TMJ. 18 Viewing MRI s The accuracy of identifying the disc position in IMAGING STRATEGIES an MRI may reach 95%. Practitioners must be cognizant that there are ARTHROGRAPHY few, if any, correlations between clinical and radiographic fi ndings; imaging of individuals To obtain an arthrogram, radiopaque contrast with signifi cant pain may have normal medium must be injected into the TMJ. By fi ndings, while imaging of asymptomatic observing the space outlines and for leakage of individuals may have abnormalities. 16 the contrast medium, the disc position, The patient interview and examination existence of a perforation, and sometimes disc provide the most important information for condition can be identifi ed. The procedure establishing the TMD clinical diagnoses, may be followed by a therapeutic TMJ lavage, contributing factors, and treatment plan. 8,20 which often provides symptom improvement Tumors in the TMJ are rare, and imaging to and may change some of the identifi ed detect intraosseous lesions in asymptomatic information. Since the wide availability of individuals is neither cost effective nor MRI, TMJ arthrography is rarely performed, biologically advisable. 18,21 because of its discomfort, relatively high radiation exposure, and invasiveness. FOCAL POINT The patient interview and examination provide HIGH -R ESOLUTION ULTRASOUND the most important information for establishing the TMD clinical diagnoses, contributing factors, The TMJ ’ s hard and soft tissues can be and treatment plan. imaged by high - resolution ultrasound. This procedure is able to detect condylar defects on It has been recommended that practitioners the anterior and lateral aspects, but has should image only if there is a reasonable diffi culty detecting defects on the medial expectation that the additional information aspect due to the limited space between the will infl uence a patient ’ s treatment glenoid fossa and the medial portion of the approach.1 6,17,22 Such selective imaging is condyle. This has led to errors such as osteo- advisable, and over- i maging will hamper a phytes (bony projections) being misdiagnosed practitioner ’ s ability to provide cost - effective as loose calcifi ed bodies within the joint care. Other than imaging for suspected C H A P T E R 4 I M A G I N G 67 odontogenic pathology, imaging has rarely 3. If the primary cause for the patient ’ s changed my treatment approach. complaint is due to the TMJ, take a screening radiograph, e.g., a transcranial FOCAL POINT or panoramic radiograph. If the TMJ It has been recommended that practitioners complaint is only noise that does not should image only if there is a reasonable need treatment, a screening radiograph is 1 expectation that the additional information will not needed. 6,18 infl uence a patient ’ s treatment approach. QUICK CONSULT QUICK CONSULT When the T MJ is the Primary Prescribing Imaging Cause for the Patient ’ s Complaint Other than imaging for suspected odontogenic If the primary cause for the patient’ s complaint pathology, imaging has rarely changed my is due to the TMJ take a screening radiograph, treatment approach. unless the complaint is only noise, then no imaging is necessary. IMAGING RECOMMENDATIONS The literature - supported imaging indications 4. If the patient ’ s TMD symptoms began that have been found useful are as follows: with or greatly worsened from trauma, take a panoramic radiograph to rule out a 1. If the practitioner is not aware of the fracture causing or contributing to the patent ’ s dental caries and periodontal patient ’ s pain. If the patient was not disease status, the practitioner may desire appropriately evaluated for a fracture to take dental radiographs. following the trauma, and the practitioner 2. A practitioner who suspects, based on the suspects the patient may have a fracture patient interview and clinical examina- in a bone that would not be revealed by tion, that a patient may have pathology the panoramic radiograph, then appropri- should not hesitate to take a screening ate radiographs would be indicated. radiograph, such as a transcranial or panoramic radiograph. Use common sense; e.g., a patient with facial pain and QUICK CONSULT swelling after the extraction of a man- Observing for Trauma History dibular tooth may have a fractured If the patient’ s TMD symptoms began or greatly mandible. worsened with trauma, take a panoramic radiograph to rule out a fracture causing or contributing to the patient ’ s pain. QUICK CONSULT Prescribing for a Screening Radiograph 5. If the patient has pain and is taking (or A practitioner who suspects, based on the has taken for a period of time) a bisphos- patient interview and clinical examination, that a phonate (i.e., Boniva, Fosamax, Actonel, patient may have pathology should not hesitate Zometa, etc.), take a panoramic radio- to take a screening radiograph, such as a graph to rule out osseous pathology as the transcranial or panoramic radiograph. cause for the pain. 23 68 P A R T I I N I T I A L E V A L U A T I O N 6. If the patient relates a developing or patients have pain (which may occur only progressively increasing open bite of the when the patient attempts to occlude into anterior teeth, the patient
may have such maximum intercuspation), and the severe TMJ osteoarthritis that it is causing occlusal change fl uctuates with the the condyle to lose its vertical height. If disorder ’ s severity. A test to evaluate these the patient has such severe osteoarthritis, is provided in chapter 9 . it should be visible in a screening radio- TMD patients frequently relate a graph, such as a transcranial or panoramic history of swelling over the region of their radiograph. An axially corrected sagittal pain (e.g., preauricular swelling). The tomogram or CBCT would provide a swelling caused by TMD is a minor better view of the degenerative changes, indistinct elevation (usually only notice- but would not change the patient ’ s able by the patient) that fl uctuates with treatment approach. The practitioner may the disorder ’ s severity. desire a CBCT in order to better follow If the practitioner suspects the patient changes in the condyle ’ s status throughout may have a growth within the TMJ or treatment. This disorder and its treatment these changes do not respond to initial are complicated and beyond the scope of therapy, it is recommended someone with this book. Practitioners observing this expertise in this area evaluate the complaint may desire to refer the patient disorder. to someone with greater expertise in this 8. TMJ implants composed of Tefl on - area. A method for identifying these Proplast and Silastic have a history of practitioners is provided in “ Practitioners fragmenting, causing a foreign- b ody with TMD Expertise and Fellowship response that results in progressive Programs. ” in appendix 13 . degeneration of the condyle and glenoid 7. If the patient has a progressively increasing fossa. A specifi c imaging and management posterior open bite, midline deviation, or protocol has been recommended for these observable preauricular swelling, the patient implants and total joint prostheses, which may have a neoplastic growth within the is beyond the scope of this book. 24 If the TMJ and the practitioner may desire a practitioner is unsure of the implant type screening radiograph. Neoplasia arising in or management, it is recommended the the TMJ are rare,1 8 but if this were to occur practitioner refer the patient to, or work within the restricted space of the TMJ, it in conjunction with, someone who has might cause the condyle to move inferior or greater expertise in this area. anterior - inferior, thereby causing a progres- 9. If the patient does not respond to TMD sively increasing posterior open bite and/or therapy as anticipated, take a panoramic midline deviation. A neoplasm on or near radiograph to screen for other possible the TMJ ’ s lateral surface may clinically pathologies. Additional suggestions are manifest as a progressively increasing provided in “ TMD Refractory to Initial observable preauricular swelling. Therapy ” in chapter 19 . A posterior open bite or a change in the midline alignment are fairly fre- QUICK CONSULT quently observed among TMD patients. Observing Poor Therapy Response The occlusal change is typically caused by If the patient does not respond to TMD therapy a disorder such as a lateral pterygoid as anticipated, take a panoramic radiograph to myospasm or TMJ infl ammation. These screen for other possible pathologies. C H A P T E R 4 I M A G I N G 69 10. If the patient is being referred for a TMJ REFERENCES surgical evaluation, the surgeon will probably request imaging. Let the surgeon 1. Larheim TA , Westesson P - L . TMJ imaging . In: L askin D M, G reene C S, H ylander W L. T emporo- prescribe the desired imaging. Clinical mandibular Disorders: An Evidence- B ased experience has shown that, out of mere Approach to Diagnosis and Treatment . Hanover curiosity, some practitioners like to Park, IL : Quintessence , 2006 , pp 149 – 179 . request the imaging they anticipate the 2. Honey OB , Scarfe WC , Hilgers MJ , Klueber K , surgeon will want. It is recommended Silveira AM , Haskell BS , Farman AG . Accuracy of the practitioner not try to anticipate and cone - beam computed tomography imaging of the prescribe the imaging, because there are temporomandibular joint: Comparisons with many variables that will dictate the panoramic radiology and linear tomography. A m J surgeon ’ s imaging decision, i.e., patient ’ s Orthod Dentofacial Orthop 2007 ; 132 ( 4 ): 429 – 438 . insurance coverage, convenience to an 3. Milam SB . TMJ osteoarthritis . In: Laskin DM , imaging center, etc. Practitioners request- Greene CS , Hylander WL . Temporomandibular ing images merely out of curiosity will Disorders: An Evidence - Based Approach to Diagnosis and Treatment . Hanover Park, IL : probably cost the patient unnecessary loss Quintessence , 2006 : 105 – 124 . of money and time. 4. Mercuri LG . Osteoarthritis, osteoarthrosis, and 11. Occasionally a third - party payer requests idiopathic condylar resorption. O ral Maxillofac that an MRI or other imaging be pre- Surg Clin North Am 2008 May; 20 ( 2 ): 169 – 183 , scribed to document the status of the v – vi. TMJ or for medicolegal reasons. 5. Stegenga B . Osteoarthritis of the temporomandibu- lar joint organ and its relationship to disc displace- This long list of indications may leave ment . J Orofac Pain 2001 ; 15 ( 3 ): 193 – 205 . the reader assuming most TMD patients 6. American Society of Temporomandibular Joint will need imaging. But muscle pain is the Surgeons . White paper: Guidelines for diagnosis most common primary source for TMD and management of disorders involving the patients ’ complaints, so the majority of temporomandibular joint and related musculoskel- etal structures . Cranio 2003 ; 21 ( 1 ): 68 – 76 . TMD patients will not need imaging. The 7. Kurita H , Uehara S , Sakai H , Kamata T , Kurashina parameters of care of the American Academy K . Radiographic follow - up of diseased temporoman- of Oral and Maxillofacial Radiology for TMD dibular joints. O ral Surg Oral Med Oral Pathol muscle disorders relates that therapy can be Oral Radiol Endod 2005 ; 100 ( 4 ): 427 – 432 . provided, and allow the patient ’ s response to 8. Okeson JP . Management of Temporomandibular treatment determine whether imaging is Disorders and Occlusion , 6th ed. St Louis : CV indicated.1 9,25 Mosby , 2008 :258, 259 , 431 . If the practitioner desires to use imaging 9. Ishihama K , Iida S , Kimura T , Koizumi H , to screen all TMD patients, then plain Yamazawa M , Kogo M . Comparison of surgical and (e.g., transcranial) or panoramic radiographs nonsurgical treatment of bilateral condylar fractures would be the most cost- e ffective form of based on maximal mouth opening . Cranio imaging. 2007 ; 25 ( 1 ): 16 – 22 . 10. Andersson J , Hallmer F , Eriksson L . Unilateral mandibular condylar fractures: A 31- y ear follow- u p FOCAL POINT of non - surgical treatment . Int J Oral Maxillofac If the practitioner desires to use imaging to Surg 2007 ; 36 ( 4 ): 310 – 314 . screen all TMD patients, then plain (e.g., tran- 11. Collins TE , Laskin DM , Farrington FH , Shetty NS , scranial) or panoramic radiographs would be the Mourino A . Pseudocysts of the mandibular condyle imaging of choice. in children . JADA 1997 ; 128 ( 6 ): 747 – 750 . 70 P A R T I I N I T I A L E V A L U A T I O N 12. Kamelchuk L , Nebbe B , Baker C Major P . Diagnosis and Management , 4th ed. Chicago : Adolescent TMJ tomography and magnetic Quintessence , 2008 : 39 , 133 , 144 , 145 . resonance imaging: A comparative analysis . J Orofac 19. Okeson JP . Growing into a new specialty: One Pain 1997 ; 11 ( 4 ): 321 – 327 . person ’ s perspective . Cranio 2007 ; 25 ( 4 ): 229 – 231 . 13. Hussain AM , Packota G , Major PW , Flores - Mir C . 20. Westesson P - L . Physical diagnosis continues to be Role of different imaging modalities in assessment the gold standard . Cranio 1999 ; 17 ( 1 ): 3 – 4 . of temporomandibular joint erosions and osteo- 21. Howard JA . Imaging techniques for the diagnosis phytes: A systematic review . Dentomaxillofac Radiol and prognosis of TMD . J Calif Dent Assoc 2008 ; 37 ( 2 ): 63 – 71 . 1990 ; 18 ( 3 ): 61 – 71 . 14. Rinchuse DJ , McMinn JT . Summary of evidence - 22. Christiansen EL , Thompson JR . Radiographic based systematic reviews of temporomandibular evaluation of the TMJ . In: Pertes RA , Gross SG disorders . Am J Orthod Dentofacial Orthop (eds). Clinical Management of Temporomandibular 2006 ; 130 ( 6 ): 715 – 720 . Disorders and Orofacial Pain . Chicago : Quintes- 15. Quereshy FA , Savell TA , Palomo JM . Applications sence , 1995 : 161 . of cone beam computed tomography in the practice 23. Hess LM , Jeter JM , Benham - Hutchins M , Alberts of oral and maxillofacial surgery. J Oral Maxillofac DS . Factors associated with osteonecrosis of the jaw Surg 2008 ; 66 ( 4 ): 791 – 796 . among bisphosphonate users. A m J Med 16. Brooks SL , Brand JW , Gibbs SJ , Hollender L , Lurie 2008 ; 121 ( 6 ): 475 – 483 . AG , Omnell K - A , Westesson P - L , White SC . 24. American Association of Oral and Maxillofacial Imaging of the temporomandibular joint: A Surgeons . Recommendations for management of position paper of the American Academy of Oral patients with temporomandibular joint implants. and Maxillofacial Radiology . Oral Surg Oral Med Temporomandibular Joint Implant Surgery Oral Pathol Oral Radiol Endod 1997 ; 83 : 609 – 618 . Workshop . J Oral Maxillofac Surg 17. Limchaichana N , Petersson A , Rohlin M . The 1993 ; 51 ( 10 ): 1164 – 1172 . effi cacy of magnetic resonance imaging in the 25. White SC , Heslop EW , Hollender LG , Mosier KM , diagnosis of degenerative and infl ammatory Ruprecht A , Shrout MK ; American Academy of temporomandibular joint disorders: A systematic Oral and Maxillofacial Radiology, ad hoc Commit- literature review . Oral Surg Oral Med Oral Pathol tee on Parameters of Care. Parameters of radiologic Oral Radiol Endod 2006 ; 102 ( 4 ): 521 – 536 . care: An offi cial report of the American Academy of 18. American Academy of Orofacial Pain . de Leeuw R Oral and Maxillofacial Radiology . Oral Surg Oral (ed). O rofacial Pain: Guidelines for Assessment, Med Oral Pathol Oral Radiol Endod 2001 ; 91 ( 5 ): 498 – 511 . Chapter 5 TMD Diagnostic Categories FAQ Q: Why do people who have a displaced disc often do well even though their condyle continues to articulate on the retrodiscal tissue? A: In the healthy TMJ, the repeated loading of the retrodiscal tissue causes adaptive changes within this tissue, making it comparable to the disc, and this is sometimes called a pseudodisc. Many TMD patients concurrently have patient ’ s chief complaint is pain, the diagnosis muscle and TMJ pain in additional to TMJ for the structure that reproduces the pain is the noise. Each of these fi ndings represents a primary diagnosis. When multiple structures different TMD diagnosis; therefore, multiple reproduce a complaint, the structure that most TMD diagnoses are very common for TMD readily reproduces it probably has the greatest patients. To make the list of diagnoses impact on it, and its diagnosis would be the meaningful, they are ranked in the order primary diagnosis. The diagnoses for the other of their contribution of the patient’ s areas that reproduce the pain, followed by complaint(s), as primary, secondary, tertiary, diagnoses involving tender structures that do etc. not
reproduce the pain, are the secondary diagnosis, tertiary diagnosis , etc. QUICK CONSULT When a patient has more than one com- Ranking T MD Diagnoses plaint, these are also ranked; e.g., pain is the Since multiple TMD diagnoses are very common primary complaint, catching within the TMJ for TMD patients, they are ranked as primary, is secondary, and TMJ noise is tertiary. This secondary, tertiary, etc. complaint list is used to prioritize the diagnoses further. Ordering the diagnoses in this manner may sound complicated, but once practitioners The primary TMD diagnosis is the have had a little practice formulating this list, it diagnosis for the disorder most responsible for becomes simple and is very helpful in formulat- a patient ’ s chief complaint. For example, if a ing the treatment recommendations. 71 72 P A R T I I N I T I A L E V A L U A T I O N Similar to many areas of medicine, TMD is studies reveal that approximately 30% of plagued by inconsistent diagnostic categories asymptomatic volunteers have a displaced and terminology. The American Academy of disc.3 Since disc displacements are so prevalent Orofacial Pain (AAOP) has published TMD among the normal population (as well as the diagnostic categories and criteria. This classifi - TMD population), it may be considered a cation, which is the most widely accepted physiological accommodation without clinical TMD terminology, is the terminology used in signifi cance for many individuals. this book. The AAOP acknowledges that its classifi cation and criteria are hampered by the limited knowledge about TMD disorders, the QUICK CONSULT inability to develop diagnostic classifi cations Evaluating Disc Displacement for all TMD disorders, and the fact that no Signifi cance one set of criteria will satisfy all circumstances Since disc displacements are so prevalent for the diagnosis.1 among the normal population (as well as the The diagnostic categories described in this TMD population), it may be considered a chapter are separated into TMJ articular physiological accommodation without clinical disorders and masticatory muscle disorders . signifi cance for many individuals. The recommended diagnostic criteria repre- sent c linical diagnoses based on information that can be obtained from a patient’ s history To help explain disc displacement disor- and clinical examination. They are not meant ders, a “ TMJ Disc Displacements ” diagram is to be rigid criteria, but only provide guidance, provided as appendix 3 . The diagram is and clinical judgment should be relied on for broken into four sections, in which the top the fi nal decision. 1 left section provides an overview and the top right section portrays the “ normal ” disc - condyle alignment. TMJ ARTICULAR DISORDERS For a disc to displace, the retrodiscal tissue (elastic ligament, in addition to its attachment This section covers disorders that affect the complex) must stretch, allowing the disc to TMJ and includes fi ve articular disorders in move anteriorly, as the disc - condyle alignment addition to TMJ fractures, congenital or depicts in the top drawing in the bottom left developmental disorders, and neoplasms. The section. 3 Reports of the disc being posteriorly most common TMD diagnosis found in the displaced are relatively rare. 4 general population is TMJ disc displacement Once the disc is displaced, the portion of with reduction, but most patients with this the retrodiscal tissue located where the disc diagnosis generally do not seek therapy for it. used to be is subjected to repeated loading by Patients most commonly seek TMD therapy the condyle. In a healthy TMJ, the repeated for pain, with the masticatory muscles being loading on this portion of the retrodiscal the most common source, followed by TMJ tissue causes adaptive changes, thereby articular disorder.1 ,2 providing most of the physical characteristics of the disc. 5 This is analogous to what Disc Displacement Disorders happens to our hands when we increase our physical activity, which causes adaptive These are the most common TMJ articular changes of the skin to develop calluses. This disorders. 1 Autopsy, clinical, and imaging modifi ed retrodiscal tissue functions well as C H A P T E R 5 T M D D I A G N O S T I C C A T E G O R I E S 73 the disc, withstands TMJ loading somewhat through the mandible and be perceived in the comparable to the disc, and has been referred contralateral TMJ. The TMJ that is generat- to as a p seudodisc .6 ,7 ing the noise can usually be determined by There is no known anatomical mechanism having the patient start in maximum intercus- for an anteriorly displaced disc to retract back pation and move laterally to the one side to its normal disc- c ondyle relationship. People several times and then laterally to the other commonly relate that their TMJ clicking side several times. The click or pop is gener- comes and goes; e.g., it occurs when the ated during the translation phase, and which- individual eats or is stressed and does not ever TMJ is translating when the noise is occur when relaxed. It is postulated that the generated is the source of the noise. TMJ anatomy (e.g., disc displacement with reduction) does not change, but clinically it TECHNICAL TIP appears the TMJ noise may vary with the Determining Origin of a Patient’ s degree of sustained joint loading. Disc displacement with reduction is the TMJ Noise most common diagnosis for patients with If the practitioner cannot determine which TMJ TMJ clicking or popping. 4,8 The top drawing is generating the click or pop, the TMJ can in the bottom left section of the “ T MJ Disc usually be identifi ed by asking the patient to Displacements ” diagram depicts a displaced start in maximum intercuspation and move disc. As the individual opens his or her laterally to one side several times and then mouth, the condyle translates forward and laterally to the other side several times. The click moves into the intermediate zone of the disc or pop is generated during the translation phase, (called the reduced position , shown in the and whichever TMJ is translating when the noise bottom drawing of the bottom left section), is generated is the source of the noise. which may cause an opening click or pop. As the mouth continues to open, the condyle Most individuals with a click or pop have a continues to translate forward with the disc TMJ disc displacement with reduction, but a and remains in the disc ’ s intermediate zone. smaller percentage have a normal disc- condyle position or a disc displacement without FOCAL POINT reduction.4 ,8 Conversely some patients without Disc displacement with reduction is the most any noise have a disc displacement with common diagnosis for patients with TMJ clicking reduction. 4,8 There are no clinical criteria to or popping. differentiate these individuals, but it has been shown that, if an individual has an opening As the individual closes, the condyle retrudes and closing click or pop with the opening and moves back under the posterior band noise occurring at a wider opening than the onto the retrodiscal tissue, which may cause a closing noise, he or she has a high probability closing click or pop. As the mouth continues of having a disc displacement with reduction.1 ,8 to close, the condyle remains on the retrodis- cal tissue. If both opening and closing noises are present, the opening click or pop occurs at QUICK CONSULT a wider opening than the closing click or pop. Understanding Variability of Disc Sometimes the patient and practitioner Displacement with Reduction cannot determine which TMJ is generating Some patients without any TMJ noise have a the click or pop, since the vibration can travel disc displacement with reduction. 74 P A R T I I N I T I A L E V A L U A T I O N The clinical criteria a practitioner chooses to The effect of TMD therapy on TMJ noise use for a diagnosis of disc displacement with is variable, because there are no established reduction may vary from a single click or pop to predictors to suggest which patients will an opening and closing click or pop in which receive noise improvement. As a general the opening noise occurs at a wider opening. conservative guide, it is estimated that approx- Personally I use the following clinical criteria: imately one- t hird of patients provided occlusal (1) the palpable presence of a click or pop; (2) if appliance therapy will report signifi cant noise the noise is not palpable during the exam, then improvement or elimination, one - third will a relatively recent history of a click or pop that report minor noise improvement, and one - tends to fl uctuate in its presence; or (3) if an third will report no noise improvement.9 ,10 A opening and closing click or pop is present, then case scenario of a patient with a disc displace- the opening noise occurs at a wider opening. ment with reduction is presented in “ C ase 10” A more accurate assessment can be obtained in part V . by a TMJ MRI at maximal intercuspation and Acute disc displacement without reduc- opening positions, but the fi ndings rarely tion (also known as closed lock ) may be change the practitioner ’ s treatment approach, diagnosed when a patient has sudden onset of and MRI is rarely indicated to confi rm this a persistent marked limited opening (less than diagnosis.1 ,9 Spending extensive time or using 35 mm). 1 Patients with this disorder are often specialized equipment to verify the noise is aware that something within the TMJ blocks also not warranted. them from obtaining their normal opening Disc displacement with reduction generally and are limited to the opening where the does not progress to disc displacement TMJ previously clicked or popped. Many without reduction unless the patient has patients report a history of their TMJ catch- pain. 5 If the noise is the only complaint and is ing at that location or intermittently having not an embarrassment or problem for the had this problem (lasting seconds to days), patient, then it is recommended the practitio- which suddenly released and allowed them to ner provide no therapy beyond education.1 ,9 regain their normal opening. The “ TMJ Disc Displacements ” diagram is This disorder is demonstrated in the used to explain the cause and inform the bottom right section of the “ T MJ Disc patient that TMJ noise is common, similar to Displacements ” diagram. As the mouth opens, noise in other joints of the body. the condyle fi rst rotates then attempts to If the click is associated with catching or translate forward, but it cannot slide under momentary locking, out of fear this may the disc ’ s posterior band to reduce onto the progress to a permanent lock (acute disc intermediate zone of the disc. The translation displacement without reduction), traditional is limited by the disc and typically the patient TMD therapies should be provided to elimi- is initially able to open only between 20 and nate the catch or lock and reduce the poten- 30 mm. tial of it progressing to a permanent lock. 9 In theory, as the patient attempts to open wider, the ipsilateral TMJ translation is QUICK CONSULT restricted by the disc while the contralateral Understanding Progression of a TMJ can translate beyond that point, and the Disc Displacement with Reduction practitioner would observe the mandible Disc displacement with reduction generally does defl ecting to the affected side. Also during the not progress to disc displacement without range - of - motion evaluation, the practitioner reduction unless the patient has pain. would observe a marked limitation to the C H A P T E R 5 T M D D I A G N O S T I C C A T E G O R I E S 75 contralateral side. Clinically these fi ndings are fractured condyle, or other causes in addition not always observed, because patients tend to to an acute disc displacement without reduc- guard against moving their mandible into tion. A more accurate assessment of the disc ’ s painful positions, and the contralateral side location can
be obtained by a TMJ MRI at may also have pain limiting a patient’ s maximum intercuspation and maximum movements. opening, but this clinical diagnosis can be A marked limited opening can also be determined by history and clinical examina- caused by a muscle disorder, but a limited tion. Recommended treatments for acute disc opening from a muscle disorder would displacement without reduction are provided typically exhibit a gradual onset (hours to in chapter 10 , “ Acute TMJ Disc Displace- days). One may also be able to differentiate ment without Reduction.” Case scenarios of the origin of the restriction for a patient with patients with various degrees of acute TMJ a marked limited opening by stretching the disc displacement without reduction are mouth beyond a comfortable opening, as presented in “ Case 12 ” through “ Case 14 ” in described in “ R ange of Motion” in chapter 3 . part V . Patients with a lateral pterygoid myospasm Chronic disc displacement without often present with similarities to the acute reduction may be diagnosed when a patient disc displacement without reduction disorder. has a history of sudden - onset limited opening These patients often have a marked limited that gradually increased to greater than opening in which the ipsilateral condyle has a 35 mm. This history suggests the patient had limited ability to translate. One of the major an acute disc displacement without reduction, differentiation factors is that patients with an and over time the retrodiscal and collateral acute disc displacement without reduction can tissues stretched, enabling the disc to move generally put their teeth into maximum forward, allowing the condyle to translate intercuspation without pain, whereas patients further and permitting the patient to open with a lateral pterygoid myospasm usually wider. relate that they cannot close or that they have signifi cant pain when closing into maximum QUICK CONSULT intercuspation. Additional information on Diagnosing Chronic Disc diagnosing and treating the lateral pterygoid Displacement without Reduction myospasm is provided in chapter 9 , “ Lateral Chronic disc displacement without reduction Pterygoid Myospasm. ” may be diagnosed when a patient has a history of sudden - onset limited opening that gradually QUICK CONSULT increased to greater than 35 mm. Observing Lateral Pterygoid Myospasm Presentation The mechanism for this transition is Patients with a lateral pterygoid myospasm activated every time the individual attempts to often present with similarities to the acute disc open beyond the restriction. This causes the displacement without reduction disorder. condyle to push against the posterior side of the disc, which puts a stretching force on the retrodiscal tissue. Repeatedly bumping the If the sudden limited opening is due to disc in this manner will often suffi ciently external trauma, this limited opening may be stretch the retrodiscal tissue over time, from a muscle injury, TMJ infl ammation, allowing the disc to move forward so that the 76 P A R T I I N I T I A L E V A L U A T I O N normal translation and opening are eventually the three palpation locations described in regained. Many individuals can move through “ TMD Palpations ” in chapter 3 . This disorder this transition without treatment (some with may be localized to the TMJ or due to a minimal discomfort), but others cannot. 11 systemic condition also affecting other joints This transition is often reported to take a few of the body. weeks to months and may have occurred Synovitis and capsulitis can cause TMJ many years ago. This may not have been a tenderness or pain, and they cannot be signifi cant event for the patient or may have clinically differentiated. The collective term occurred with trauma, so a patient with this TMJ infl ammation is used to signify either disorder may not remember such a history. or both and is diagnosed whenever there is Coarse crepitus is the most common noise TMJ tenderness. Traditional TMD therapies associated with this disorder, but some patients have been shown to benefi t patients with TMJ have no noise, or a single click or a reciprocal infl ammation. click. 8 Personally the clinical criteria of the Polyarthritides is a systemic condition that patient reporting this history or having coarse may cause TMJ infl ammation as well as crepitus is used to clinically diagnose this tenderness and/or pain in other joints of the disorder. Traditional TMD therapies have been body, e.g., rheumatoid arthritis. The systemic shown to benefi t patients with this disorder. condition may go through acute fl are - up and remission phases. As these changes occur, Dislocation (Also Known as Subluxation) observing the degree to which the TMJ infl ammation follows the course of infl amma- A dislocation is diagnosed when a patient tion in other joints may suggest whether the presents with or relates a history of momentary TMJ involvement is related more to the or prolonged inability to close the mandible systemic condition or to traditional TMD from a maximal open position. In this disorder, contributing factors. The systemic condition the condyle is caught in front of the articular should be treated by a physician while the eminence. It may be due to the articular local component caused by TMD contribut- eminence obstructing the posterior movement ing factors should be treated with traditional of the disc - condyle unit, the disc obstructing TMD therapies. TMJ involvement is often the posterior movement of the condyle, or a treated by combining medical and dental combination of the two.1 2 Conservative therapies, and the TMD treatment may help treatments for TMJ dislocation are discussed in to minimize the medications the physician chapter 11 , “ TMJ Dislocation. ” needs to prescribe. Infl ammatory Disorders TECHNICAL TIP Working with Physicians The synovial fl uid within the TMJ contains The systemic portion of a polyarthritides should the lubricant for the joint and the nutrients be treated by a physician while the local compo- for the articular surfaces. TMJ infl ammation nent caused by TMD contributing factors should can deteriorate these substances, thereby be treated with traditional TMD therapies. leading to the breakdown of the articular surfaces and contributing to other articular Osteoarthritis problems. 1,13 TMJ infl ammation is diagnosed when the This condition, in which TMJ infl ammation TMJ is tender to palpation at one or more of is associated with articular tissue and bone C H A P T E R 5 T M D D I A G N O S T I C C A T E G O R I E S 77 degeneration,3 ,13 is diagnosed when the TMJ progressively increasing open bite of the is tender to palpation and hard- t issue imaging anterior teeth that progresses to the posterior reveals bony changes, i.e., subchondral teeth. This disorder and its treatment are sclerosis, osteophyte formation, or erosion. complicated and beyond the scope of this The bony changes are active when the TMJ is book. A practitioner observing this complaint painful or tender and the radiographic may desire to refer the patient to someone changes lag behind the active disorder by as with greater expertise in this area. A method much as 6 months. 1,3,9 Therefore, the practi- for identifying these practitioners is provided tioner should treat the patient’ s symptoms to in “ Practitioners with TMD Expertise and bring this disorder under control and not rely Fellowship Programs ” in appendix 13 . on the radiographic fi ndings. TMJ osteoarthritis is subdivided into If radiographs are not taken, this disorder primary and secondary osteoarthritis, which would be diagnosed as TMJ infl ammation. are differentiated by their etiologic factors. Not having the radiographic support to Primary and secondary osteoarthritis are both diagnose osteoarthritis is not a problem generally referred to as TMJ osteoarthritis . because the treatment goal for both disorders is to treat the TMJ infl ammation pain. As the 1. Primary osteoarthritis is diagnosed when infl ammation resolves, the osseous degenera- there is no identifi able etiologic factor, and tion concurrently resolves and adaptive therefore the osseous degeneration and remodeling occurs. 14 TMJ infl ammation are presumed to be due to TMJ overloading from parafunctional habits, etc.1,13,15 QUICK CONSULT Traditional TMD thera- Failing to Image for Osteoarthritic pies have been shown to reduce TMJ Changes infl ammation, thereby inactivating the degenerative process.1 5 Osteoarthritic changes are active when the TMJ 2. Secondary osteoarthritis is diagnosed is painful or tender. If radiographs were not when there is an identifi able etiologic taken, the same treatment objective would be factor for the disorder, i.e., direct trauma, sought — decrease the TMJ infl ammation. As the TMJ infection, or active systemic arthritis. infl ammation resolves, the osseous degeneration If the etiologic factor can be resolved (e.g., concurrently resolves and adaptive remodeling TMJ infection), that should be accom- occurs. plished fi rst. If TMJ infl ammation remains or the etiologic factor cannot be adequately Occasionally the osteoarthritis is so severe altered, then traditional TMD therapies that the osseous degeneration will cause the should be implemented. This has been condyle to lose its vertical height. As the shown to reduce the TMJ loading and will condylar height collapses, the most posterior thereby inactivate the degenerative process. ipsilateral tooth becomes the fi rst tooth to contact, acts as a fulcrum, and progressively Ankylosis creates an open bite for the remaining denti- tion. The open bite generally begins on the This is the fi rm restriction of the TMJ due to contralateral anterior teeth and progressively fi brous bands or osseous union within the spreads bilaterally until only the most poste- TMJ and is generally not associated with pain. rior ipsilateral tooth makes contact. In this It can be the result of direct trauma, systemic situation, the patient initially observes a disease, surgery, etc. The involved condyle has 78 P A R T I I N I T I A L E V A L U A T I O N no or very limited translation and the amount non - TMD purpose. The patient may not have of rotation will vary with the type and extent any symptoms associated with the fracture or of the ankylosis.6 ,16 be aware of the fracture. Subcondylar fractures As a patient with TMJ ankylosis attempts are the most common, and the condyle may to open beyond the restriction, the ankylosed even be dislocated out of the glenoid fossa. TMJ will have very limited translation, the Most patients with condylar fractures do well contralateral TMJ will continue to translate, with only conservative therapy, with a higher and the practitioner should observe the risk associated with bilateral fractures and the mandible defl ecting to the affected side. condyle being dislocated out of the fossa. 17 – 19 During the range - of - motion evaluation, the practitioner should also observe a marked Congenital or Developmental Disorders limitation to the contralateral side. Digital palpation of the affected TMJ during maximal These disorders rarely cause TMD symptoms. movements will also refl ect no or very limited The chief complaint may be esthetics or translation of the condyle. 6 function, and the disorder may be inadver- tently observed on a panoramic image taken QUICK CONSULT for a non - TMD purpose. Understanding T MJ Ankylosis Ankylosis is the fi rm restriction of the TMJ due 1. Aplasia is the faulty or incomplete devel- to fi brous bands or osseous union within the opment of the mandible or cranial bone. TMJ and is generally not associated with pain. 2. Hypoplasia is the underdevelopment of the mandible or cranial bone. 3. Hyperplasia is the overdevelopment of the 1. Fibrous ankylosis is associated with a mandible or cranial bone. limited opening and ability to translate. 4. Dysplasia is abnormal tissue development. Treatment depends on the degree of 5. Neoplasia is a malignant or benign disease dysfunction and discomfort. If the patient process that results in the formation and has adequate function and minimal discom- growth of a tumor. Reports of TMD fort, no treatment is indicated. If the patient symptoms caused by a tumor are very rare. desires to have the disc - condyle assembly released, TMJ surgery (e.g., arthroscopic or open joint surgery) will be needed.6 MASTICATORY MUSCLE DISORDERS 2. Bony ankylosis is caused by the union of the osseous structures within
the TMJ, Muscle pain is the most common source of causing an extremely limited ability for the TMD pain. 2 Masticatory muscle disorders are patient to open or the condyle to translate similar to muscle disorders in other parts of or possibly even rotate. This condition is the body and are therefore treated using the rare, and treatment involves open joint same principles. 1 surgery to release and recontour the osseous structures. 6,16 Myofascial Pain Fracture Myofascial pain is the most common muscle diagnosis and is generally described by TMJ fracture may fi rst be noticed on a patients as an ache, pressure, and/or dull pain, routine panoramic radiograph taken for a but can be throbbing when more severe.2 0 C H A P T E R 5 T M D D I A G N O S T I C C A T E G O R I E S 79 TMD patients most commonly have myofas- From a clinically practical viewpoint, if the cial pain in their closure muscles (masseter, muscle is tender to palpation and none of the temporalis, and medial pterygoid muscles). other masticatory muscle disorders better These muscles are tender to palpation, and describe the patient’ s condition, it is recom- ideally the practitioner would identify trigger mended the muscle tenderness be diagnosed points to arrive at this diagnosis, but they may as myofascial pain. Among the TMD patients be diffi cult to discern, even for practitioners I have seen who have muscle tenderness, it is experienced in palpating muscles. 21 estimated that more than 95% of the time I diagnose the muscle tenderness as myofascial FOCAL POINT pain. Traditional TMD therapies have been Myofascial pain is the most common cause for shown to reduce masticatory myofascial pain. muscle pain and palpation tenderness and is generally described by patients as an ache, pressure, and/or dull pain, but can be throbbing TECHNICAL TIP when more severe. Diagnosing Myofascial Pain From a clinically practical viewpoint, if the A practitioner may be able to identify one muscle is tender to palpation and none of the or more trigger points or nodules of spot other masticatory muscle disorders better tenderness by palpating the full extent of a describe the patient ’ s condition, it is recom- muscle with myofascial pain. These are mended the muscle tenderness be diagnosed as localized, fi rm, tender nodules that feel like myofascial pain. fi rm knots within the muscle and are more tender than the surrounding muscle. Palpa- tion of these tender nodules may generate Myositis pain within that structure, pain beyond the structure, referred pain to a distant location, This disorder is characterized by infl ammation and/or autonomic responses. 1 Firm, sustained of the muscle due to a spreading infection, palpation on the tender nodules maximizes external muscle trauma, or muscle strain. the generated effect. Patients often relate the symptom onset Muscle pain is often aggravated by the directly to this event. The symptoms are patient ’s stimulating these tender nodules constant acute pain within the muscle, which through muscle function, stress, etc. Some- may additionally be swollen and red, with an times practitioners prefer to inactivate these overlying increased temperature. The muscle nodules in an attempt to confi rm the diagno- is tender to palpation and may cause a limited sis, identify the degree of pain that is being range of motion. If the infl ammation involves generated by the nodule, or provide tempo- the tendon or tendon- m uscle attachment, the rary pain relief. Temporary inactivation can diagnosis may be tendonitis or tendomyositis. 1 be attempted through a trigger- p oint anes- If an infection is the etiology of the myosi- thetic injection, vapocoolant spray, transcuta- tis, then treatment must involve identifying neous electrical stimulation (TENS), etc. and resolving the infection, and antibiotic Myofascial pain is frequently the cause of therapy may be advisable. Additionally the regional pain in any part of the body (e.g., myositis should be treated with NSAIDs, low back pain). It involves the muscle and/or limiting the use of the masticatory muscles fascia, and many dentists incorrectly call it (e.g., soft diet or avoiding oral habits), and myofacial pain rather than myofascial pain. possibly using ice over the affected area for 80 P A R T I I N I T I A L E V A L U A T I O N the fi rst 48 hours after traumatic injury. Lateral and medial pterygoid myospasms Practitioners may fi nd the “ TMD Self - are the only myospasms I can recall treating, Management Therapies ” handout provided but a myospasm could occur in any muscle. I in appendix 4 helpful in explaining these treat the myospasm in a tiered approach and therapies. observe whether the recommended therapies adequately resolve the problem. The practitio- Myospasm ner may desire to begin with the “ T MD Self - Management Therapies ” handout pro- This is the involuntary contracture of a vided in the appendix, muscle- s tretching muscle, causing pain and interfering with its exercises, and medications. ability to move. This disorder has a rapid Any masticatory closure muscle myospasm onset and has awakened many of us in the should be actively stretched gradually to middle of the night with a cramp in the calf tolerance while ensuring the muscle is not muscle. A myospasm can occur in any of the aggravated by this procedure. It is recom- masticatory muscles, but it alarms patients mended that the muscle be stretched and held (and unaware practitioners) the most when it by the index and middle fi ngers for 30 – 60 occurs in the inferior lateral pterygoid muscle. seconds, ten or more times a day (Figure 5 .1) . A myospasm of the inferior lateral ptery- goid muscle causes constant involuntary contraction at a partially shortened position. Similar to an individual awaking with a calf myospasm that causes diffi culty and increased pain when attempting to move the foot up or down, the individual with a lateral pterygoid myospasm has diffi culty and increased pain when attempting to translate the condyle forward or retrude the jaw so the teeth fi t into maximum intercuspation. The patient usually complains of the inability to put the ipsilateral posterior teeth together without excruciating pain (the teeth are usually separated by a fraction of a millimeter to a few millimeters), and the fi rst tooth contact is in the area of the contralateral canine (if the patient has normal tooth alignment). Since the patient has diffi culty translating forward, he or she also usually has a marked limited opening. The rapid onset and ability to reduce the pain by stretching Figure 5.1. Stretching exercise recommended for the lateral pterygoid muscle help confi rm this a masticatory closure muscle myospasm, diagnosis rather than other diagnoses that can myofi brotic contracture, or an acute TMJ disc cause a similar posterior open bite. Diagnosis displacement without reduction. This exercise is recommended rather than the “ Closure Muscle- and treatments for the lateral pterygoid Stretching Exercise” in appendix 6 because these myospasm are provided in chapter 9 , “ Lateral conditions require more forceful stretching, which Pterygoid Myospasm. ” may cause the digastric muscles to become painful. C H A P T E R 5 T M D D I A G N O S T I C C A T E G O R I E S 81 Patients usually benefi t from an analgesic muscle forcibly beyond its fi rm limitation. (e.g., 800 mg ibuprofen, t.i.d.) and a muscle Surgical detachment and reattachment of the relaxant (e.g., 5 mg diazepam, 1 – 2 tablets muscle may be indicated if the impairment is h.s.). If these initial therapies do not resolve severe.9 the myospasm or if it continues to recur, then A similar disorder, myostatic contracture , traditional TMD therapies (e.g., occlusal presents similarly, but the muscle does not appliance therapy, or identifying and changing have fi brous adhesions restricting its range of contributing factors) should be implemented motion. Closure muscles with this disorder and have been shown to be benefi cial. may be slowly stretched to regain the opening. 9 For a closure muscle with this TECHNICAL TIP condition, it is recommended that the man- Treating Myospasm dible be stretched and held by the index and middle fi ngers for 30 – 60 seconds, six times a Myospasm is usually improved by gradual day (Figure 5.1 ). Additional supportive active stretching of the muscle; this can be therapy may be needed, i.e., the “ T MD performed for a masticatory closure muscle by Self - Management Therapies ” handout placing the index and middle fi ngers over the provided in the appendix, an analgesic incisal edges of the mandibular anterior teeth. (e.g., 800 mg ibuprofen, t.i.d.), and/or a muscle relaxant (e.g., 5 mg diazepam, Myofi brotic Contracture 1 – 2 tablets h.s.). This is a painless disorder in which fi brous Centrally Mediated Myalgia adhesions within muscle do not allow the muscle to be stretched to its full length. When this In this disorder, the CNS maintains the condition involves a closure muscle (e.g., muscle in a state of constant pain and tender- masseter), then it limits a patient ’ s ability to open ness through the downregulation of peripheral wide, and forcibly attempting to stretch the neurogenic infl ammation. This disorder arises muscle beyond its fi rm limitation elicits pain. from prolonged pain or other input (e.g., Myofi brotic contracture may be caused by emotional stress) into the CNS. The disorder trauma, infl ammation, or the muscle not is diffi cult to delineate from myofascial pain being stretched beyond this limited range for and may occur in combination with it. 2,9 an extended period, enabling the fi brous This disorder does not generally resolve as adhesions to develop. 9 An inferior lateral quickly as myofascial pain. Since neurogenic pterygoid muscle could remain in a shorted infl ammation releases infl ammatory substances state from an individual wearing an anterior into the muscle, it is recommended the positioning appliance 24 hours a day and a patient be prescribed an NSAID (e.g., 800 m g closure muscle could remain shorted from an ibuprofen, t.i.d.) in addition to the other individual having intermaxillary fi xation. therapies recommended for myofascial pain. 2,9 Generally the fi brous adhesions cause a permanent limitation to the muscle’ s range of Local Myalgia motion, and traditional conservative TMD therapies would not help patients to regain This is a diagnostic category for additional the muscle ’ s range of motion. Clinically, muscle pain disorders that do not have suffi cient limited improvement has been achieved by distinguishing clinical characteristics to be given patients using tongue depressors to stretch the separate categories, e.g., protective splinting 82 P A R T I I N I T I A L E V A L U A T I O N muscle pain, delayed - onset muscle soreness, neuromuscular orthosis treatment affects reduction muscle fatigue, and muscle pain from ischemia.1 of TMD symptoms in 313 patients . Cranio 2008 ; 26 ( 2 ): 104 – 117 . Neoplasia 11. Minakuchi H , Kuboki T , Matsuka Y , Maekawa K , Yatani H , Yamashita A . Randomized controlled evaluation of non - surgical treatments for temporo- This is abnormal tissue growth, which may be mandibular joint anterior disk displacement without malignant or benign, and may be painful or reduction . J Dent Res 2001 ; 80 ( 3 ): 924 – 928 . pain free. Neoplasms of the masticatory 12. Yoda T , Imai H , Shinjyo T , Sakamoto I , Abe M , muscles are extremely rare. Enomoto S . Effect of arthrocentesis on TMJ disturbance of mouth closure with loud clicking: A REFERENCES preliminary study . Cranio 2002 ; 20 ( 1 ): 18 – 22 . 13. Milam SB . TMJ osteoarthritis . In: Laskin DM , 1. American Academy of Orofacial Pain , with de Greene CS , Hylander WL . Temporomandibular Leeuw R (ed). Orofacial Pain: Guidelines for Disorders: An Evidence - Based Approach to Assessment, Diagnosis and Management . Chicago : Diagnosis and Treatment . Hanover Park, IL : Quintessence , 2008 : 142 – 158 . Quintessence , 2006 : 105 – 124 .
2. Okeson JP . Growing into a new specialty: One 14. Kurita H , Uehara S , Sakai H , Kamata T , Kurashina person ’ s perspective . Cranio 2007 ; 25 ( 4 ): 229 – 231 . K . Radiographic follow - up of diseased temporoman- 3. Stegenga B . Osteoarthritis of the temporomandibu- dibular joints . Oral Surg Oral Med Oral Pathol lar joint organ and its relationship to disc displace- Oral Radiol Endod 2005 ; 100 ( 4 ): 427 - 32 . ment . J Orofac Pain 2001 ; 15 ( 3 ): 193 – 205 . 15. Fujimura K , Kobayashi S , Suzuki T , Segami N . 4. Yatani H , Sonoyama W , Kuboki T , Matsuka Y , Histologic evaluation of temporomandibular Orsini MG , Yamashita A . The validity of clinical arthritis induced by mild mechanical loading in examination for diagnosis of anterior disc displace- rabbits . J Oral Pathol Med 2005 ; 34 ( 3 ): 157 – 163 . ment with reduction. O ral Surg Oral Med Oral 16. Long X , Li X , Cheng Y , Yang X , Qin L , Qiao Y , Pathol Oral Radiol Endod 1998 ; 85 : 647 – 653 . Deng M . Preservation of disc for treatment of 5. Greene CS , Laskin DM . Long - term status of TMJ traumatic temporomandibular joint ankylosis . J clicking in patients with myofascial pain and Oral Maxillofac Surg 2005 ; 63 ( 7 ): 897 – 902 . dysfunction. JADA 1988 ; 117 : 461 – 465 . 17. Andersson J , Hallmer F , Eriksson L . Unilateral 6. Pertes RA , Gross SG . Disorders of the temporo- mandibular condylar fractures: A 31- y ear follow- u p mandibular joint . In: Pertes RA , Gross SG (eds). of non - surgical treatment . Int J Oral Maxillofac Clinical Management of Temporomandibular Surg 2007 ; 36 ( 4 ): 310 – 314 . Disorders and Orofacial Pain . Chicago : Quintes- 18. Marker P , Nielsen A , Bastian HL . Fractures of the sence , 1995 : 78 , 85 – 86 . mandibular condyle. Part 1: Patterns of distribution 7. Larheim TA , Westesson P - L . TMJ imaging . In: of types and causes of fractures in 348 patients. B r J Laskin DM , Greene CS , Hylander WL . Temporo- Oral Maxillofac Surg 2000 ; 38 ( 5 ): 417 – 421 . mandibular Disorders: An Evidence- B ased 19. Marker P , Nielsen A , Bastian HL . Fractures of the Approach to Diagnosis and Treatment . Hanover mandibular condyle. Part 2: Results of treatment of Park, IL : Quintessence , 2006 : 149 – 180 . 348 patients . Br J Oral Maxillofac Surg 8. Schiffman E , Anderson G , Fricton J , Burton K , 2000 ; 38 ( 5 ): 422 – 426 . Schellhas K . Diagnostic criteria for intraarticular 20. Fricton J . Myogenous temporomandibular T.M. disorders . Community Dent Oral Epidemiol disorders: Diagnostic and management consider- 1989 ; 17 ( 5 ): 252 – 257 . ations . Dent Clin North Am 2007 Jan; 51 ( 1 ): 61 – 83 . 9. Okeson JP . Management of Temporomandibular 21. Sciotti VM , Mittak VL , DiMarco L , Ford LM , Disorders and Occlusion , 6th ed. St Louis : CV Plezbert J , Santipadri E , Wigglesworth J , Ball K . Mosby , 2008 :175, 387 – 388 , 410 , 431 , 455 – 459 . Clinical precision of myofascial trigger point 10. Cooper BC , Kleinberg I . Establishment of a location in the trapezius muscle . Pain temporomandibular physiological state with 2001 ; 93 ( 3 ): 259 – 266 . Chapter 6 Contributing Factors FAQ Q: Does smoking contribute to TMD? If so, do you try to motivate these patients to quit? A: I believe smoking contributes to TMD symptoms through oral movements and lessening the body ’ s ability to heal itself; a study has never been performed to evaluate the degree smoking contributes to TMD symptoms. I try to provide patients with the least costly (time, money, and effort) therapies that enable them to obtain satisfactory relief. It generally takes a large amount of effort for smokers to quit. I believe all smokers know smoking is harmful and they currently do not possess the desire or willpower to stop. I present patients other therapies that are much less costly and generally enable patients to obtain satisfactory relief. TMD contributing factors are the elements FOCAL POINT that directly or indirectly contribute to the Predisposing contributing factors are the TMD symptoms, impacting both muscle and elements that make an individual more suscep- TMJ pain. They can be subcategorized into tible to developing TMD, e.g., fi ngernail biting, predisposing, initiating, and perpetuating clenching, and biting on objects. An individual contributing factors. 1 – 4 The predisposing who is very predisposed to developing TMD may contributing factors are the elements that be the one who develops TMD from a slight make an individual more susceptible to occlusal change, e.g., from the placement of a developing TMD, e.g., fi ngernail biting, pit and fi ssure sealant. clenching, and biting on objects. The indi- vidual who is very predisposed to developing The initiating contributing factor is the TMD may be the one who develops TMD event that caused the TMD symptoms to from a slight occlusal change, e.g., from the occur, e.g., trauma to the jaw or the place- placement of a pit and fi ssure sealant. ment of a crown. A total of 230 sequential 83 84 P A R T I I N I T I A L E V A L U A T I O N Table 6.1. Events that patients related to TMD The perpetuating contributing factors are onset (n = 230). the elements that directly or indirectly aggra- 61% No reason vate the masticatory system and prevent the 17% Stress or stressful situation TMD symptoms from resolving. It is impor- 4% Orthodontic treatment tant to attempt to identify these factors and 4% Trauma determine the degree they are contributing to 3% Other dental procedures a patient ’ s symptoms. It is recommended to 3% Motor vehicle accident the patient that those easiest to change and 7% Other events that should provide the greatest impact on the symptoms be initially changed. TMD patients were asked what they perceived FOCAL POINT as the cause of their TMD symptoms, and it Perpetuating contributing factors are the ele- was found that most (61%) did not associate ments that directly or indirectly aggravate the the onset of their symptoms with any particu- masticatory system and prevent TMD symptoms lar occurrence. Seven percent related it to from resolving. dental treatment (orthodontic and other Attempt to change the perpetuating contribut- dental procedures) (see Table 6.1 ). ing factors that are the easiest to change and Some individuals who have developed that should provide the greatest impact on the TMD from dental treatment may have patient ’ s symptoms. received treatments for which the average individual would not have had any problem, The daily variation in symptoms will often but these individuals may have been very give an indication of when these factors are predisposed to developing TMD. With the occurring. For example, a situation in which a relatively high percentage of patients associat- patient awakes with the TMD symptoms that ing their TMD symptoms with dental treat- rapidly resolve would suggest the primary ment, it would be prudent for dentists to perpetuating contributing factors are occur- inquire about TMD symptoms and perform a ring at night. It is recommended that the cursory TMD evaluation prior to performing factors that should fi rst be considered for dental treatment, e.g., during the periodic changing are sleeping position (if the patient dental examination. A cursory TMD evalua- sleeps on his or her stomach) and nocturnal tion can be done by measuring the patient’ s parafunctional habits. opening and checking for tenderness in the temporalis and masseter muscles, TMJs, and lateral pterygoid areas, as described in “ T MD QUICK CONSULT Palpations ” in chapter 3 (Tables 3.1 and 3.2 ). Observing for Variation in Daily Symptoms QUICK CONSULT The daily variation in symptoms will often give Varying Patient Response an indication of when the perpetuating contribut- Some individuals who have developed TMD ing factors are occurring. from dental treatment may have received treatments for which the average individual Conversely, if the patient awakes symptom would not have had any problem, but these free with the symptoms occurring later in the individuals may have been very predisposed to day, this would suggest the primary perpetuat- developing TMD. ing contributing factors are transpiring during C H A P T E R 6 C O N T R I B U T I N G F A C T O R S 85 the day and are under the patient’ s conscious Biological contributing factors are the control. This is generally due to excessive elements that mechanically or biologically muscle activity in the form of holding exces- contribute to TMD. They can include neck sive muscle tension in the masticatory pain, poor posture, malocclusion, insomnia, muscles and/or excessive parafunctional and systemic diseases (e.g., fi bromyalgia or habits.5 rheumatoid arthritis).1 Behavioral contributing At the initial evaluation, patients are rarely factors are habits a patient frequently performs aware of excessive muscle tension or their that negatively impact TMD, e.g., holding daytime parafunctional habits and the fre- excessive tension in the masticatory muscles, quency with which they perform them. For clenching, fi ngernail biting, lip biting, example, some patients relate they lightly rest stomach sleeping, or telephone cradling. their teeth together throughout the day but Biological and behavioral contributing factors are unaware that they squeeze the teeth tend to infl uence the TMD symptoms together when they are busy, frustrated, or directly, whereas emotional, cognitive, and concentrating on other activities, e.g., using a social factors tend to convey their infl uence computer or driving. indirectly. 6 Clinically some residual effect of the TMD contributing factors appears to carry over to QUICK CONSULT the other portions of the day. Additionally Observing Contributing Factor daytime stress may contribute to the noctur- nal parafunctional activity; see Figures 1 .3 and Infl uence 1.4 . Biological and behavioral contributing factors Some TMD patients awake with symptoms tend to infl uence the TMD symptoms directly, and have symptoms throughout the day. whereas emotional, cognitive, and social factors This symptom pattern suggests these tend to convey their infl uence indirectly. patients have daytime and nocturnal contrib- uting factors. They may have daily severity Emotional contributing factors are pro- patterns suggesting either the daytime and longed negative emotions such as depression, nocturnal contributing factors are more worry, anxiety, and anger. Cognitive factors prominent, but generally both need to be are harmful thought processes or low cogni- addressed. The contributing factors are widely tive skills, e.g., negative self - statements, or diverse and unique to each patient. For ease poor reasoning skills making it diffi cult for of comprehending the broad continuum of the patient to work with the self- m anagement contributing factors, they can be thought or other instructions. Social contributing about in biological, behavioral, emotional, factors are related to interactions with others cognitive, social, and environmental that can contribute to patients ’ TMD symp- categories.6 toms or their poor response to therapy, e.g., coworker diffi culties, lack of social support, or secondary gain.1 ,6 QUICK CONSULT Environmental contributing factors can Observing Treatment Effect on have a direct effect (e.g., a food additive Daily Pattern directly causing a migraine headache) or an Clinically some residual effects of TMD contrib- indirect effect (e.g., seasonal affective disorder uting factors appear to carry over to the other causing depression and thereby contributing portions of the day. to TMD symptoms). These factors are usually 86 P A R T I I N I T I A L E V A L U A T I O N quite diffi cult to identify and therefore are Finally, the patient will need to break these infrequently explored among
TMD patients. 6 habits so the masticatory system can heal. The Generally TMD therapies are not directed patient may require assistance from someone toward physically or biochemically changing trained in teaching patients to relax and/or the TMD diagnosis (e.g., myofascial pain), break habits. but are directed at changing the contributing For example, a TMD patient who also had factors. With the reduction in the intensity moderately severe hip pain was being evalu- and frequency of the perpetuating contribut- ated as to whether the disorder was benign or ing factors, the body heals itself. This is malignant. Using the diary, the patient found similar to a patient who has mild generalized a direct association between her hip and periodontal disease. A practitioner would not TMD symptoms. Upon discussing this, the surgically intervene to change this condition, patient thought that, when her hip pain but would try to determine the factors that increased in severity, she tightened her have caused this disease to develop, e.g., not masticatory muscles in response to the pain properly brushing or fl ossing, smoking, or and started worrying about her hip disorder. poor nutrition. Once these factors have been She chose to use her hip pain as a cue to alert identifi ed, the practitioner would educate and herself consciously to keep her jaw muscles motivate the patient to make suffi cient relaxed. With this and other conservative behavioral changes to enable the body to therapies, she obtained satisfactory relief of reverse the disease. The practitioner would her TMD pain. follow the patient ’ s case to ensure adequate behavioral changes have been made to resolve QUICK CONSULT the disease. Challenging Segments of Therapy Identifying the TMD contributing factors, in FOCAL POINT addition to educating and motivating the patient With the reduction in the intensity and frequency to change them, is one of the most challenging of the perpetuating contributing factors, the body aspects of treating TMD patients. heals itself. Identifying the TMD contributing factors, TECHNICAL TIP in addition to educating and motivating the Identifying Contributing Factors patient to change the TMD contributing through a Diary factors, is one of the most challenging aspects When one is having diffi culty identifying the of treating TMD patients. Begin by using the contributing factors, a technique that can be daily symptom pattern as a guide. When one helpful is asking the patient to hourly track the is having diffi culty identifying the daytime pain and other events that are occurring in the contributing factors, a technique that has been patient ’ s life. helpful is asking the patient to hourly track the pain and other events that are occurring in the patient ’ s life. This has often helped A 64 - year - old lady who had recently patients to identify events associated with the developed daytime TMD symptoms several pain. The patient next needs to identify the days a week also found the diary helpful. At perpetuating contributing factors that are the initial appointment, when asked about occurring at that time, e.g., clenching, holding new stresses, irritations, frustrations, or tension in the masticatory muscles, etc. concerns in her life, she stated that she has a C H A P T E R 6 C O N T R I B U T I N G F A C T O R S 87 superb life, she doesn’ t work, all of her REFERENCES children have left home, and she and her husband have a wonderful relationship. After 1. Abdel - Fattah RA . Evaluating and Managing using the diary, she found her pain was Temporomandibular Injuries , 3rd ed. Boca Raton, related to thoughts regarding her 90 -y ear - old FL : Radiance Publishing Co , 2008 : 167 – 187 . father who lives alone (about an hour’ s drive 2. American Academy of Orofacial Pain. de Leeuw R from her home) and is becoming forgetful. (ed). Orofacial Pain: Guidelines for Assessment, Diagnosis and Management , 4th ed. Chicago : She related that, in the previous week, he left Quintessence , 2008 : 134 , 158 – 159 . his house for several hours with the fl ame 3. Atsu SS , Ayhan - Ardic F . Temporomandibular burning on his stove. She also periodically disorders seen in rheumatology practices: A review. receives telephone calls from her siblings Rheumatol Int 2006 ; 26 ( 9 ): 781 – 787 . reminding her that she lives the closest to 4. Fricton J . Myogenous temporomandibular disorders: him, it is her responsibility to watch over him Diagnostic and management considerations . Dent and, if anything went wrong, she would Clin North Am 2007 Jan; 51 ( 1 ): 61 – 83 . receive the blame. It was speculated that, 5. Glaros AG , Williams K , Lausten L . The role of when she had concerned thoughts about her parafunctions, emotions and stress in predicting facial father, she tended to tighten her masticatory pain . JADA 2005 ; 136 ( 4 ): 451 – 458 . muscles suffi ciently to manifest her TMD 6. Fricton JR , Chung SC . Contributing factors: A key symptoms. She worked with a psychologist to chronic pain . In: Fricton JR , Kroening RJ , Hathaway KM (eds). TMJ and Craniofacial Pain: who taught her coping strategies and how to Diagnosis and Management . St Louis : Ishiyaku deal better with her siblings, in addition to EuroAmerica , 1988 : 27 – 37 . my instructions on breaking her masticatory muscle- tightening habits, and her symptoms resolved after a few weeks. Part II Common Acute T MD Conditions and Treatments Most new TMD patients report having chronic rather than acute TMD symptoms; they have had the pain at least several months, and the pain intensity generally fl uctuates over time. When considering medications for a patient with chronic symptoms, generally assume they will be used long term. Therefore, avoid prescribing muscle relaxants and primarily use tricyclic antidepressants and sometimes use NSAIDs on an as- n eeded basis. It is believed that the best treatment for patients with chronic TMD symptoms is for them to change their parafunctional habits in addition to other perpetuating contributing factors, e.g., not coping well with life ’ s stresses, anxiety, and depression. Clinical experience has demonstrated there is a tendency for patients with chronic symptoms who are prescribed muscle relaxants to rely on these medications for pain relief rather than attempting to change their contributing factors. An acute TMD condition can be the recent onset of TMD symptoms or an acute fl are - up of a chronic condition. For these patients, I am much more likely to prescribe short - term use of a muscle relaxant and/or anti - infl ammatory medications. A few patients, who occasionally (every 1 or 2 years) develop mild TMD symptoms related to temporary stressful events, prefer to use only TMD self - management therapy and medication. It is recommended that these cases be followed to ensure the symptoms adequately resolve and the patients do not need additional TMD therapy. FOCAL POINT An acute TMD condition can be the recent onset of TMD symptoms or an acute fl are - up of a chronic condition. 89 Chapter 7 TMD Secondary to Trauma FAQ Q: What would you do if a patient who developed TMD from trauma was provided your initial recommended therapy and returned requesting stronger medications? A: If the patient returns requesting stronger medications after having been provided the initial recommended therapy, there is probably some other pathology involved, e.g., pulpalgia from an incomplete tooth fracture. TMD can occur from trauma to the Microtrauma generally refl ects unconscious masticatory system whose intensity or habits, which may predispose an individual to duration exceeds the adaptive capacity of this develop TMD from direct or indirect trauma system. It can occur in three forms: (1) direct and make it more diffi cult to resolve the trauma (macrotrauma), e.g., blow to jaw; (2) manifested symptoms. This chapter focuses on indirect trauma (nonimpact jolt to the jaw), direct and indirect trauma, and uses the term e.g., occurring in conjunction with cervical “ trauma ” to encompass both forms. whiplash; and (3) microtrauma, e.g., chronic parafunctional habits.1 QUICK CONSULT Understanding Trauma QUICK CONSULT This chapter focuses on direct and indirect Understanding Trauma trauma, and uses the term “ trauma ” to Trauma to the masticatory system can occur in encompass both forms. three forms: (1) direct trauma (macrotrauma), (2) indirect trauma (nonimpact jolt to the jaw), Trauma can cause muscle pain, TMJ pain and (3) microtrauma. and infl ammation, and intracapsular changes. It can stretch ligaments supporting the TMJ ’ s Direct and indirect trauma have identifi able smooth mechanical movements, causing or events a patient normally reports as the predisposing an individual to develop one of initiating cause of the TMD symptoms. the disc displacements or a dislocation. It can 91 92 P A R T I I C O M M O N A C U T E T M D C O N D I T I O N S A N D T R E A T M E N T S create irregularities in the smooth condyle, greater expertise in this area. A method for fossa, or disc surfaces, thereby causing identifying these practitioners is provided in roughness or catching during TMJ “ Practitioners with TMD Expertise and movements. Additionally, trauma can Fellowship Programs ” in appendix 13. precipitate bleeding within the TMJ, leading Even though a patient has only an acute to adhesion formation. 2 – 4 problem, the TMD examination should be performed as recommended in chapter 3 , FOCAL POINT “ Clinical Examination. ” Cervical pain is even Trauma can cause muscle pain, TMJ pain and more prevalent among patients whose TMD infl ammation, and intracapsular changes. is secondary to trauma from a motor vehicle accident.2 ,5,6 It is recommended a panoramic The “ Initial Patient Questionnaire ” asks radiograph be taken to rule out a fracture when the problem began and whether the causing or contributing to the pain. If the patient has suffered whiplash or trauma to the patient was not appropriately evaluated for a head or neck. These responses will alert the fracture following the trauma and the practitioner as to whether the patient has practitioner suspects the patient may have a acute TMD symptoms secondary to trauma. fracture in a bone that would not be revealed These patients may have complaints of muscle by the panoramic radiograph, then pain, TMJ pain, other pains, new TMJ noises, appropriate radiographs are indicated. and/or disruption of smooth TMJ movements. These symptoms may not QUICK CONSULT manifest until weeks to months after the Evaluating Patients with History of traumatic event. 3 a Motor Vehicle Accident Among patients whose TMD is secondary to QUICK CONSULT trauma from a motor vehicle accident, cervical Observing for Trauma History pain is more likely to be present. The “ Initial Patient Questionnaire” responses will alert the practitioner as to whether the patient TECHNICAL TIP has acute TMD symptoms secondary to trauma. Contributing Factor of Trauma When trauma is the initiating contributing factor Many factors can cause or contribute to or has greatly exacerbated chronic symptoms, it these complaints and need to be considered is recommended a panoramic radiograph be when trauma is the initiating contributing taken to rule out a fracture causing or factor or has greatly exacerbated chronic contributing to the patient ’ s pain. symptoms. The more common possibilities include bone fracture, referred odontogenic Depression, anger, and hostility are pain secondary to tooth trauma, comorbid signifi cantly more common with these cervical disorder, and psychosocial issues patients.6 Sometimes patients angrily complain related to the trauma or treatment for the about the injustice of their situation, whereas trauma. The literature reports many other less others may disclaim these feelings but also common disorders that have been related to internally stew with these thoughts. Some traumatic events. If the patient has signs and/ practitioners routinely refer all patients with or symptoms suggestive of disorders beyond signifi cant trauma to a psychologist to the practitioner ’ s ability, the practitioner evaluate for such perpetuating contributing should refer the patient to someone with factors. C H A P T E R 7
T M D S E C O N D A R Y T O T R A U M A 93 QUICK CONSULT instructions verbally to using cold over the Observing for Psychosocial affected area for the fi rst 48 hours after injury Contributors and then applying heat as needed. Depression, anger, and hostility are signifi cantly more common with patients whose TMD TECHNICAL TIP symptoms were initiated by trauma. Determining Initial Therapy Initial therapy for many of these patients may Signifi cant trauma may cause patients to encompass discussing TMD self - management have neuropsychological and cognitive instructions and prescribing a muscle relaxant, functioning defi cits that may comprise anti - infl ammatory, and/or analgesic medication. memory and concentration impairment, rapid mental fatigue, weakness, sleep disturbances, As a general pharmaceutical guide, I tend anxiety, etc.5 – 9 Patients with such defi cits to prescribe the following for patients with should be evaluated and treated with a constant pain at these intensities. This will multidisciplinary approach by medical vary with the patient ’ s fl uctuating pain personnel trained in this area. In conjunction intensity pattern, the patient’ s palpation with these therapies, traditional TMD therapy tenderness, and the emotional impact these can be provided for the masticatory system. are causing. If the patient has a low level of The trauma ’ s severity and the patient ’ s pain (3/10 or below), I would tend to TMD perpetuating contributing factors are prescribe the patient 800 mg ibuprofen, t.i.d. major determinants for how readily the TMD If the pain is greater and primarily of muscle symptoms will resolve. The patient may origin, I would tend to prescribe 5 m g require anything from no or minimal diazepam, 1– 2 tablets h.s. If the patient has treatment to very extensive multidisciplinary signifi cant daytime muscle pain, I would therapies; even with extensive therapy, some consider discussing the possibility of the patients with trauma - induced TMD do not patient taking one- h alf tablet in the morning improve. 10,11 and afternoon; the potential side effects and ramifi cations must be discussed. If the pain is FOCAL POINT above 3/10 and primarily of TMJ origin, I The trauma’ s severity and the patient’ s TMD consider prescribing 500 m g naproxen, b.i.d. perpetuating contributing factors are major If the pain is above 6 – 7/10 and primarily of determinants for how readily the TMD symptoms TMJ origin, I consider prescribing the Medrol will resolve. Dosepak - naproxen regimen discussed in “ Anti - infl ammatory Medications ” in chapter Initial therapy for many of these patients 17 . In healthy adults, the anti - infl ammatory may encompass discussing TMD self- and the muscle relaxant can be taken together; management instructions and prescribing a if additional analgesic relief is needed, muscle relaxant, anti - infl ammatory, and/or acetaminophen can be added. analgesic medication. The “ TMD Self - After providing this therapy, if the patient Management Therapies ” handout (appendix returns requesting stronger medications, some 4 ) recommends that patients limit use of the other pathology is probably involved, e.g., masticatory system by eating a soft diet, pulpalgia from an incomplete tooth fracture. eliminating oral habits, etc. It also Based on the patient ’ s history and recommends the use of heat and cold, but the practitioner ’ s experience, the practitioner may practitioner may desire to alter these elect to provide additional temporary TMD 94 P A R T I I C O M M O N A C U T E T M D C O N D I T I O N S A N D T R E A T M E N T S therapies (e.g., temporary soft appliance) or 6. Goldberg MB . Posttraumatic temporomandibular initiate long- t erm therapy (e.g., making disorders . J Orofac Pain 1999 ; 13 ( 4 ): 291 – 294 . impressions for an acrylic appliance). 7. Krogstad BS , Jokstad A , Dahl BL , Soboleva U . Comparative studies reveal considerable Somatic complaints, psychologic distress, and variability as to whether patients with treatment outcome in two groups of TMD patients, one previously subjected to whiplash injury . J posttraumatic TMD respond differently to Orofac Pain 1998 ; 12 ( 2 ): 136 – 144 . TMD therapies than do patients whose TMD 8. Grossi M , Goldberg MB , Locker D , Tenenbaum developed independently of trauma. 5,9,11 – 13 HC . Reduced neuropsychologic measures as predictors of treatment outcome in patients with REFERENCES temporomandibular disorders. J Orofac Pain 2001 ; 15 ( 4 ): 329 – 339 . 1. American Academy of Orofacial Pain . de Leeuw R 9. Romanelli GG , Mock D , Tenenbaum HC . (ed). O rofacial Pain: Guidelines for Assessment, Characteristics and response to treatment of Diagnosis and Management , 4th ed. Chicago : posttraumatic temporomandibular disorder: A Quintessence , 2008 : 134 – 135 . retrospective study . Clin J Pain 1992 ; 8 ( 1 ): 6 – 17 . 2. Kolbinson DA , Epstein JB , Senthilselvan A , Burgess 10. Carroll LJ , Ferrari R , Cassidy JD . Reduced or JA . A comparison of TMD patients with or without painful jaw movement after collision- r elated prior motor vehicle accident involvement: Initial injuries: A population - based study . JADA signs, symptoms, and diagnostic characteristics . J 2007 ; 138 ( 1 ): 86 – 93 . Orofac Pain 1997 ; 11 ( 3 ): 206 – 214 . 11. Kolbinson DA , Epstein JB , Senthilselvan A , Burgess 3. Burgess JA , Kolbinson DA , Lee PT , Epstein JB . JA . A comparison of TMD patients with or without Motor vehicle accidents and TMDs . JADA prior motor vehicle accident involvement. J Orofac 1996 ; 127 ( 12 ): 1767 – 1772 . Pain 1997 ; 11 ( 4 ): 337 – 345 . 4. Okeson JP . Bell ’ s Orofacial Pains: The Clinical 12. De Boever JA , Keersmaekers K . Trauma in patients Management of Orofacial Pain , 6th ed. Carol with temporomandibular disorders: Frequency and Stream, IL : Quintessence , 2005 : 343 – 344 . treatment outcome . J Oral Rehabil 5. Grushka M , Ching VW , Epstein JB , Gorsky M . 1996 ; 23 ( 2 ): 91 – 96 . Radiographic and clinical features of 13. Steed PA , Wexler GB . Temporomandibular temporomandibular dysfunction in patients disorders: Traumatic etiology vs. nontraumatic following indirect trauma: A retrospective study. etiology — a clinical and methodological inquiry into Oral Surg Oral Med Oral Pathol Oral Radiol symptomatology and treatment outcomes. C ranio Endod 2007 ; 104 ( 6 ): 772 – 780 . 2001 ; 19 ( 3 ): 188 – 194 . Chapter 8 TMD Secondary to Dental Treatment FAQ s Q: If a dental patient develops TMD after a dental procedure, was the dental treatment the cause of the symptoms? A: A patient ’ s propensity for developing TMD may play a major role for one individ- ual manifesting TMD after dental treatment, whereas a dentist using excessive and/or prolonged forces on the mandible may play a major role for another individual mani- festing TMD after dental treatment. Q: If a patient returns to my offi ce with a medial pterygoid myospasm and the patient is provided the therapy you recommend, how long will it take the disorder to resolve? A: Depending on its severity, this disorder generally takes 5 – 10 days to resolve. Q: Do most patients prefer to take their TMD medication prior to their dental appointments or after their appointments? A: Some patients may desire premedication, others prefer postoperative medication, and some may need both. When 230 sequential TMD patients were QUICK CONSULT asked what they perceived as the cause for Observing the Onset of T MD their symptoms, most (61%) did not associate Symptoms the onset of their symptoms with any Most patients with TMD do not associate the particular event, whereas 4% related it to onset of their symptoms with any particular orthodontic treatment and 3% related it to event. other dental procedures (see Table 6.1 ). 95 96 P A R T I I C O M M O N A C U T E T M D C O N D I T I O N S A N D T R E A T M E N T S For many TMD patients, their pain possible for a dentist to place such excessive appears to develop slowly and worsen in a and/or prolonged forces on the jaw that fl uctuating pattern until a severity is reached someone who is not predisposed to developing for which they desire to obtain relief. For TMD would develop the disorder. other individuals, TMD symptoms may Understandably it would be prudent for fl uctuate over time, but never develop the dentists to inquire about TMD symptoms and severity for which therapy is desired. The perform a cursory TMD evaluation prior to propensity for any one individual to develop performing dental treatment, e.g., during the TMD from dental treatment may vary with periodic dental examination. A cursory TMD the degree of low- l evel or subclinical evaluation can be done by measuring the symptoms. patient ’ s opening, identifying the presence or history of TMJ noise, and checking for FOCAL POINT tenderness in the anterior region of the The propensity for any one individual to develop temporalis and masseter muscles, TMJs, and TMD from dental treatment may vary with the lateral pterygoid areas (Table 8.1 ). degree of low- level or subclinical symptoms. A dentist can also provide dental therapy QUICK CONSULT appropriately for an individual who is in the Protecting Yourself midst of developing TMD, but may not even It is recommended dentists inquire about TMD be aware of it because of such minor symptoms prior to dental treatment, measure the symptoms. Because of the patient’ s propensity patient ’ s opening, and check for tenderness in for developing TMD, the dental treatment the anterior region of the temporalis and may cause this individual to manifest TMD masseter muscles, TMJs, and lateral pterygoid from the dental treatment. Conversely it is areas. Table 8.1. Cursory TMD evaluation palpations for dental patients. Anterior region of the Bilaterally palpate approximately 1 1/2 inches behind the eye canthus and a half temporalis muscle inch above the zygomatic arch (Figure 3 .6 ). TMJ T hree areas of the TMJ need to be palpated bilaterally, and any one of these can be tender without tenderness of the others. A common mistake is not having the patient open suffi ciently to adequately palpate the TMJ. (1) Ask the patient to open approximately 20 mm and palpate the condyle’ s lateral pole. (2) Ask the patient to open as wide as possible and palpate the depth of the depression behind the condyle with the fi ngertip. (3) With the fi nger in the depression, pull forward to load the posterior aspect of the condyle (Figure 3 .7 ). Masseter muscle Bilaterally palpate the center of the masseter muscle (Figure 3 .8) . If unsure of the muscle ’ s extent, ask the patient to clench, and its extent can easily be felt. Lateral pterygoid area Slide the fi fth digit along the lateral side of the maxillary alveolar ridge to the most posterior region of the vestibule (the location for the posterior superior alveolar injection). Palpate by pressing in a superior, medial, and posterior direction (Figure 3.23) . If tenderness is observed, referred pain may be generated by applying heavier sustained pressure. C H A P T E R 8 T M D S E C O N D A R Y T O D E N T A L T R E A T M E N T 97 Many elements of dental treatment in PREVENTING AGGRAVATION FROM DENTAL addition to excessive and/or prolonged TREATMENT opening can initiate TMD symptoms or aggravate a chronic TMD condition. For Prolonged or extensive opening of the mouth example, a medial pterygoid myospasm in addition to forces applied to the mandible may occur from piercing the medial may aggravate the masticatory muscles and pterygoid muscle during an
inferior alveolar TMJs. Some individuals relate they have injection, a myositis may occur from TMD symptoms only after aggravating events extracting an infected tooth, and generalized such as dental treatment and some TMD muscle and/or TMJ pain may occur from patients who have not completely eliminated placing a restoration with an inharmonious their TMD symptoms relate they suffer occlusion. symptom fl are - ups from dental treatment. If a patient returns to the practitioner ’ s Many techniques are available to decrease the offi ce and complains of TMD pain after a aggravation that patients may experience from dental procedure, the pain may also be dental treatment. postoperative tooth (or other dental Some patients relate their masticatory structure) pain referring to the masticatory muscles and TMJs become sore or stiff muscles and/or TMJ. An example of during dental treatment and would referred pain that dentists frequently observe appreciate the opportunity to take a break is among patients with a mandibular periodically to move their jaw. The third - molar osteitis, for which TMJ and/or practitioner may wish to inform patients they ear pain is a common complaint. Referred are “ allowed ” to take stretching breaks and pain to the masticatory muscles or TMJ devise a form of communication so patients may be observed from any tooth or deep can notify the practitioner when they would structure that is causing postoperative dental like a break. pain. A number of patients fi nd they have less TMD symptoms secondary to dental TMD discomfort after using a bite block, treatment can be limited to one muscle, the whereas others relate its use aggravates their TMJ, or be present in a generalized fashion. symptoms. If a bite block is used, the The following section of this chapter provides practitioner should place it so the patient is suggestions that can be used to prevent open no further than will be needed for most aggravation of preexisting TMD symptoms or of the intended procedure. The practitioner for patients who appear prone to developing can periodically ask the patient to open wider TMD symptoms following dental treatment. and, as the patient requests, periodically The next two sections discuss pain that may remove it for stretching breaks. Once the bite occur in the medial pterygoid muscle and block is placed, the patient should be disorders that can cause a patient to be unable informed that this is all the wider the to close into maximum intercuspation after practitioner needs him or her to open (at this dental treatment. The last two sections then time), that the patient should rest the teeth discuss TMD sequelae generated from only lightly on the block (not bite it), and placing occlusally inharmonious restorations that the patient should indicate whenever a (usually presents as generalized pain) and break is desired. Patients who previously TMD symptoms secondary to obstructive found that the use of the bite block sleep apnea appliances and treatment aggravated their symptoms may want to try it suggestions. again using these recommendations. 98 P A R T I I C O M M O N A C U T E T M D C O N D I T I O N S A N D T R E A T M E N T S Make a patient ’ s appointments for when are more prone to developing TMD, and the patient has minimal symptoms. If the forces that do not bother most patients may patient has a daily symptom pattern, make the cause TMD symptoms among patients more appointment for the portion of the day when predisposed to the disorder. The occlusion of the symptoms will be minimal. If the patient all new restorations must be adjusted so they can predict future stressful or relaxing times, are in harmony with the rest of the dentition these usually affect the TMD symptoms, so or the patient may develop TMD symptoms. appointments can be scheduled when the The fear of symptom aggravation may symptoms will be minimal. Some patients cause TMD patients to be reluctant to seek prefer short appointments, whereas others routine dental care and perform routine oral may prefer longer appointments that enable hygiene.1 Empathy for their disorder and them to suffer through the postoperative encouragement to obtain routine dental care discomfort fewer times. If several procedures and perform routine oral hygiene are usually are to be performed at one appointment, do quite benefi cial for these patients. the more diffi cult one fi rst, because the Some TMD patients need restorations prior patient should have greater stamina early in to long - term occlusal appliance fabrication. the appointment. This situation can be handled with one or more of the following techniques: TECHNICAL TIP Making Appointments 1. Provide a temporary appliance (e.g., soft Make a patient’ s appointments for when the appliance) until the teeth are restored. patient has minimal symptoms. 2. Restore the teeth on the arch that needs the least treatment, fabricate an appliance Some patients may desire premedication, for this arch, and adjust the appliance’ s others prefer postoperative medication, and occlusal surface as the opposing some may need both. Many patients who restorations are placed. develop mild to moderate TMD pain from 3. Pharmaceutically manage (Chapter 17 , dental procedures receive adequate relief from “ Pharmacological Management ” ) the TMD 800 mg ibuprofen, t.i.d. Depending on the symptoms until a temporary or long - term severity of their symptoms, they may desire to occlusal appliance can be provided. start 1 or 2 days before the procedure and take it afterward for as long as needed. If ibuprofen does not provide adequate relief, MEDIAL PTERYGOID MUSCLE PAIN I tend to prescribe patients who have TMJ infl ammation 500 mg naproxen, 1 tablet b.i.d. The most common disorder observed for the If the pain is primarily of muscle origin, I medial pterygoid muscle is a medial tend to prescribe 5 mg diazepam and dose as pterygoid myospasm induced by trauma needed; if the patient is to take it during the from the needle piercing the medial pterygoid day, the potential side effects and muscle during an inferior alveolar injection. 2,3 ramifi cations must be discussed. The myospasm may involve the entire muscle With all patients, be cautious not to overly or be limited to the traumatized portion of strain the masticatory system. Whenever force the muscle. 4 The majority of patients treated is applied to the mandible, a balancing force for this disorder previously received multiple should be applied with the nondominant inferior alveolar injections, but some only had hand to support the mandible. Some patients a single injection. C H A P T E R 8 T M D S E C O N D A R Y T O D E N T A L T R E A T M E N T 99 A patient who develops this disorder Depending on its severity, this disorder typically returns to the practitioner’ s offi ce 1 generally takes 5– 1 0 days to resolve. On one or 2 days after a dental procedure that occasion, a patient who had only minimal required an inferior alveolar injection. The improvement with her limited opening was patient complains of signifi cant pain in the asked to implement a more aggressive medial pterygoid muscle region and limited stretching technique. This entailed her using opening. Palpation of the masticatory muscles wooden tongue depressors to stretch the and TMJs typically reveals no or minimal medial pterygoid muscle more actively (up to tenderness, until the medial pterygoid muscle tolerance), ten or more times a day, and hold is palpated. The patient ’ s limited opening the stretch for 1 minute. She inserted as many often makes it diffi cult to palpate the medial wooden tongue depressors as would fi t pterygoid muscle, but, once this is palpated, between her maxillary and mandibular the patient ’ s eyes usually “ light up ” and there incisors, and held them together with a rubber is no doubt that this is the source of the pain. band. She next inserted an additional tongue For these patients, I generally prescribe depressor at the far end and slowly slid it 800 mg ibuprofen, t.i.d., and 5 mg diazepam, between the others, providing additional 1 to 2 tablets h.s. If the pain is severe, it is stretch to her medial pterygoid muscle, as recommended the patient also take demonstrated in Figure 8 .1. She continued to acetaminophen, and consider discussing the insert tongue depressors up to tolerance and possibility of the patient taking a half tablet of eventually regained her normal opening. 5 mg diazepam in the morning and afternoon. Tongue depressors could similarly be held If diazepam is prescribed for daytime use, the together by placing them inside a fi nger cot or potential side effects and ramifi cations must the fi nger of a glove. A case scenario of a be discussed with the patient. patient with a medial pterygoid myospasm is presented in “ Case 7 ” in part V . Clinically a medial pterygoid myositis TECHNICAL TIP Prescribing Medication for a presents in a similar manner as a myospasm. The myositis can be due to a bacterial Medial Pterygoid Myospasm infection of the muscle, which can occur from For patients with a medial pterygoid myospasm, I generally prescribe 800 mg ibuprofen, t.i.d., and 5 mg diazepam, 1 to 2 tablets h.s. Additionally the “ TMD Self - Management Therapies ” handout (appendix 4 ) is reviewed, and the patient is requested to stretch the medial pterygoid muscle (up to tolerance) ten or more times a day with the index and middle fi ngers and hold the stretch for 30 – 60 seconds, as demonstrated in Figure 5 .1. Anatomically it appears that heat applied to the lateral surface of the mandible would not Figure 8.1. Forceful stretching procedure that penetrate to the medial pterygoid muscle, but may be desired for a resistant medial pterygoid these patients report they have a benefi cial myospasm, myofi brotic contracture, or fi brous effect from its use. ankylosis. 100 P A R T I I C O M M O N A C U T E T M D C O N D I T I O N S A N D T R E A T M E N T S the presence of an abscessed tooth or problem and can make it nearly impossible extracting an infected tooth. 5 A practitioner for the practitioner to adjust the occlusion of might have to attempt to differentiate whether a new restoration. a patient has a medial pterygoid myospasm or Holding the mouth open wide for an myositis, if the patient had an inferior alveolar extended period tends to fatigue a susceptible injection to extract an infected tooth and inferior lateral pterygoid muscle and infl ame a returned complaining of signifi cant medial susceptible TMJ. If a patient is predisposed to pterygoid muscle pain limiting opening. If the developing either of these problems, the patient has a fever or lymphadenopathy, this susceptible structure may be the source for the would suggest an infection is present, and patient ’ s inability to close into MI. Palpating antibiotics are indicated. the TMJs and lateral pterygoid areas (Table 8.1 ) should enable the practitioner to QUICK CONSULT determine the source; this problem may be Observing a Medial Pterygoid unilateral or bilateral. The top left section of the “ TMJ Disc Displacements ” diagram Myositis (appendix 3 ) may help practitioners explain Clinically patients with a medial pterygoid the cause and symptoms to patients. myositis present similarly to those with a medial pterygoid myospasm. QUICK CONSULT Observing Susceptible Muscles The importance of following the cases of and TMJ s TMD patients and their symptoms cannot be Having a dental patient hold his or her mouth overemphasized. An oral surgeon once referred open wide for an extended period tends to me a patient who had TMD symptoms fatigue a susceptible inferior lateral pterygoid (generalized unilateral pain and palpation muscle and infl ame a susceptible TMJ. tenderness) after a tooth extraction. Based on the patient interview and clinical examination, TECHNICAL TIP the patient ’ s symptoms were diagnosed as TMD. Two or three weeks later, she returned Explaining Cause and Symptoms
complaining that her airway was starting to to Patients become restricted. At my request, the patient The top left section of the “ TMJ Disc returned that day to the oral surgeon, and a Displacements ” diagram (appendix 3 ) may help computed tomogram was made and suggested practitioners explain the cause and symptoms to the symptoms were caused by a space patients. infection. Once her infection was treated, her TMD symptoms resolved. If only the lateral pterygoid muscles are tender, they are probably fatigued (almost certainly due to the aggravation of preexisting INABILITY TO CLOSE INTO MAXIMUM myofascial pain) and unable to stretch to their INTERCUSPATION normal relaxed length. Therefore, they hold the condyles in a slightly translated position, Occasionally at the end of a dental procedure, and the fi rst occlusal contact is often on the some patients have diffi culty putting their anterior teeth. In this situation, the TMJs are teeth into maximum intercuspation (MI). not tender to palpation, and the practitioner This can be a momentary or prolonged may be able to stretch the lateral pterygoid C H A P T E R 8 T M D S E C O N D A R Y T O D E N T A L T R E A T M E N T 101 muscles, enabling the patient to close into MI. appointment. Some patients may report they Stretching of the lateral pterygoid muscles is have TMD symptoms also at other times that demonstrated in chapter 9 , “ Lateral Pterygoid are signifi cant enough for them to desire Myospasm. ” If pain occurs in the TMJ while TMD therapy. performing this stretch, there is probably As a general premedication guide, I tend some TMJ infl ammation, and continued to prescribe patients who have TMJ stretching to this length will probably infl ammation an anti - infl ammatory (e.g., aggravate the infl ammation. 500 mg naproxen) and those who have muscle fatigue (probably aggravation of preexisting TECHNICAL TIP myofascial pain) a muscle relaxant (e.g., 5 mg Stretching the Lateral Pterygoid diazepam). The dosing varies with the severity Muscle of the symptoms; i.e., if symptoms are mild, If only the lateral pterygoid muscles are tender, ask the patient to take the medication 1 hour stretching them often enables patients to close prior to the appointment, but, if symptoms into MI. are severe, ask the patient to start the night before the appointment, 1 hour prior to the If only the TMJs are tender to palpation, appointment, and an appropriate time after the diagnosis is TMJ infl ammation, and an the appointment. If the patient is to take a anti - infl ammatory medication should help muscle relaxant during the day, the potential prevent or resolve this problem; see “A nti - side effects and ramifi cations must be infl ammatory Medications ” in chapter 17 . If discussed. both the lateral pterygoid areas and TMJs are tender to palpation, then both problems are QUICK CONSULT probably present. If the TMJs are considerably Prescribing Anti- infl ammatory and more tender than the lateral pterygoid areas, Muscle Relaxant Medications the lateral pterygoid muscles may be sore from I tend to prescribe patients who have TMJ holding the condyles forward to protect the infl ammation an anti - infl ammatory (e.g., 500 mg infl amed TMJs (protective muscle splinting) naproxen) and those who have muscle fatigue a and, once the TMJ infl ammation is treated, muscle relaxant (e.g., 5 mg diazepam). the muscle splinting usually resolves. If a patient requests medication for the TECHNICAL TIP discomfort from the dental procedure, the Reducing TMJ Infl ammation practitioner may desire to consider the patient If only the TMJs are tender to palpation, an taking the medication for a few days anti - infl ammatory medication should help postoperatively. In healthy adults, the anti - prevent or resolve this problem. infl ammatory and muscle relaxants may be taken together; if additional analgesic relief is Patients who report that this problem needed, acetaminophen can be added. commonly occurs every time they receive The inability to close into MI is not dental treatment would probably benefi t from exclusively associated with dental treatment, using applicable suggestions in the section on but may be a chronic fl uctuating problem for “ Preventing Aggravation from Dental some individuals, with the source being the Treatment. ” If this does not provide adequate TMJ and/or the lateral pterygoid muscle. In improvement, the practitioner may desire the fact, some dentists have informed me that patient to take medication prior to the they themselves experience having this 102 P A R T I I C O M M O N A C U T E T M D C O N D I T I O N S A N D T R E A T M E N T S problem after providing certain diffi cult dental harmony with the rest of the dentition may procedures, after stressful events, or after a cause patients to develop TMD symptoms.6 – 8 stressful day. These may develop relatively rapidly, occur on the ipsilateral and/or contralateral side of the QUICK CONSULT restoration, and consist of masticatory muscle Observing Chronic Inability to pain, TMJ pain, and/or TMJ clicking. The Close into Maximum inharmonious change may be as minor as a Intercuspation pit and fi ssure sealant. The inability to close into MI is not exclusively associated with dental treatment, but may be a QUICK CONSULT chronic fl uctuating problem for some individuals, Placing an Inharmonious with the source being the TMJ and/or the lateral Restoration pterygoid muscle. Placing a restoration inharmonious with the rest A lateral pterygoid muscle that is overused of the occlusion may cause TMD symptoms, and remains fatigued might develop a which develop relatively rapidly, occur on the myospasm.5 The myospasm can occur ipsilateral and/or contralateral side of the independently of dental treatment and may restoration, and consist of masticatory muscle cause a prolonged inability for the patient to pain, TMJ pain, and/or TMJ clicking. close into MI. The diagnosis and treatment for this are discussed in chapter 9 , “ Lateral When a patient returns to the practitioner ’ s Pterygoid Myospasm. ” offi ce and complains of TMD symptoms that Some patients may be able to close into MI the practitioner believes are due to the recent immediately after the dental procedure, but placement of an occlusally inharmonious develop this inability hours to days later. One restoration, clinical experience has shown the patient was referred to me with this symptom restoration should be adjusted until the pattern in addition to constant severe pain and patient relates it feels comfortable. The tenderness in the lateral pterygoid area. The interference may be located in MI or any practitioner had unknowingly placed a large other position. restoration over a maxillary premolar with an If the complaint is with a posterior tooth, acute pulpalgia. The patient also had premolar fi rst check whether the MI contacts on the pain to a lesser degree and a ligamentary new restoration are too heavy. Once it is injection along the premolar provided observed the MI contacts are evenly temporary relief of the lateral pterygoid pain. distributed on the dentition, then check It is believed the pulp ’ s deep pain input caused whether the tooth strikes in the eccentric a myospasm of the lateral pterygoid muscle.5 positions. It is recommended the tooth’ s other Once the practitioner endodontically cleaned contacts be marked with a thin red the premolar ’ s canal, the constant pain and articulating fi lm in the following manner: inability to close into MI resolved. manipulate the patient’ s mandible into centric relation and ask the patient to squeeze so his or her teeth slide into MI, help the patient to OCCLUSAL INTERFERENCE SEQUELAE return to centric relation and ask the patient to rub side to side on that tooth, ask the Many studies have demonstrated that placing patient to bite down (into MI) and rub side a restoration with an occlusion that is not in to side, and fi nally ask the patient to slide the C H A P T E R 8 T M D S E C O N D A R Y T O D E N T A L T R E A T M E N T 103 mandible forward. Next use thin black Once the tooth feels comfortable to the articulating fi lm and ask the patient to tap in patient, the TMD symptoms generally resolve MI. Clinical experience has shown that highly rapidly. There is not a direct relationship polished crowns refl ect the red oral mucosa, between a newly placed interference and the making it diffi cult to observe the red marks development of TMD symptoms. In studies, on the crown, so a different color may be some patients did not develop TMD needed in this situation. I fi nd occlusal symptoms from the placement of an indicator wax to be an excellent adjunct for interference, some in the control group (who identifying occlusal discrepancies, and it unknowingly only had the placement of an eliminates the refl ection problem with interference simulated) developed TMD polished crowns. symptoms, and a few patients took up to 6 Reduce the new restoration wherever the weeks to obtain symptom resolution after the red marks are located. The tooth should be interference was removed.6 ,10 adjusted so it feels comfortable to the patient. Occasionally a restoration is adjusted as QUICK CONSULT described, but the patient relates that it still Adjusting an Inharmonious feels uncomfortable. Clinically it has been observed that nonrestored portions of the Restoration tooth may need to be adjusted in the same Once the tooth feels comfortable to the patient, manner prior to the patient relating that it the TMD symptoms generally resolve rapidly. feels comfortable. It is speculated this may occur because these teeth become tender to It is suspected that some of the control percussion,9 and prior nonideal contacts may patients who developed TMD and the no longer be perceived as comfortable. patients whose symptoms took an inordinate Clinically it has also been observed that amount of time to resolve had a high patients may believe a new restoration has an predisposition for developing TMD excursive contact when there is none. The symptoms. The likelihood of a patient’ s TMD excursive contact is found on an adjacent symptoms not resolving once the tooth feels tooth and when removed, the symptoms comfortable is low, but it is possible.9 resolve. It is speculated this may occur because A patient who does not respond well to the replaced restoration had an excursive refi ning the occlusion, and for whom referred contact, which felt natural to the patient. pain from the tooth has been ruled out, may With this contact gone, another tooth have had his or her masticatory system contacts in the excursive position and feels aggravated during the dental procedure (e.g., unnatural to the patient. from prolonged opening). Initial therapy for An anterior tooth may also need to be such patients may encompass discussing TMD adjusted in centric and excursive movements. self - management instructions and prescribing Observe whether the new restoration has muscle relaxants and/or anti - infl ammatory heavier contacts than the other anterior teeth medications. If medications are desired, as a and adjust so it feels comfortable to the general guide I tend to prescribe patients who patient. If it appears the adjustments may have TMJ infl ammation an anti - infl ammatory compromise the patient’ s esthetics, the (e.g., 500 mg naproxen, 1 tablet b.i.d.) and practitioner may need to discuss the those who have muscle pain a muscle relaxant possibility of providing minor adjustments of (e.g., 5 mg diazepam, 1 – 2 tablets h.s.). The the opposing teeth. patient ’ s case should be followed to ensure 104 P A R T I I C O M M O N A C U T E T M D C O N D I T I O N S A N D T R E A T M E N T S the symptoms resolve, and, if they do not, to move. Attempt to resolve mandibular traditional TMD therapies should be protruding limitations prior to fabricating an instituted. OSA appliance.1
5 Many techniques have been used to reduce the TMD symptoms associated with OSA QUICK CONSULT Failing to Relieve Symptoms appliances. Some practitioners use analgesics (e.g., ibuprofen) and ask patients to increase A patient who does not respond well to refi ning the appliance wear slowly up to tolerance, the occlusion, and for whom referred pain from whereas others ask patients to reduce the the tooth has been ruled out, may have had his appliance use and perform stretching or her masticatory system aggravated during the exercises. 13,16 dental procedure (e.g., from prolonged opening). After wearing the OSA appliance the entire night, some patients awake unable to OBSTRUCTIVE SLEEP APNEA APPLIANCES completely retrude their mandible and occlude into MI. Clinically it has been Obstructive sleep apnea (OSA) appliances observed that closing for a few seconds to have been shown to help patients manage minutes on a fl exible material (e.g., cotton snoring and OSA. TMD symptoms (muscle roll, leaf gauge) placed between their maxillary pain, TMJ pain, and/or TMJ noise) are and mandibular central incisors generally reported by up to 40% of patients using these retrudes their mandible and greatly improves appliances and are the most common reason or resolves their problem. Patients use this these patients discontinue using their technique whenever it is needed to keep their appliances.1 1 – 14 symptoms under control. TECHNICAL TIP FOCAL POINT TMD symptoms are reported by up to 40% of Patients Who Awake Unable to patients using obstructive sleep apnea Retrude Their Mandible and appliances and are the most common reason Occlude into M I patients discontinue using their appliances. Most patients obtain satisfactory relief by closing for a few seconds to minutes on a fl exible material (e.g., cotton roll, leaf gauge) Since this appliance holds the mandible placed between their maxillary and mandibular in a protruded (50 – 75% of maximum central incisors. protrusion) position the entire night, prior to fabricating an OSA appliance, it is If TMD symptoms are derived from recommended practitioners evaluate these holding the mandible forward, limiting the patients for TMD signs and symptoms, mandibular advancement to the amount that nocturnal parafunctional habits (e.g., satisfactorily relieves the snoring or obstructive suggested by tooth wear), and mandibular sleep apnea may reduce the likelihood of these protruding limitations. Warn patients with patients developing TMD symptoms. Based TMD signs and symptoms the OSA appliance on this hypothesis, it appears titratable may worsen them. Provide patients who mandibular advancement appliances would appear to have signifi cant nocturnal provide the most satisfactory results. parafunctional habits with two- p iece OSA Since OSA appliances tend to aggravate the appliances that allow the mandible freedom masticatory musculoskeletal system, it is C H A P T E R 8 T M D S E C O N D A R Y T O D E N T A L T R E A T M E N T 105 conceivable that additional TMD therapies 2. Madan GA , Madan SG , Madan AD . Failure of may reduce the propensity for patients inferior alveolar nerve block: Exploring the developing symptoms and benefi t patients alternatives . JADA 2002 ; 133 ( 7 ): 843 – 846 . who develop symptoms from wearing these 3. Blanton PL , Jeske AH . Avoiding complications in appliances. It is speculated that the TMD local anesthesia induction: Anatomical considerations . JADA 2003 ; 134 ( 7 ): 888 – 893 . therapies shown to be more benefi cial for 4. Mense S , Simons DG , Russell IJ . Muscle Pain: morning pain (e.g., employing a relaxation Understanding Its Nature, Diagnosis, and exercise just prior to sleep) would have greater Treatment . Philadelphia : Lippincott Williams & benefi t for these patients.1 7 Additional TMD Wilkins , 2001 : 117 , 120 , 122 . therapies are discussed in part I V, 5. Okeson JP . Management of Temporomandibular “ Multidisciplinary Treatment Approach. ” Disorders and Occlusion , 6th ed. St Louis : CV For patients who do not obtain satisfactory Mosby , 2008 : 175 , 382 . improvement from these techniques, their 6. Randow K , Carlsson K , Edlund J , Oberg T . The TMD symptoms may benefi t from a effect of an occlusal interference on the masticatory stabilization appliance (the standard fl at - surface system: An experimental investigation. O dontol appliance). It is recommended patients alternate Revy 1976 ; 27 ( 4 ): 245 – 256 . the use of the OSA and stabilization appliances 7. Riise C , Sheikholeslam A . The infl uence of experimental interfering occlusal contacts on the at their discretion, using their judgment to postural activity of the anterior temporal and balance the appliance wear with their TMD masseter muscles in young adults. J Oral Rehabil and snoring or sleep apnea symptoms. 1982 ; 9 : 419 – 425 . Occlusal changes are another complaint 8. Le Bell Y , Jamsa T , Korri S , Niemi PM , Alanen P . among patients wearing OSA appliances and Effect of artifi cial occlusal interferences depends on appear to be more common after 1 or more previous experience of temporomandibular years of wear. 11,13,15,18 Some are thought to be disorders . Acta Odontol Scand permanent occlusal changes, whereas others 2002 ; 60 ( 4 ): 219 – 222 . are due to muscle and/or TMJ dysfunction 9. Clark GT , Tsukiyama Y , Baba K , Watanabe T . and resolve on their own after the appliance is Sixty - eight years of experimental occlusal removed or after jaw - stretching exercises.1 3,14 interference studies: What have we learned? J Since OSA appliances hold the mandible Prosthet Dent 1999 ; 2 : 704 – 713 . 10. Magnusson T , Enbom L . Signs and symptoms of forward similar to Herbst appliances, the mandibular dysfunction after introduction of permanent occlusal changes from OSA experimental balancing - side interferences . Acta appliances may be consistent with fi ndings Odontol Scand 1984 ; 42 : 129 – 135 . observed from Herbst appliances, which are 11. Clark GT , Sohn J - W , Hong CN . Treating primarily dentoalveolar changes. 19,20 obstructive sleep apnea and snoring: Assessment of Randomized clinical trials comparing the an anterior mandibular positioning device . JADA presented hypotheses will facilitate our ability 2000 ; 131 ( 6 ): 765 – 771 . to more effectively help patients manage their 12. Friedlander AH , Walker LA , Friedlander IK , snoring and obstructive sleep apnea while Felsenfeld AL . Diagnosing and comanaging patients minimizing their TMD symptoms. with obstructive sleep apnea syndrome . JADA 2000 ; 131 ( 8 ): 1178 – 1184 . 13. Pantin CC , Hillman DR , Tennant M . Dental side REFERENCES effects of an oral device to treat snoring and obstructive sleep apnea . Sleep 1999 ; 22 ( 2 ): 237 – 240 . 1. Humphrey SP , Lindroth JE , Carlson CR . Routine 14. Lindman R , Bondemark L . A review of oral devices dental care in patients with temporomandibular in the treatment of habitual snoring and obstructive disorders . J Orofac Pain 2002 ; 16 ( 2 ): 129 – 134 . sleep apnoea . Swed Dent J 2001 ; 25 ( 1 ): 39 – 51 . 106 P A R T I I C O M M O N A C U T E T M D C O N D I T I O N S A N D T R E A T M E N T S 15. Ferguson KA , Cartwright R , Rogers R , Schmidt - advancement devices for the management of snoring Nowara W . Oral appliances for snoring and and sleep apnea . J Prosthet Dent obstructive sleep apnea: A review . Sleep 2008 ; 99 ( 4 ): 314 – 321 . 2006 ; 29 ( 2 ): 244 – 262 . 19. Von Bremen J , Pancherz H . Effi ciency of early and 16. George PT . Selecting sleep - disordered - breathing late Class II Division 1 treatment . Am J Orthod appliances, biomechanical considerations . JADA Dentofacial Orthop 2002 ; 121 ( 1 ): 31 – 37 . 2000 ; 132 ( 3 ): 339 – 347 . 20. Baltromejus S , Ruf S , Pancherz H . Effective 17. Lavigne GJ , Goulet J - P , Zuconni M , Morisson F , temporomandibular joint growth and chin position Lobbezoo F . Sleep disorders and the dental patient: changes: Activator versus Herbst treatment. A An overview . Oral Surg Oral Med Oral Pathol Oral cephalometric roentgenographic study. E ur J Radiol Endod 1999 ; 88 : 257 – 272 . Orthod 2002 ; 24 ( 6 ): 627 – 637 . 18. Jauhar S , Lyons MF , Banham SW , Cameron DA , Orchardson R . Ten - year follow - up of mandibular Chapter 9 Lateral Pterygoid Myospasm This is the most common disorder seen When the inferior lateral pterygoid muscle among the emergency TMD patients I am has a myospasm, it is in a partially shortened referred. Patients and their dentists are often state and holds the condyle in a translated frantic because it develops relatively rapidly, position. This is generally far enough forward and the patient can no longer close his or her that the teeth no longer occlude into MI. 2 teeth into MI and can no longer open wide. Additionally the slope of the articular The patient also has constant pain and eminence dictates that, with the condyle palpation tenderness of the lateral pterygoid translated, there is a space that forms between area. A case scenario of a patient with this the ipsilateral posterior teeth (see Figure 9 .1) . disorder is presented in “ Case 16 ” in part V . Similar to awaking with a calf myospasm in which the individual has diffi culty and QUICK CONSULTS increased pain when attempting to move the Observing Emergency T MD foot up or down, the person with a lateral Patients pterygoid myospasm has diffi culty and The lateral pterygoid myospasm is the most increased pain attempting to translate the common disorder seen among the emergency condyle forward or retrude the jaw so the TMD patients I am referred. teeth fi t into MI. The patient usually complains of the inability to put the ipsilateral Observing for Lateral Pterygoid posterior teeth together without excruciating Myospasm pain, and the fi rst tooth contact is in the area Lateral pterygoid myospasm develops relatively of the contralateral canine (if the patient has rapidly, the patient can no longer close his or her a normal tooth alignment). Since the patient teeth into maximum intercuspation, can no also has diffi culty translating, he or she usually longer open wide, has constant pain, and has has a marked limited opening. palpation tenderness of the lateral pterygoid The severity of the myospasm may vary, so area. the extent of these symptoms will differ from patient to patient; e.g., a patient with minimal A myospasm is the involuntary contracture symptoms may complain about pain only of a muscle, causing pain and interfering with when closing into MI. The overview drawing the muscle ’ s ability to move. This disorder has (top left) of the “ T MJ Disc Displacements” awakened many of us during the middle of diagram (appendix 3 ) is used to visually the night with a painful cramp in one’ s calf explain the lateral pterygoid myospasm muscle.1 symptoms to the patient. 107 108 P A R T I I C O M M O N A C U T E T M D C O N D I T I O N S A N D T R E A T M E N T S Figure 9.1. Lateral pterygoid myospasm often causes a gap between the ipsilateral posterior teeth. TECHNICAL TIP the signifi cant limited opening as commonly Explaining Lateral Pterygoid observed with a lateral pterygoid myospasm. Myospasm Symptoms Once the history is obtained, the The overview drawing (top left) of the “ TMJ Disc “ Recommended Initial Palpations ” in chapter Displacements ” diagram (appendix 3 ) is used to 3 (Table 3.1
) are performed in addition to visually explain the lateral pterygoid myospasm palpating the lateral pterygoid area. This symptoms to the patient. provides the practitioner with a tentative approximation of the relative lateral pterygoid myospasm to TMJ infl ammation contribution By far, the most common reasons for the to the patient ’ s symptoms. The practitioner condyle to be held in a partially translated may desire to use shim stock to confi rm location are a lateral pterygoid myospasm, which teeth occlude; see Figure 3 .27. TMJ infl ammation, or a combination of these The primary treatment I use for a lateral disorders. 2 When the TMJ ’ s retrodiscal tissue pterygoid myospasm is stretching the inferior is infl amed, it can physically push the condyle lateral pterygoid muscle, as depicted in forward or the lateral pterygoid muscle can Figure 9.2 . I perform this stretch to better be in a state of protective splinting3 in which approximate the lateral pterygoid myospasm the patient subconsciously holds the condyle and TMJ infl ammation involvement, and the forward to avoid compressing the infl amed potential for it to provide effective therapy. retrodiscal tissue. When TMJ infl ammation To stretch the inferior lateral pterygoid is the sole cause for the patient’ s inability to muscle, place the thumb on the most occlude in MI, the lateral pterygoid muscle posterior ipsilateral teeth and wrap the fi ngers is healthy and the patient would not have around the mandible. One may prefer to use C H A P T E R 9 L A T E R A L P T E R Y G O I D M Y O S P A S M 109 Figure 9.2. Stretching lateral pterygoid muscle. the dominant or nondominant hand. Some this stretch throughout the day, he or she may practitioners like to place gauze between the be able to resolve the disorder merely through patient’ s teeth and their thumb to prevent lateral pterygoid muscle stretches. discomfort from pressing on the cusp tips. If TMJ infl ammation is the primary source Push down with the thumb and pull up on for the patient ’ s symptoms, as the stretch is the chin. This rotates the mandible, distracts performed the patient generally relates it the condyle, and provides more room to aggravates the pain, so I then only stretch the mobilize the condyle. While distracting the lateral pterygoid muscle up to tolerance, and condyle, slowly push the mandible posteriorly afterward ask the patient to close lightly. If up to approximately 4 pounds of force and there is any improvement this would suggest a hold for about 30 seconds. Release the force, lateral pterygoid myospasm is involved. Based but maintain the hand position on the upon the fi ndings of this test, I speculate the mandible. After about 10 seconds, repeat the involvement of each of these disorders. 30 - second stretch of the lateral pterygoid muscle. Perform six of these stretches, remove the hand, and ask the patient to TECHNICAL TIP close lightly. Differentiating Lateral Pterygoid If a lateral pterygoid myospasm is the Myospasm and T MJ Infl ammation primary source for the patient ’ s symptoms, Diagnose lateral pterygoid myospasm, TMJ the patient generally relates that the teeth fi t infl ammation, or a combination, based on a together better and the pain has decreased. patient ’ s symptom response to stretching the This suggests if the patient were to perform lateral pterygoid muscle. 110 P A R T I I C O M M O N A C U T E T M D C O N D I T I O N S A N D T R E A T M E N T S Practitioners need to keep in mind that perform a series of six stretches, six times a other, rarely observed disorders (e.g., tumor in day, and hold each stretch for 30 seconds. TMJ) may cause similar symptoms and are If the patient cannot perform the stretches beyond the scope of this book. 4,5 I once in this manner or prefers not to place his or observed an individual who had an external her fi ngers in the mouth, an alternative ear infection that caused a similar inability to technique has been recommended in which close into MI. The patient clearly knew the the patient uses a wooden tongue depressor to ear was the source of his pain and recognized disengage the teeth and help retrude the the inability to close into MI; additionally the mandible. The patient performs this exercise opening was not restricted. If a patient does by placing a tongue depressor between the not adequately respond to initial therapy or maxillary and mandibular incisors with the there is cause for other concerns, the extraoral end of the tongue depressor tipped practitioner may want to take a screening down at an angle of approximately 45 ° to the image of the TMJ with a plain radiograph vertical. The patient slowly protrudes the (e.g., transcranial radiographs) or panoramic mandible along the tongue depressor, then radiograph. relaxes the jaw and retrudes the mandible up It is recommended that lateral pterygoid the incline,6 and holds the retruded position myospasm treatment be provided in a tiered as recommended previously. approach and the initial therapies be observed At the follow - up appointment, the great to determine whether they adequately resolve majority of my patients with lateral pterygoid the problem. Initially provide the patient with myospasm report that performing the “ TMD the “ TMD Self - Management Therapies ” Self - Management Therapies ” handout handout (appendix 4 ) and with an exercise recommendations and the exercises resolved or protocol to stretch the lateral pterygoid are controlling their symptoms and they have muscle. If the muscle pain is severe enough to no desire to escalate therapy. If these initial justify medications, patients usually benefi t therapies do not resolve the myospasm or if from an analgesic (e.g., 800 mg ibuprofen, the myospasm continues to recur, then t.i.d.) and a muscle relaxant (e.g., 5 m g traditional TMD therapies (e.g., occlusal diazepam, 1 – 2 tablets h.s.). appliance therapy, identifying and changing contributing factors) should be implemented QUICK CONSULT and have been shown to be benefi cial. Providing Tiered- Approach Treatment QUICK CONSULT It is recommended that lateral pterygoid Reducing Symptoms of Lateral myospasm treatment be provided in a tiered Pterygoid Myospasm approach and the initial therapies be observed to The great majority of my patients with lateral determine whether they adequately resolve the pterygoid myospasm report that the stretching problem. exercises have resolved or are controlling their symptoms and they have no desire to escalate The patient should perform this gradual therapy. active stretch of the inferior lateral pterygoid muscle up to tolerance, ensuring that neither If the diagnosis includes TMJ the muscle nor the TMJ is aggravated from infl ammation, it is generally recommended this procedure. It is recommended the patient that the patient be provided an C H A P T E R 9 L A T E R A L P T E R Y G O I D M Y O S P A S M 111 anti - infl ammatory medication. If there is only (as in appendix 6 ) are generally for closure mild TMJ infl ammation in comparison to muscles and will tend to aggravate a painful the lateral pterygoid myospasm, I consider lateral pterygoid muscle. prescribing 500 mg naproxen, b.i.d. If the primary diagnosis is TMJ infl ammation, if REFERENCES the condition is of recent onset or an acute aggravation of a chronic condition, and if 1. American Academy of Orofacial Pain . de Leeuw R the pain is mild to moderate, I provide the (ed). Orofacial Pain: Guidelines for Assessment, Diagnosis and Management , 4th ed. Chicago : patient with the “ TMD Self - Management Quintessence , 2008 : 156 . Therapies ” handout and tend to prescribe 2. Dupont JS . Acute malocclusion . Gen Dent 500 mg naproxen, b.i.d. If the pain is a 6/10 2006 ; 54 ( 2 ): 102 – 104 . or above, I consider prescribing the Medrol 3. Stegenga B , de Bont LGM . TMJ growth, adaptive Dosepak - naproxen regimen discussed in modeling and remodeling, and compensatory “ Anti - infl ammatory Medications ” in chapter mechanisms. In: Laskin DM , Greene CS , Hylander 17 , in addition to the “ TMD Self - WL . Temporomandibular Disorders: An Evidence - Management Therapies ” handout (appendix Based Approach to Diagnosis and Treatment . 4 ). These patients should be followed to Hanover Park, IL : Quintessence , 2006 : 53 – 67 . ensure the symptoms resolve; otherwise, 4. Kademani D , Bevin C . A mass in the traditional TMD therapies should be initiated temporomandibular joint . JADA 2008 ; 139 ( 3 ): and have been shown to be benefi cial in 301 – 303 . 5. Xiang S , Rebellato J , Inwards CY , Keller EE . resolving TMJ infl ammation. Malocclusion associated with osteocartilaginous loose Since the inability to close into MI is due bodies of the temporomandibular joint. J ADA to a temporary condition, it is important the 2005 ; 136 ( 4 ): 484 – 489 . practitioner does not adjust the occlusion at 6. Gray RJ , Davies SJ . Emergency treatment of acute this transitory position. It is also important to temporomandibular disorders: Part 1. D ent Update be cognizant that TMD - stretching exercises 1997 ; 24 ( 4 ): 170 – 173 . Chapter 10 Acute TMJ Disc Displacement without Reduction FAQ Q: If a patient has an acute TMJ disc displacement without reduction, should the practitioner attempt to “ unlock ” the TMJ? A: The longer the patient has had the acute TMJ disc displacement without reduction, the less likely the dentist will be able to “ unlock ” the TMJ. There is no distinct time limit after which this procedure should not be attempted, but the success rate decreases rapidly as the condition extends beyond 1 week. Patients with this disorder present with some QUICK CONSULTS similarities to patients with a lateral pterygoid Observing for Acute TMJ Disc myospasm; i.e., both patients have limited Displacement without Reduction opening, and their contralateral and protrusive Patients with this disorder present with some movements are generally restricted. similarities to patients with a lateral pterygoid Fortunately there are many differences that myospasm; i.e., both patients have limited enable practitioners to separate these diagnoses opening, and their contralateral and protrusive clinically; e.g., a patient with an acute TMJ movements are generally restricted. disc displacement without reduction generally can close his or her teeth into maximum Differentiating from Lateral intercuspation without pain. Pterygoid Myospasm Patients with an acute TMJ disc displacement without reduction present with many differences 113 114 P A R T I I C O M M O N A C U T E T M D C O N D I T I O N S A N D T R E A T M E N T S from patients with a lateral pterygoid myospasm, the primary one being that the former can generally close their teeth into maximum intercuspation without pain. The symptoms known to be associated with an acute TMJ disc displacement without reduction have been shown to be a reliable clinical indicator for this condition. 1 The condition occurs suddenly and includes restriction of mouth opening and of contralateral and protrusive movements; Figure 10.1. Condyle is caught behind disc’ s defl ection of the mandible toward the posterior band and as patient tries to translate the condyle (open wider), the disc is pushed forward, ipsilateral side as the patient attempts to open stretching the retrodiscal tissue, causing maximally; and elimination of clicking, infl ammatory and pain mediators to be released popping, or transient locking. 1 into the synovial fl uid, causing the patient to This sudden onset is an immediate change; experience pain, and increasing the patient ’ s TMJ e.g., the patient may have been eating a meal palpation tenderness (TMJ infl ammation). with a normal opening and suddenly on the next bite the TMJ blocks the opening at the individual opens and the condyle
attempts to location where the TMJ normally clicked, translate, the condyle is blocked by the disc’ s popped, or transiently locked. Patients are posterior band and cannot reduce onto the usually aware that the TMJ’ s translation is disc. As the patient repeatedly bumps into this blocked in this manner and typically have an restriction or attempts to open beyond it, the initial restricted opening of approximately retrodiscal tissue is forcibly stretched, releasing 20 – 30 mm. 2 infl ammatory and pain mediators into the synovial fl uid; see Figure 10.1 . This causes (or increases) TMJ infl ammation and is the basis QUICK CONSULT for the TMJ pain. 3 Asking Patients about Symptoms Patients are usually aware that the TMJ ’ s translation is blocked in this manner and TECHNICAL TIP typically have an initial restricted opening of Explaining Acute T MJ Disc approximately 20– 30 mm. Displacement without Reduction This disorder is demonstrated in the bottom right section of the “ TMJ Disc Displacements” Clinically it has been observed that some diagram (appendix 3 ), which should be helpful in patients with this disorder cannot or are explaining the disorder to patients. reluctant to demonstrate the deviation upon maximal opening or the expected restricted movements. This may be due to pain on the FOCAL POINT contralateral side or guarding of the painful As the patient repeatedly bumps into this TMJ. restriction or attempts to open beyond it, the This disorder is demonstrated in the retrodiscal tissue is forcibly stretched, releasing bottom right section of the “ T MJ Disc infl ammatory and pain mediators into the Displacements ” diagram (appendix 3 ). As the synovial fl uid. C H A P T E R 1 0 A C U T E T M J D I S C D I S P L A C E M E N T W I T H O U T R E D U C T I O N 115 The patient generally points to the TMJ diagrams and explain the mechanism of the as the source of the pain, and the TMJ disc displacement with reduction (which the is generally the most palpation - tender vast majority of patients had prior to the masticatory structure. The masticatory onset) in the bottom left diagram. Explain that muscles often tighten in response to the TMJ the condyle repeatedly loaded the retrodiscal pain (protective muscle splinting), so they are tissue (through parafunctional habits, eating also frequently tender and painful. If there is tough foods, etc.), thereby thinning the tissue a question about the source of the restriction, so the condyle is now higher in the the patient ’ s mouth can be stretched to mandibular fossa. For the condyle to reduce aggravate the restricting structure (as discussed onto the disc, it must now move down further in “ Additional Evaluations ” in chapter 3 ), and to travel below the posterior band. This is this location confi rmed by reproducing the more diffi cult, and in the patient’ s situation pain through palpation. the condyle cannot move below the posterior Some patients with this disorder also band. The posterior band now blocks the complain about painful anterior and/or condyle from translating forward, as shown in posterior digastric muscles, which are small the bottom right diagram. jaw - opening muscles that are not developed to Depending on how I plan to treat the provide repeated forceful contractions. These disorder, I may inform the patient that the muscles are generally painful from the patient tension held in the muscles (the closure repeatedly opening his or her mouth, pushing muscles: masseter, temporalis, and medial against the disc, in an attempt to free or pterygoid) contributes to the continuation of stretch this restriction. Occasionally these the disorder by bracing the condyle higher in muscles are as painful as the TMJ. the mandibular fossa. I also might inform the Direct trauma occasionally causes an acute patient that the tension held in the muscles TMJ disc displacement without reduction. 4 If continues to load the retrodiscal tissue, the patient relates the sudden limited opening aggravating the TMJ. This tension is usually is due to external trauma, then muscle injury, related to stress, parafunctional habits, or TMJ infl ammation, and fracture should eating. also be considered as possible causes of the Some patients complain that this disorder restriction. In this situation, a panoramic occurs only intermittently and is not present radiograph should be taken to rule out a at the time of the dental appointment. It fracture. is recommended that this be diagnosed as This disorder ’ s onset is most commonly intermittent acute TMJ disc displacement related to repeated loading of the TMJ without reduction , the mechanical problem through activities such as parafunctional just discussed be reviewed, and inquiry made habits. 5,6 It is speculated the progression about the type of events that seem to precede occurs by thinning of the retrodiscal tissue or initiate the disorder. Patients commonly relative to the posterior band,7 ,8 and report an increase in clicking and/or parafunctional habits as well as loading of the intermittent locking severity associated with TMJ raise the condyle in the mandibular fossa daytime parafunctional habits, nocturnal relative to the posterior band. 9,10 parafunctional habits, or eating. 3 An easy manner in which to explain this If the patient awakes with the intermittent disorder to patients is through the use of the disorder, nocturnal parafunctional habits are “ TMJ Disc Displacements ” diagram (appendix probably the primary contributor, and it is 3 ). Start by orienting the patient to the recommended that the practitioner (1) review 116 P A R T I I C O M M O N A C U T E T M D C O N D I T I O N S A N D T R E A T M E N T S the “ TMD Self - Management Therapies ” “ Integrating Conservative Therapies ” in (appendix 4 ) , with special emphasis on sleep chapter 19 ). posture; and (2) provide the patient with an occlusal appliance that is worn at night. If the QUICK CONSULT disorder is not adequately resolved by these Observing Daytime Intermittent therapies, other traditional TMD therapies Symptoms should benefi t this disorder (see “ Integrating If the intermittent disorder occurs during the Conservative Therapies ” in chapter 19 ). day, the primary contributors probably are daytime muscle tension and/or parafunctional QUICK CONSULT habits. Observing Waking Intermittent Symptoms For patients with the intermittent disorder, If the patient awakes with the intermittent three techniques can be discussed that they disorder, nocturnal parafunctional habits are may fi nd benefi cial in “ unlocking ” their TMJ. probably the primary contributor. About half of my patients can “ unlock ” their TMJ by placing their fi nger about 1/2 inch anterior to their TMJ, pressing medially and If the intermittent disorder occurs during slightly posterior, and moving the mandible the day, the primary contributors are probably side to side. It is speculated this pressure tends daytime muscle tension and/or parafunctional to push tissue between the condyle and fossa, habits. In addition to the TMD self - helping to distract the condyle, enabling it to management instructions, it is recommended slide more easily under the posterior band of that the patient become aware of the daytime the disc. muscle tension and parafunctional habits and learn to break them (breaking these parafunctional habits is discussed in “ B reaking TECHNICAL TIP Daytime Habits ” in chapter 14 ). If this does Unlocking an Intermittent Acute not adequately resolve the disorder, I would TMJ Disc Displacement without ask a psychologist to help the patient break Reduction the daytime parafunctional habits (as For patients with the intermittent disorder, three discussed in “ Breaking Daytime Habits ” in techniques can be discussed that they may fi nd chapter 1 6) . If the patient needed additional benefi cial in “ unlocking ” their TMJ. assistance, it is recommended that therapy be escalated by fabricating an appliance for the A second procedure is for patients patient to wear at night to decrease the impact consciously to relax and massage the any nocturnal parafunctional habits may have temporalis and masseter muscles. As these on the problem. Until the patient learns to muscles relax, ask patients to move the control the daytime muscle tension and mandible side to side. It is speculated that the parafunctional habits, the appliance may also closure muscles are often tight when the be worn for a limited time during the day, intermittent disorder occurs, bracing the especially in situations the patient relates to condyle higher in the fossa. As these muscles preceding or initiating the disorder (except for relax, the condyle distracts slightly, enabling it eating). If these techniques do not adequately to slide more easily under the posterior band resolve the disorder, other traditional TMD of the disc as the patient moves the mandible therapies should benefi t this disorder (see to the contralateral side. C H A P T E R 1 0 A C U T E T M J D I S C D I S P L A C E M E N T W I T H O U T R E D U C T I O N 117 A third technique some fi nd benefi cial is to practitioner can manually distract the TMJ by slide the mandible as far as possible to the placing the thumb on the most posterior contralateral side and then open maximally. 2,11 ipsilateral teeth, wrapping the fi ngers around This attempts to forcibly reduce the condyle the mandible, and pressing down on the onto the disc and often causes discomfort as posterior teeth and up on the chin (Figure this vigorous reduction occurs. 10.2 ). This motion is similar to removing the It is recommended patients fi rst try pressing cap from a soda pop bottle. Some in front of the TMJ, because this is a quick practitioners like to place gauze between the nonaggravating maneuver. If that does not teeth and their thumb to prevent discomfort unlock the TMJ, then try relaxing and from pressing on the cusp tips. After massaging the temporalis and masseter distracting the TMJ for approximately 30 muscles while moving the mandible side to seconds, maintain the force and ask the side. It is recommended the third maneuver patient to repeat the prior movements several be used as a last resort because of the times.2 ,4 If this is unsuccessful, while discomfort that often occurs when the condyle continuing to distract the TMJ, the abruptly reduces. practitioner can attempt to move the condyle It is recommended patients with the forward and medial (the usual location of the intermittent disorder be treated with disc) in an attempt to unlock the TMJ conservative therapies in an attempt to resolve (Figure 10.3 ). their intermittent locking and TMD pain. The practitioner can easily tell whether the Otherwise, it is feared that the disorder may unlocking procedure was clinically successful progress from intermittent to continuous, and because the patient immediately regains the TMD pain severity appears to be one of the normal opening, even though fi ndings on factors predicting which patients will be thus magnetic resonance imaging often show affected. 12 A case scenario of a patient with an complete reduction is not obtained. 13 intermittent acute TMJ disc displacement If these were unsuccessful and the patient without reduction is presented in “ C ase 12” and practitioner would like to continue in part V . attempting to unlock the TMJ, many In treating patients who have the additional procedures can be used in continuous disorder, one practitioner reports conjunction with the manipulation. They that manipulation to unlock the TMJ is often attempt to decrease the patient’ s pain (which successful for patients who have been locked reduces the patient guarding) and/or relax the for less than a week, but the success rate patient (which reduces the tension in the decreases rapidly as the condition extends closure muscles). These procedures include beyond 1 week.2 There is no distinct time nitrous oxide – oxygen inhalation, lateral limit after which this procedure should not pterygoid muscle anesthetic injection, lateral be attempted, and it is only
up to the pterygoid and masseter muscle anesthetic practitioner ’ s and patient ’ s discretion. injection, TMJ anesthetic injection, and an One technique is to fi rst have the patient oral anti- infl ammatory and/or muscle relaxant attempt to self- u nlock. Ask the patient to prescription. 3,14 – 16 Once these medication(s) consciously relax and massage the closure have taken effect, the practitioner can attempt muscles, and then make several attempts at to unlock the TMJ by the same manipulations unlocking the TMJ by moving the mandible described previously. to the contralateral side as far as possible and If the practitioner is successful at unlocking opening maximally. If this is unsuccessful, the the TMJ, the patient often needs to wear an Figure 10.2. Manually distracting the TMJ. Figure 10.3. Moving the condyle forward and medial while manually distracting the TMJ. 118 C H A P T E R 1 0 A C U T E T M J D I S C D I S P L A C E M E N T W I T H O U T R E D U C T I O N 119 Figure 10.4. The condyle in the reduced position. anterior positioning appliance to hold the 2 - mm - deep indentations for the maxillary condyle in the reduced position (Figure 1 0.4) . teeth (Figures 10.5 and 10.6 ). Otherwise, the condyle will tend to lock again when it is retruded off the disc. A quick, easy TECHNICAL TIP technique for fabricating a temporary anterior Fabricating a Temporary Anterior positioning appliance is to use the putty that Positioning Appliance is used for crown and bridge impressions. 17 A quick, easy technique for fabricating a Ask the patient to place the anterior teeth end temporary anterior positioning appliance is to to end, which provides a stable reproducible use the putty that is used for crown and bridge position where the condyle is usually reduced impressions. on the disc. Mix the putty into the shape of a thick rope 4 – 5 inches long, ask the patient to It is recommended patients wear the open, place the material along the occlusal - appliance 24 hours a day, including while incisal surfaces of the teeth, and ask the eating (these patients will generally drink their patient to close to the prior end- t o- e nd meals during this phase of treatment). position, but stop the patient so about 1 m m Depending on the pain severity associated of material remains between the maxillary and with this disorder, the practitioner may desire mandibular anterior teeth. Adjust the to prescribe an anti - infl ammatory and/or appliance so it is retentive for the mandibular muscle relaxant (as discussed below and in teeth and has only approximately 1- to chapter 17 , “ Pharmacological Management ” ). 120 P A R T I I C O M M O N A C U T E T M D C O N D I T I O N S A N D T R E A T M E N T S reduction that was unlocked is presented in “ Case 13 ” in part V . Clinically I am not successful in unlocking the TMJs for many patients with this disorder. Even though the TMJ could not be unlocked or the practitioner does not feel comfortable attempting these manipulations or managing the patient once the TMJ unlocks, the vast majority of these patients do well with conservative TMD therapy.1 4,18 In Figure 10.5. Maxillary view of the temporary fact, many patients with this disorder improve anterior positioning appliance. without treatment; 19,20 the symptoms tend to gradually fade away over a few weeks or months. 1 QUICK CONSULT Unlocking the T MJ Clinically I am not successful in unlocking the TMJs for many patients with this disorder. FOCAL POINT Even if patients’ TMJs are not unlocked, the vast majority do well with conservative TMD therapy. Figure 10.6. Mandibular view of the temporary anterior positioning appliance. One study followed the cases of individuals who chose not to have treatment for this The long - term treatment plan for these disorder (their symptoms tended to be mild) patients generally includes wearing a and found the approximate portions of the stabilization appliance (the standard fl at - group at 6 months, 12 months, and 18 surface appliance) at night. Because of the months whose symptoms had resolved were time needed for its fabrication, if the patient one - third, one - half, and two - thirds, does not already have one, the practitioner respectively.2 0 The investigators found that may desire to make impressions to fabricate younger individuals more readily become one as soon as the patient can tolerate it. asymptomatic without treatment. 21 Patients should wear the temporary putty It is speculated that the reason people can appliance 24 hours a day for the fi rst 2 – 4 days progress through this disorder is that they before transitioning to nighttime - only wear. 2 often unintentionally apply a stretching force The number of days of continuous wear varies to their retrodiscal tissue. Every time an with a patient ’ s propensity for the TMJ to individual with this disorder opens to the relock. Similarly, over time, patients transition restriction, the condyle pushes the disc to wearing the stabilization appliance, forward (see Figure 10.1 ). This may modulated by the propensity for the TMJ unintentionally occur when the person to relock. A case scenario of a patient with talks, laughs, puts food in the mouth, etc. an acute TMJ disc displacement without Repeatedly bumping or pushing the disc in C H A P T E R 1 0 A C U T E T M J D I S C D I S P L A C E M E N T W I T H O U T R E D U C T I O N 121 this manner will often suffi ciently stretch the The amount of conservative therapy I retrodiscal tissue over time. As the retrodiscal initially provide these patients varies with the tissue is stretched, the disc moves forward, level of their pain, the length of time they eventually the disc is pushed out of the have had the disorder, and whether their condyle ’ s translation path, and the individual limited opening has improved. It is regains the normal opening. As this recommended all of these patients be provided progression occurs, the retrodiscal tissue with the explanation discussed earlier and a typically gets stretched less often, and the “ TMD Self - Management Therapies ” handout amount of infl ammatory and pain mediators (appendix 4 ) , emphasizing the importance of released into the synovial fl uid is observing for and breaking any daytime correspondingly reduced, allowing the TMJ contributing habits. infl ammation to improve proportionally. If the microtrauma to the retrodiscal tissue QUICK CONSULT (from parafunctional habits, muscle tension, etc.) is satisfactorily small, the TMJ Providing Conservative Therapy infl ammation may totally resolve. The amount of conservative therapy I initially provide these patients varies with the level of their pain, the length of time they have had the FOCAL POINT disorder, and whether their limited opening has Every time an individual with this disorder opens improved. to the restriction, the condyle pushes the disc forward. Repeatedly bumping or pushing the disc in this manner will often suffi ciently stretch Most of my patients receive a stretching the retrodiscal tissue over time. exercise unless they have such severe TMJ pain that it is believed performing the exercise Even though many individuals can progress will be too painful at the time, or a patient through this disorder with minimal treatment, has rapidly regained most of the opening and others have excruciating pain and desperately the exercise is considered unnecessary. The need help. Conservative treatment for this exercise tends to aggravate the TMJ, but most disorder primarily attempts to reduce the patients are prescribed an anti- i nfl ammatory TMJ infl ammation and TMJ loading. This medication, so they generally can tolerate the promotes a synovial fl uid environment that exercise. The patient is instructed to perform facilitates more rapid adaptive alterations of the exercise as shown in Figure 5.1 , hold the retrodiscal tissue.7 Additionally patients the stretch 30– 6 0 seconds, and sporadically often benefi t from adjunctive up to tolerance perform this approximately six times stretching to help mobilize the disc out of the throughout the day. The patient needs to condyle ’ s translation path.2 balance the amount of force, length of time Suffi cient studies have not been completed the stretch is held, and number of times the to suggest a specifi c conservative therapy stretch is performed throughout the day, so regimen, and conservative therapy ’ s success the resulting TMJ pain is tolerable.2 ,4 Patients is highly variable from patient to patient. 6,18 are asked, when possible, to preheat the TMJ Most patients with this disorder are with a heating pad prior the exercise.2 2 successfully treated with conservative As a general pharmaceutical guide, I tend TMD therapies, but some patients will not to prescribe the following for patients with satisfactorily improve and will need to have constant pain. This will vary with a patient’ s their level of therapy escalated. 18 fl uctuating pain - intensity pattern, the TMJ 122 P A R T I I C O M M O N A C U T E T M D C O N D I T I O N S A N D T R E A T M E N T S palpation tenderness, and the emotional opposing cast, e.g., soft appliance; or (2) make impact of the disorder. If the patient has a the mandibular impression after removing low level of TMJ pain (3/10 or below), I a portion of the tray ’ s lingual fl ange. If this tend to prescribe 500 mg naproxen, b.i.d. results in an inadequate impression and a If the TMJ pain is above 5/10, I consider mandibular appliance is preferred, fabricate prescribing the Medrol Dosepak - naproxen a temporary mandibular appliance (e.g., regimen discussed in “ Anti - infl ammatory soft appliance) and, if desired, replace it Medications ” in chapter 17 . If nocturnal once the opening suffi ciently improves. parafunctional habits appear to be During treatment, closely monitor the contributing to the TMJ infl ammation (the opening and pain level to ensure the patient is patient awakes with greater TMJ pain), I also responding well to the initial therapy. If it tend to prescribe 5 mg diazepam, 1 –2 tablets appears the patient is not responding quite h.s., to decrease the nocturnal parafunctional positively to this therapy over the next 1 or habits until a stabilization appliance can be 2 weeks, and a stabilization appliance is not inserted. being used, escalate therapy by adding the If there is muscle pain, I tend to prescribe appliance. 5 mg diazepam, 1 – 2 tablets h.s. If the patient While under therapy, it is not uncommon has signifi cant muscle pain causing a for a patient to report that his or her TMJ substantial amount of daytime pain, I has unlocked. This situation is different than consider discussing the possibility of the when a practitioner manipulates a patient patient also taking 1/2 tablet in the morning to unlock his or her TMJ, for in this and afternoon; the potential side effects and situation the TMJ does not tend to relock ramifi cations must be discussed. I maintain immediately and therefore an anterior the patient on 5 m g diazepam, 1– 2 tablets positioning appliance is not needed. Even h.s., and/or nonsteroid anti - infl ammatory though the TMJ unlocked, it is important drugs as long as it appears they are benefi cial. that the patient continue therapy and This is the only TMD disorder for which I become as asymptomatic as possible, for might continue prescribing diazepam for patients with greater pain appear to have a longer than 2– 3 weeks. greater propensity for redeveloping this The longer patients have had this disorder, disorder.1 2 the less likely they are to do well with If a patient does not appear to be conservative therapy. 6
Therefore, at the initial improving from the conservative therapy or is exam, if a patient reports having had the frustrated with the slow progress, the disorder for more than 2 months or so, practitioner may desire to escalate treatment especially if the patient has not observed to an invasive procedure.2 3 Studies show that improvement in limited opening, I tend to conservative therapy, arthrocentesis, and include a stabilization appliance as part of my arthroscopic surgery provide a similar degree initial therapy. A stabilization appliance, in of improvement for this disorder.1 8,24 Flushing addition to these other therapies, generally the pain and infl ammatory mediators out of provides greater benefi t for these patients.6 ,18 the TMJ through arthrocentesis or If a patient cannot open wide enough that arthroscopic surgery appears to enable patients an adequate mandibular impression can be to rapidly stretch the retrodiscal tissue. If the made, the practitioner has several options: perpetuating contributing factors (1) make only a maxillary impression and (parafunctional habits, etc.) were never fabricate an appliance that does not need an adequately controlled, though, TMD pain C H A P T E R 1 0 A C U T E T M J D I S C D I S P L A C E M E N T W I T H O U T R E D U C T I O N 123 may return after the surgery and the disc remains anchored anteriorly. Conservative contributing factors would need to be therapy can decrease the TMJ loading and addressed.1 8,25 infl ammation, allowing the reconstitution of the “ healthy ” synovial fl uid, thereby promoting the release of the adhered disc. QUICK CONSULT Pressure injections and arthrocentesis can be Escalating to an Invasive benefi cial for treatment of this condition and Procedure are recommended if conservative therapy is If a patient does not appear to be improving not successful.2 3,30 As more information is from the conservative therapy or is frustrated obtained about this condition, it may become with the slow progress, the practitioner may recognized as an independent TMD disorder. desire to escalate treatment to an invasive Practitioners must bear in mind that a procedure. patient ’ s inability to translate may be due to a neoplastic growth within the TMJ.3 1 Additionally, referral for these procedures Neoplasia arising within the TMJ are should not be unnecessarily delayed when it extremely rare, 31 but the practitioner may becomes evident that conservative therapy will desire to make a screening radiograph, such not be successful; the longer the patient has as a transcranial or panoramic radiograph, this disorder, the less likely it is that much during the initial evaluation or if the initial benefi t will be derived from arthrocentesis and therapy does not improve the patient’ s the more likely it is arthroscopic surgery (more condition. A case scenario of a patient with expensive and invasive) may be needed.2 6 TMJ an acute TMJ disc displacement without injections with anesthetic, steroid, and/or reduction that was not unlocked is presented sodium hyaluronate (not yet approved by the in “ Case 14 ” in part V . FDA for use in the TMJ) have also been recommended and are also reasonable REFERENCES considerations for treating this disorder. 27 – 29 If surgical intervention was chosen as the 1. Isberg A , Stenstrom B , Isacsson G . Frequency of fi rst line of treatment, the contributing factors bilateral temporomandibular joint disc displacement that caused this disorder to develop (e.g., in patients with unilateral symptoms: A 5- y ear parafunctional habits, etc.) will often need to follow - up of the asymptomatic joint — a clinical and be dealt with after the surgical intervention. If arthrotomographic study . Dentomaxillofac Radiol they are not satisfactorily reduced, there is a 1991 ; 20 ( 2 ): 73 – 76 . high likelihood that TMD symptoms will 2. Okeson JP . Joint intracapsular disorders: Diagnostic return. 18 and nonsurgical management considerations . Dent An alternative hypothesis for this disorder Clin North Am 2007 Jan; 51 ( 1 ): 85 – 103 . has been presented in the literature, in which 3. Pertes RA , Gross SG . Disorders of the TMJ loading causes a breakdown of the temporomandibular joint . In: Pertes RA , Gross SG (eds). Clinical Management of Temporomandibular synovial fl uid, potentiating the tendency for Disorders and Orofacial Pain . Chicago : the superior portion of the disc to adhere to Quintessence , 1995 : 75 – 78 . the articular eminence in a fashion similar to 4. Okeson JP . Management of Temporomandibular a suction cup. It is theorized that the anterior Disorders and Occlusion , 6th ed. St Louis : CV displacement is caused by the disc adhering to Mosby , 2008 : 415 – 420 . the articular eminence while the condyle is 5. Molina OF , dos Santos J Jr , Nelson SJ , Nowlin T . translated and, as the condyle retrudes, the A clinical study of specifi c signs and symptoms of 124 P A R T I I C O M M O N A C U T E T M D C O N D I T I O N S A N D T R E A T M E N T S CMD in bruxers classifi ed by the degree of severity . 16. Mongini F . A modifi ed extraoral technique of Cranio 1999 ; 17 ( 4 ): 268 – 279 . mandibular manipulation in disk displacement 6. Stiesch - Scholz M , Fink M , Tschernitschek H , without reduction . Cranio 1995 ; 13 ( 1 ): 22 – 25 . Rossbach A . Medical and physical therapy of 17. Hicks NA . An effi cient method for constructing a temporomandibular joint disk displacement without soft interocclusal splint . J Prosthet Dent reduction . Cranio 2002 ; 20 ( 2 ): 85 – 90 . 1989 ; 61 ( 1 ): 48 – 50 . 7. Stegenga B , de Bont LGM . TMJ growth, adaptive 18. Schiffman EL , Look JO , Hodges JS , Swift JQ , modeling and remodeling, and compensatory Decker KL , Hathaway KM , Templeton RB , Fricton mechanisms. In: Laskin DM , Greene CS , Hylander JR . Randomized effectiveness study of four WL . Temporomandibular Disorders: An Evidence - therapeutic strategies for TMJ closed lock. J Dent Based Approach to Diagnosis and Treatment . Res 2007 ; 86 ( 1 ): 58 – 63 . Hanover Park, IL : Quintessence , 2006 : 53 – 67 . 19. Minakuchi H , Kuboki T , Matsuka Y , Maekawa K , 8. Stegenga B , de Bont LGM . TMJ disc Yatani H , Yamashita A . Randomized controlled displacements . In: Laskin DM , Greene CS , evaluation of non - surgical treatments for Hylander WL . Temporomandibular Disorders: An temporomandibular joint anterior disk displacement Evidence - Based Approach to Diagnosis and without reduction . J Dent Res 200180 ( 3 ): 924 – 928 . Treatment . Hanover Park, IL : Quintessence , 20. Sato S , Kawamura H , Nagasaka H , Motegi K . The 2006 : 125 – 136 . natural course of anterior disc displacement without 9. Kuboki T , Azuma Y , Orsini MG , Takenami Y , reduction in temporomandibular joint: Follow - up at Yamashita A . The effect of sustained unbilateral 6, 12, and 18 months . J Oral Maxillofac Surg molar clenching on the temporomandibular joint 1997 ; 55 : 234 – 238 . space . Oral Surg Oral Med Oral Pathol Oral Radiol 21. Sato S , Goto S , Kawamura H , Motegi K . The Endod 1996 ; 82 ( 6 ): 616 – 624 . natural course of nonreducing disc displacement of 10. Ito T , Gibbs CH , Marguelles - Bonnet R , Lupkiewicz the TMJ: Relationship of clinical fi ndings at initial SM , Young HM , Lundeen HC , Mahan PE . visit to outcome after 12 months with- o ut Loading on the temporomandibular joints with fi ve treatment . J Orofac Pain 1997 ; 11 ( 4 ): 315 – 320 . occlusal conditions . J Prosthet Dent 22. Lentell G , Hetherington T , Eagan J , Morgan M . 1986 ; 56 ( 4 ): 478 – 484 . The use of thermal agents to infl uence the 11. Yamaguchi T , Komatsu K , Okada K , Matsuki T . effectiveness of a low- l oad prolong stretch. J Orthop The advantageous direction of jaw movement for Sports Phys Ther 1992 ; 16 ( 5 ): 200 – 207 . releasing TMJ intermittent lock . Cranio 23. Reston JT , Turkelson CM . Meta - analysis of surgical 2006 ; 24 ( 3 ): 171 – 178 . treatments for temporomandibular articular 12. Lundh H , Westesson P - L , Kopp S . A three - year disorders . J Oral Maxillofac Surg 2003 ; 61 ( 1 ): 3 – 10 . follow - up of patients with reciprocal 24. Murakami K , Hosaka H , Moriya Y , Segami N , temporomandibular joint clicking. O ral Surg Oral Iizuka T . Short - term treatment outcome study for Med Oral Pathol 1987 ; 63 ( 5 ): 530 – 533 . the management of temporomandibular joint closed 13. Segami N , Murakami K , Iizuka T . Arthrographic lock: A comparison of arthrocentesis to nonsurgical evaluation of disk position following mandibular therapy and arthroscopic lysis and lavage. O ral Surg manipulation technique for internal derangement Oral Med Oral Pathol Oral Radiol Endod with closed lock of the temporomandibular joint . J 1995 ; 80 ( 3 ): 253 – 257 . Craniomandib Disord 1990 ; 4 ( 2 ): 99 – 108 . 25. Dimitroulis G . A review of 56 cases of chronic 14. Mongini F , Ibertis F , Manfredi A . Long - term closed lock treated with temporomandibular joint results in patients with disc displacement without arthroscopy . J Oral Maxillofac Surg reduction treated conservatively . Cranio 2002 ; 60 ( 5 ): 519 – 524 . 1996 ; 14 ( 4 ): 301 – 305 . 26. Sakamoto I , Yoda T , Tsukahara H , Imai H , 15. Helkimo M , Hugoson A . Nitrous oxide – oxygen Enomoto S . Comparison of the effectiveness of sedation in the diagnosis and treatment of arthrocentesis in acute and chronic closed lock: temporomandibular joint locking: A clinical and Analysis of clinical and arthroscopic fi ndings . methodological study . Cranio 1988 ; 6 ( 2 ): 148 – 155 . Cranio 2000 ; 18 ( 4 ): 264 – 271 . C H A P T E R 1 0 A C U T E T M J D I S C D I S P L A C E M E N T W I T H O U T R E D U C T I O N 125 27. Yeung RW , Chow RL , Samman N , Chiu K . 29. Suarez OF , Ourique SAM . An alternate technique Short - term therapeutic outcome of intra - articular for management of acute closed locks. C ranio high molecular weight hyaluronic acid injection for 2000 ; 18 ( 3 ): 168 – 173 . nonreducing disc displacement of the 30. Nitzan DW . “ Friction and adhesive forces ” — temporomandibular joint . Oral Surg Oral Med Oral possible underlying causes for temporomandibular Pathol Oral Radiol Endod 2006 ; 102 ( 4 ): 453 – 461 . joint internal derangement . Cells Tissues Organs 28. Emshoff R . Clinical factors affecting the outcome 2003 ; 174 ( 1 – 2 ): 6 – 16 . of arthrocentesis and hydraulic distension of the 31. American Academy of Orofacial Pain . de Leeuw R temporomandibular joint . Oral Surg Oral Med (ed). Orofacial Pain: Guidelines for Assessment, Oral Pathol Oral Radiol Endod 2005 ; 100 ( 4 ): 409 – Diagnosis and Management , 4th ed. Chicago : 414 . Quintessence , 2008 : 144 . Chapter 11 TMJ
Dislocation A TMJ dislocation is diagnosed when a painful, tend to develop spasms, and make it patient presents with or relates a history of progressively more diffi cult to reduce the momentary or prolonged inability to close the condyle over time. As individuals are unable mandible from a maximal open position. This to self - reduce, they often become distressed is due to the condyle being trapped in front because the pain increases as they attempt to of the articular eminence.1 The entrapment close their mouth.4 ,5 may be from the articular eminence If a patient has a dislocation, the sooner the obstructing the posterior movement of the condyle is manipulated, the easier it is for disc - condyle unit, the disc obstructing the the practitioner to reduce the dislocation. If posterior movement of the condyle, or a the dislocation just recently occurred, it will combination of the two. 2 probably be fairly easy to reduce through manipulation. 6 Among patients who have had QUICK CONSULT the dislocation for a month or more, few can Diagnosing TMJ Dislocation have it reduced through manipulation.4 A TMJ dislocation is diagnosed when the patient presents with or relates a history of QUICK CONSULT momentary or prolonged inability to close the Observing Ease of Manipulation mandible from a maximal open position. If a patient has a dislocation, the sooner the condyle is manipulated, the easier it is for the It is very common for individuals to have practitioner to reduce the dislocation. this disorder and self - reduce.3 ,4 Some defi ne the self- reducing condition as subluxation,3 Prior to attempting to reduce a patient ’ s but in this book (and as defi ned by the dislocation, explain to the patient how the American Academy of Orofacial Pain) temporalis and masseter muscles are tight and dislocation includes both when an individual bracing the condyle in front of the articular is able or needs someone else to reduce the eminence. Explain that he or she will need condyle. 1 to concentrate and relax the muscles as the This disorder is extremely easy to diagnose. condyle is pushed down and around the The patient relates a history of a sudden eminence. While the patient is concentrating catching or locking near maximal opening to relax his or her closure muscles, put gauze (e.g., from a yawn, dental procedure, or bilaterally over the mandibular molars, yelling). If the duration is more than place your thumbs over the gauze (some momentary, the closure muscles become practitioners place their thumbs on the buccal 127 128 P A R T I I C O M M O N A C U T E T M D C O N D I T I O N S A N D T R E A T M E N T S shelves), and wrap your fi ngers around the patients. Warn them to be very cautious when chin. Ask the patient to open wider, which they yawn, yell, and have dental treatment. physiologically causes the closure muscles to Some fi nd this satisfactorily prevents the relax. As he or she attempts to open wider, dislocation, whereas others have diffi culty bilaterally press down on the molars, press up remembering to restrict their opening and on the chin, and slowly slide the mandible thus desire to escalate therapy. The next posteriorly.5 ,7 Fortunately, so far, I have always therapy recommended is a stabilization been successful with this maneuver. appliance worn at night, which clinical If this is unsuccessful, some practitioners experience has shown and others have recommend having an assistant activate the observed generally reduces the frequency and gag refl ex by touching the patient ’ s soft palate intensity of a dislocation. 9,11 This may be due with a couple of cotton - tip applicators, while to the appliance ’ s capability to decrease the the practitioner reattempts the maneuver. 5,7 TMJ loading, thereby improving the quality The gag refl ex should more vigorously of the TMJ ’ s lubricant (sodium hyaluronate).9 stimulate the opening muscles, providing Others theorize the dislocation is primarily a greater physiological inactivation of the due to a muscular disorder and the appliance closure muscles. decreases the dislocation’ s frequency and/or If this fails to reduce the condyle, intensity through improvement of the muscle medications may enable the manipulation to disorder. 11 be successful. The medications are used in an attempt to relax the patient (which reduces QUICK CONSULT the tension in the closure muscles) and/or Reducing Dislocation’ s Frequency decrease the pain (which reduces the patient’ s and Intensity guarding). They may include nitrous Wearing a stabilization appliance at night oxide – oxygen inhalation, TMJ anesthetic generally reduces the frequency and intensity of injection, intravenous sedation, or general a dislocation. anesthesia. 4,5,6,8 Adjunctive procedures with manipulation have also been recommended, If the appliance does not satisfactorily i.e., arthrocentesis, arthroscopic surgery, or diminish the dislocation, it is recommended open joint surgery. 3,9,10 that the practitioner discuss three other At this stage of therapy escalation, many options and let the patient decide which of practitioners refer the patient to someone with these he or she is interested in pursuing: (1) If greater expertise in this area, e.g., an oral the patient desires help remembering to surgeon. 6 restrict the opening, it is recommended the Patients whose condyles were successfully patient be offered a referral to an orthodontist reduced or who have a dislocation history may to have buttons placed on the molars. Plastic desire to prevent this from recurring. In this fi shing line or elastics are placed around the situation, it is recommended that preventative buttons, so when the patient tries to open therapy be provided in an escalating fashion. wide, he or she is reminded to restrict the First educate the patient about the mechanical opening. The patient wears this for 2 problem; explain that, if the patient learns not months.7 (2) If the patient has trouble to open too wide, the problem will not occur. reducing when the dislocation occurs, it is The top left diagram of the “ T MJ Disc recommended the patient be taught how to Displacements ” handout (appendix 3 ) may distract and reduce his or her condyle. 7 (3) If help to explain TMJ dislocation visually to the dislocation is a signifi cant problem, it is C H A P T E R 1 1 T M J D I S L O C A T I O N 129 recommended the patient be offered a referral (eds). Clinical Management of Temporomandibular to an oral surgeon to discuss a surgical Disorders and Orofacial Pain . Chicago : treatment for the dislocation.8 Quintessence , 1995 : 80 – 81 . 6. Nusrath MA , Adams JR , Farr DR , Bryant DG . TMJ dislocation . Br Dent J 2008 ; 204 ( 4 ): 170 – 171 . TECHNICAL TIP 7. Okeson JP . Management of Temporomandibular Self -R educing a T MJ Dislocation Disorders and Occlusion , 6th ed. St Louis : CV Sometimes I teach the patient how to distract Mosby , 2008 : 424 – 428 . and reduce his or her condyle. 8. Laskin DM . Indications and limitations of TMJ surgery . In: Laskin DM , Greene CS , Hylander WL . REFERENCES Temporomandibular Disorders: An Evidence - Based Approach to Diagnosis and Treatment . Hanover 1. American Academy of Orofacial Pain . de Leeuw R Park, IL : Quintessence , 2006 : 413 – 419 . (ed). O rofacial Pain: Guidelines for Assessment, 9. Nitzan DW . Temporomandibular joint “ open lock ” Diagnosis and Management , 4th ed. Chicago : versus condylar dislocation: Signs and symptoms, Quintessence , 2008 : 148 . imaging, treatment, and pathogenesis . J Oral 2. Yoda T , Imai H , Shinjyo T , Sakamoto I , Abe M , Maxillofac Surg 2002 ; 60 ( 5 ): 506 – 511 . Enomoto S . Effect of arthrocentesis on TMJ 10. Esposito C , Clear M , Veal SJ . Arthroscopic surgical disturbance of mouth closure with loud clicking: A treatment of temporomandibular joint preliminary study . Cranio 2002 ; 20 ( 1 ): 18 – 22 . hypermobility with recurrent anterior dislocation: 3. Shorey CW , Campbell JH . Dislocation of the An alternative to open surgery . Cranio temporomandibular joint . Oral Surg Oral Med Oral 1991 ; 9 ( 3 ): 286 – 292 . Pathol Oral Radiol Endod 2000 ; 89 ( 1 ): 29 – 34 . 11. Kai S , Kai H , Nakayama E , Tabata O , Tashiro H , 4. Caminiti MF , Weinberg S . Chronic mandibular Miyajima T , Sasaguri M . Clinical symptoms of dislocation: The role of non - surgical and surgical open lock position of the condyle: Relation to treatment . J Can Dent Assoc 1998 ; 64 ( 7 ): 484 – 491 . anterior dislocation of the temporomandibular joint. 5. Pertes RA , Gross SG . Disorders of the Oral Surg Oral Med Oral Pathol temporomandibular joint . In: Pertes RA , Gross SG 1992 ; 74 ( 2 ): 143 – 148 . Part III Occlusal Appliance Therapy Occlusal appliances have been used to improve TMD symptoms for over 100 years.1 They generally provide a benefi cial effect for masticatory muscle pain, TMJ pain, TMJ noise, jaw mobility, and TMJ dislocation.2 – 4 Many studies have demonstrated the effectiveness of the stabilization appliance (the traditional fl at - surface occlusal appliance). FOCAL POINT Occlusal appliances generally provide a benefi cial effect for masticatory muscle pain, TMJ pain, TMJ noise, jaw mobility, and TMJ dislocation. Some dentists limit their TMD therapy to occlusal appliances, most probably because they have not been taught how and/or when to provide other therapies. For patients with more severe TMD pain, occlusal appliances alone will only provide modest improvement, will not provide satisfactory relief, and will not provide any relief for some.2 ,3,5 These appliances should be thought of as only one of many potential conservative TMD therapies. Effective integration of conservative TMD therapies is discussed in “ Integrating Conservative Therapies ” in Chapter 19 . FOCAL POINT Occlusal appliances alone will not provide many TMD patients with satisfactory symptom relief and will not provide any relief for some. QUICK CONSULT Providing Conservative TMD Therapies Occlusal appliances should be thought of as only one of many potential conservative TMD therapies. 131 132 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y Occlusal appliances can cause irreversible changes with jaw movement and occlusion. This problem is generally limited to patients who wear their appliance long term for more than 12 hours a day, especially if their appliance covers only part of the dental arch.6 Patients who do not maintain their appliance or oral hygiene suffi ciently may develop caries, gingival infl ammation, and/or mouth odors.4 Practitioners provide a vast variation of occlusal appliances. Therefore, when one begins studying occlusal appliances, the subject matter appears overwhelming. Basically appliances can only be fabricated to vary (1) whether the appliance allows the mandible to slide freely from maximum intercuspation (e.g., stabilization appliance) or holds the mandible in a predetermined condylar position (e.g., anterior positioning appliance), (2) the condyle ’ s position when a patient occludes in maximum intercuspation on the appliance, and (3) the physical aspects of the appliance, i.e., whether it covers all of the teeth in the arch, whether it covers the maxillary or mandibular teeth, the type of material it is fabricated with, its thickness, and its form of retention. The two most common appliances used to treat TMD patients are the stabilization and anterior positioning appliances. The stabilization appliance has a fl at surface occluding with the opposing dentition, which provides a gnathologically stable occlusal environment and generally uses the mutually protected occlusal scheme. This appliance enables patients to move freely from maximum intercuspation and is most commonly used for patients with tooth attrition or TMD symptoms. The anterior positioning appliance is primarily used for patients who have a disc displacement with reduction and holds the mandible in the anterior location where the
condyle is reduced onto the disc. In this manner, the disc - condyle mechanical disturbances are temporarily eliminated, and any forces loading the condyle are transmitted through the disc ’ s intermediate zone rather than the retrodiscal tissue. The reason occlusal appliances are clinically effective is not fully understood. This section uses the occlusal appliance literature and clinical observations to provide a better understanding of these appliances, so practitioners may use them more effectively with their TMD patients. QUICK CONSULT Understanding the Mechanism for Effectiveness The reason occlusal appliances are clinically effective is not fully understood. P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y 133 To help your hygienists better identify patients in your practice who should be provided an occlusal appliance, a recommended “ R eferral Criteria for Hygienists ” is provided in appendix 1. REFERENCES 4. American Academy of Orofacial Pain. de Leeuw R (ed). Orofacial Pain: Guidelines for Assessment, 1. Goodwillie DH . Arthritis of the temporomaxillary Diagnosis and Management , 4th ed. Chicago : articulation . Arch Med 1881 ; 5 : 259 – 263 . Quintessence , 2008 : 168 . 2. Fricton J . Current evidence providing clarity in 5. Behr M , Stebner K , Kolbeck C , Faltermeier A , management of temporomandibular disorders: Driemel O , Handel G . Outcomes of Summary of a systematic review of randomized temporomandibular joint disorder therapy: clinical trials for intra - oral appliances and occlusal Observations over 13 years . Acta Odontol Scand therapies . J Evid Based Dent Pract 2006 ; 6 ( 1 ): 2007 ; 65 ( 5 ): 249 – 253 . 48 – 52 . 6. Clark GT , Minakuchi H . Oral appliances . In: Laskin 3. Rinchuse DJ , McMinn JT . Summary of evidence - DM , Greene CS , Hylander WL . based systematic reviews of temporomandibular Temporomandibular Disorders: An Evidence - Based disorders . Am J Orthod Dentofacial Orthop Approach to Diagnosis and Treatment . Hanover 2006 ; 130 ( 6 ): 715 – 720 . Park, IL : Quintessence , 2006 : 377 – 390 . Chapter 12 Stabilization Appliance FAQs Q: What do you think about the new appliance materials and is there one that you prefer? A: Appliances fabricated from many of these new materials are softer than the traditional acrylic appliances, are easier to insert, are more comfortable for the patients, and still provide adequate wear resistance for most patients. I refer to this category of materials as intermediate materials because their hardness is between the traditional hard and soft appliance materials. Among appliances fabricated with one of the intermediate materials, I prefer appliances fabricated with Impak, as discussed in “ Hard, Intermediate, or Soft Material ” and “ Appliance Examples ” in this chapter. Q: What do you think about the NTI (Nociceptive Trigeminal Inhibition Tension Suppression System) appliance? A: On average, the traditional stabilization appliance provides better TMD symptom improvement and does not have the probability of causing the signifi cant number of occlusal changes that are associated with the NTI; hence I do not recommend or provide patients with an NTI. The NTI is discussed in “ Full or Partial Coverage ” in this chapter. Q: If a patient is provided an acrylic appliance for tooth attrition, will the opposing teeth wear if the patient continues to grind? A: The acrylic appliance is softer than the teeth, so when he or she grinds the acrylic will wear rather than the teeth.1 ,2 135 136 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y Q: Do you recommend practitioners use a centric relation (CR) interocclusal record and adjust the appliance in CR? A: Obtaining an interocclusal record and adjusting the appliance in CR provides the practitioner with a more reproducible maxillomandibular relationship, requires less effort to obtain a well - adjusted appliance, and provides the patient with an appliance that maintains its stable occlusal environment. Unfortunately many TMD patients cannot tolerate the TMJs being seated in CR and/or cannot relax the muscles satisfactorily so CR can be attained. Q: Do you ever provide patients with appliances that do not cover all of the teeth in the arch? A: It is very rare for me to provide an appliance that does not cover all of the teeth in the arch, because a full - coverage appliance reduces the probability of teeth moving while the patient uses it. Q: Is a maxillary or mandibular appliance more effective? A: Both maxillary and mandibular appliances can be fabricated to provide virtually a perfect gnathologic articulation, and they appear to have comparable effi cacy. Q: Do you adjust the occlusion of athletic mouthpieces that you deliver? A: I always adjust the occlusion of the athletic mouthpiece, because it makes the mouthpiece more comfortable, less likely to cause occlusal changes, and less likely to cause patients to develop TMD symptoms. Stabilization appliances provide a FOCAL POINT gnathologically stable occlusal environment in Stabilization appliances are advocated when which the mandible can slide freely from nocturnal parafunctional habits are believed to maximum intercuspation. Numerous be contributing to tooth attrition, tooth pain, practitioners use these appliances for many tooth mobility, abfractions, recurrent tooth non - TMD purposes. Their use is advocated fractures, and periodontal disease. Additionally when nocturnal parafunctional habits are these appliances are used for deprogramming believed to be contributing to tooth attrition, proprioception prior to dental treatment and tooth pain, tooth mobility, recurrent tooth observing a patient ’ s tolerance to an increased fractures, and periodontal disease. Additionally vertical dimension. these appliances are used for deprogramming proprioception prior to dental treatment and TMD patients generally report a decrease observing a patient’ s tolerance to an increased in morning symptoms with the use of a vertical dimension.1 ,2 nocturnal appliance.1 Nocturnal muscle C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 137 activity has been generally shown to decrease making her aware of what she was doing, so with nighttime appliance wear, but she stopped. The other reported that the parafunctional activities (e.g., bruxing or appliance made her very cognizant of her clenching) do not stop. 2,3 One study found mouth, and thus she noticed and reduced her that even patients whose nocturnal muscle daytime habits. activity increased with nighttime appliance A third hypothesis for the TMD symptom wear reported a decrease in TMD symptoms.3 improvement observed with the use of stabilization appliances is related to the increase in vertical dimension that occurs FOCAL POINT from their wear. An increase in vertical TMD patients generally report a decrease in dimension is speculated to benefi t both morning symptoms with the use of a nocturnal the TMJ and the musculature. 6 The appliance. nonoccluding palatal appliance has also been shown to increase the resting vertical Why stabilization appliances benefi t many dimension. 7 TMD patients is not well understood, but A fourth hypothesis is that stabilization several hypotheses have been proposed. It appliances can be fabricated so they decrease appears more than one may apply the load on the TMJ during different oral simultaneously, and the impact of each varies activities. Decreasing the load placed on the for every individual. TMJ reduces the continual TMJ aggravation The most common hypothesis is that that occurs from parafunctional habits, stabilization appliances can replace a patient’ s thereby promoting healing of the TMJ.8 ,9 occlusal disharmonies with virtually a perfect Similarly anterior positioning appliances can gnathologic articulation.1 ,2,4 It is frequently change the location within the TMJ that the observed that TMD symptoms improve load is transmitted, e.g., from infl amed to among new patients who bring a poorly noninfl amed tissues. adjusted appliance with an occlusion that is Over - the -c ounter appliances sold for signifi cantly improved. TMD symptoms or athletic mouthpieces are A second hypothesis is that wearing the often purchased by individuals in an attempt appliance causes patients to be more attuned to adequately resolve their TMD symptoms. continually to their oral cavity and It has been observed that individuals have parafunctional habits, thereby enabling them mixed results with these appliances and the to catch and alter these habits. 2 Some studies belief is that a poor response may be related provided acrylic appliances that did not to (1) the opposing occlusal indentations occlude with the opposing dentition and having been made with the condyles in an found that these appliances improved TMD inappropriate position, (2) the occlusal symptoms. 5 It is postulated the symptom indentations not allowing the patient to move improvement is primarily due to a change in the mandible freely, or (3) the mouthpiece the patient ’ s cognitive awareness from wearing not providing adequate retention, requiring the nonoccluding appliance. 2 When, out of the patient to hold it in place by keeping the curiosity, nonoccluding palatal appliances teeth together. It is strongly recommended were fabricated for two patients with daytime that patients do not attempt to use an over- TMD symptoms, both reported symptom the - counter appliance, because of fear that it reduction. One related that the appliance may cause occlusal changes if it does not cover shifted every time she started to clench, or evenly occlude with all of the teeth. 138 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y MANDIBULAR POSITIONS AND INTEROCCLUSAL RECORD Centric relation appears to be the most musculoskeletally stable position for the mandible. In CR, the condyles are seated in their most anterior - superior location against the disc ’ s intermediate zone (the thinnest avascular portion of the disc) and the posterior slopes of the articular eminences. Theoretically a stabilization appliance Figure 12.1. A model simulating occlusion appropriately adjusted using CR would be on a stabilization appliance adjusted with the optimally effective.4 ,8 mandible in a position anterior to centric relation (CR). QUICK CONSULT Using Centric Relation Centric relation (CR) appears to be the most musculoskeletally stable position for the mandible. CR is a very reproducible position; if the interocclusal record is made using CR, the resulting appliance occlusion in the mouth will be very similar to the occlusion developed on the articulator. Therefore, obtaining an interocclusal record and adjusting the appliance using CR should require the least Figure 12.2. A model simulating occlusion on the stabilization appliance in Figure 12.1, with the amount of effort for practitioners. mandible retruded; note only the most posterior If the interocclusal record is made and the tooth contacts the appliance. appliance adjusted in a position anterior to CR, the patient can retrude the mandible from this position. When the patient retrudes, practitioners with a more reproducible the condyles slide superior along the articular maxillomandibular relationship, require less eminence, causing the posterior portion of the effort to obtain a well - adjusted appliance, mandibular occlusal plane to move superior. and provide patients with an appliance that As the patient then occludes onto the maintains its stable occlusal environment. appliance, only the most posterior tooth or Unfortunately many TMD patients cannot teeth would occlude on it, as demonstrated tolerate the TMJs being seated in CR in Figures 12.1 and 12.2 . Consequently, and/or cannot relax the muscles satisfactorily adjusting an appliance in a protruded position so CR can be attained.8 ,10 Hence, when furnishes an appliance that may provide the non - TMD patients need a stabilization patient with an unstable occlusal environment. appliance, it is recommended that their Obtaining an interocclusal record and interocclusal record and adjustments be made adjusting the appliance in CR provide using CR. C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 139 Many TMD patients who have TMJ TECHNICAL TIP infl ammation fi nd it painful to have their
Using Centric Relation condyles seated into CR. 8,11 If the It is recommended that CR be used only for practitioner were to adjust these appliances TMD patients who have no detectable TMJ so maximum intercuspation coincided with infl ammation, TMJ noise, or history of TMJ the condyles being seated in CR, one would locking. anticipate that, whenever these patients clenched on the appliance in maximum intercuspation, the condyles would seat in Instead of using CR, it is recommended CR, reproducing this pain and aggravating that an unrestrained condylar position that their TMD. approaches CR but does not encroach upon Some patients have TMJ noises (clicking, infl amed retrodiscal tissue nor fi rmly seat the popping, or crepitus) caused by mechanical condyles be used. Therefore, if a patient were interference within the TMJ. This interference to have his or her appliance adjusted to this may be caused by the disc, the retrodiscal position and clench on the appliance in tissue, or irregularities on the head of the maximum intercuspation, the condyles would condyle and/or the articular eminence, as tend not to forcibly seat or load against any discussed in “ T MJ Noise” in chapter 3 . If the structure. I refer to this unrestrained condylar condyles are seated fi rmly into CR, the TMJ position as the neutral position. mechanical interference often becomes more To obtain the condyle ’ s neutral position , pronounced, which tends to aggravate the adjust the back of the dental chair so it is TMJ. 12 approximately 10 ° above the horizontal Early in my TMD training, a patient plane of the fl oor. Ask the patient to tilt his reported that about once a month her right or her head back as far as possible, place the TMJ locked and did not allow her to open tongue on the roof of the mouth, and slide it wide (an intermittent acute TMJ disc back as far as possible. Lightly place a fi nger displacement without reduction). No TMJ on the inferior portion of the patient’ s chin infl ammation was detected, so I bilaterally and repeatedly ask the patient to close and manipulated her mandible to seat the condyles open his or her mouth (Figure 1 2.3) . into CR. Her right TMJ locked as the After a few arching movements, the patient condyles were seated in CR; she telephoned develops a consistent arching of the me later that day to let me know that her mandible. TMJ had fi nally unlocked for her. Each of the recommended positions helps Based on clinical experiences and my to retrude the mandible and prevent the understanding of the TMJ ’ s biomechanics, tendency of some patients to protrude the it is recommended that CR be used only for mandible inadvertently.4 ,13 The reader can TMD patients who have no detectable TMJ easily observe how these positions tend to infl ammation, TMJ noise, or history of TMJ retrude the mandible on himself or herself. locking. It is also recommended that CR not Sitting in your normal posture, close your be used if patients have any discomfort when teeth lightly and observe your fi rst tooth attempting to seat the condyles into CR. 8,12 contact. Then, tilt your head back as far as Therefore, the vast majority of my TMD possible and again close your teeth lightly and patients do not have their interocclusal observe your fi rst tooth contact; most people records made or appliances adjusted using notice that the mandible is more retruded. CR. Continuing to hold your head back, place 140 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y Figure 12.4. Pink baseplate wax for the interocclusal record: warmed, folded in fourths, and cut with a pair of scissors or alginate spatula in the shape of a trapezoid. Figure 12.3. The condyle’ s neutral position is obtained by the back of the dental chair being approximately 10 ° above the horizontal plane of the fl oor; asking the patient to tilt his head back as far as possible and place his tongue on the roof of his mouth and slide it back as far as possible; lightly touching the inferior portion of the patient ’ s chin; and asking the patient to close and open his mouth repeatedly. your tongue on the roof of your mouth and slide it back as far as possible. Once again, close your teeth lightly and observe your fi rst Figure 12.5. Wax interocclusal record. tooth contact; most people notice that the mandible is further retruded. Placing a fi nger on the inferior portion of a Pink baseplate wax is preferred for the patient’ s chin helps to steady the mandible so interocclusal record. It can be warmed over a he or she more easily develops a consistent fl ame, under running hot water, or in a arching of the mandible. Based on these waterbath. I fold it in fourths and cut it recommendations, most TMD patients will with a pair of scissors or alginate spatula in have their interocclusal records and appliances the shape of a trapezoid (Figure 1 2.4) . The adjusted in the neutral position. It is not as wax should be soft enough that it does not repeatable as CR, but, as the appliance is provide any resistance as the patient closes adjusted, most patients establish a consistent into it. contact position. If a practitioner would like the wax to Prior to making an interocclusal record, adhere temporarily to the maxillary teeth position the patient, review the procedure during the interocclusal record, the teeth can with the patient, and manipulate the be dried with gauze. Manipulate the mandible mandible into the planned condylar position into the planned condylar position. Ask the (CR or neutral position). Discuss the patient to open approximately 10 m m, align interocclusal record procedure planned with the trimmed baseplate wax, and ask the the patient. I let the patient know I will place patient to close slowly into the wax. Ask the warm wax in his or her mouth, manipulate patient to stop closing as soon as indentations the mandible as performed earlier, and ask the are satisfactory to provide a stable mounting patient to bite into it slowly. for the casts (Figure 12.5 ). C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 141 Attempt to remove the wax without treatment. There are some patients whose distorting it. If the teeth were dried prior to occlusion you may not be able to stabilize and placing the wax in the mouth, the wax is a compromised maxillomandibular relation more diffi cult to remove without deforming. may need to be used for the prosthodontic Wax that has a minor amount of distortion therapy.1 4 can be warmed and straightened on the cast. Some practitioners and sales representatives Check to ensure the patient did not perforate advocate using a “ n euromuscularly deter- the wax. A perforation of the wax suggests the mined ” mandibular position obtained teeth contacted and the mandible probably through a Myomonitor. This maxilloman- shifted along this contact. If a wax perforation dibular relation has no advantage over the is present, I retake the interocclusal record. traditional positions used for stabilization I do not use a facebow for occlusal appliances.1 ,15 appliance records because (1) my interocclusal An informal survey of dental laboratory record is approximately as thick as the technicians revealed most dentists do not send desired appliance thickness, (2) acrylic is their laboratory technicians an interocclusal easily adjusted and inexpensive compared record when requesting a stabilization with gold or porcelain, and (3) many TMD appliance. In this situation, laboratory patients have preauricular tenderness, and a technicians generally mount the casts in MI facebow would almost certainly be quite and open the vertical dimension of the painful. articulator. This generally provides appliances If an acrylic stabilization appliance is being that take more adjustment than if one of the requested, I ask the laboratory technician to above relationships was used. Also, if the adjust the articulator’ s pin so the closest occlusal plane is not level, adjusting the opposing posterior tooth contact is 3 m m once occlusion for a patient with the mandible the casts have been mounted. retruded from MI may require the practitioner Some dental patients need extensive to perforate the appliance in order to obtain prosthodontic therapy , requiring their even posterior contact. occlusion be restored using CR. Occasionally If you use the above recommended one of these patients has a TMJ disorder in techniques and consistently receive appliances which the practitioner cannot use CR, e.g., with the occlusion not as close to the fi nal the patient has TMJ infl ammation to the mandibular position as you think it should be, degree that the patient cannot tolerate the your laboratory technician may be using MI condyles being loaded in CR. I recommend rather than your interocclusal record. This providing the patient a stabilization appliance occurred with one of the laboratories I used, that is adjusted in the neutral position. As the in spite that I articulated the casts with the therapies recommended in this book help the interocclusal record and sent them to the lab TMD symptoms to resolve, slowly (within bound together with rubber bands. patient’ s tolerance) modify the appliance ’ s Another caveat is that if you are not skilled occlusion so it is adjusted in CR. at making an interocclusal record, send your Follow the patient to ensure he or she casts to the laboratory without an interocclusal provides consistent occlusal contacts on the record and the laboratory technician will stabilization appliance at each visit and mount your casts in MI and open the vertical remains symptom free. It is recommended the dimension of the articulator. This will patient remain in this status for 3– 6 months generally provide a stabilization appliance with prior to initiating CR required dental a moderately acceptable occlusion. 142 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y PHYSICAL VARIABLES Similarly there is a case report of a patient who was provided an appliance that did not Practitioners can choose among many physical cover his erupted third molars. He wore the alternatives when designing a stabilization appliance 24 hours a day and, by 5 weeks appliance. This section should help later, had developed an open bite in which practitioners better understand their choices only his third molars occluded when the and decide which appliance physical variables appliance was not worn.1 7 they prefer for their various patients and Not only do practitioners need to be situations. concerned about tooth movement with partial- coverage appliances, but they may not be as effective as full - coverage appliances. 18,19 Full or Partial Coverage One study provided patients with maxillary appliances that only occluded with teeth A full - coverage appliance (which covers all of 22 – 27 (Figure 12.6 ). Patients who received the teeth in the arch) reduces the probability little or no relief from the appliance had it of the teeth moving when the patient uses it. modifi ed into a full - coverage appliance, and Therefore, a full - coverage appliance is 66% reported their TMD symptoms were recommended except in rare situations. greatly or completely improved by use of the A partial - coverage appliance may cause full - coverage appliance. 19 teeth it covers to intrude and/or teeth not This type of partial - coverage appliance has included in it to extrude. Patients with heavy also been shown to compress the structures nocturnal parafunctional habits and/or who within the TMJ. 20 This is a concern for any wear the appliance more than only at night partial- coverage appliance in which only may be at greater risk of intruding the teeth anterior teeth occlude on the appliance. covered by a partial - coverage appliance. Generally practitioners who provide patients with partial - coverage appliances instruct their
patients to wear the appliance only at night, but occlusal appliances tend to improve TMD symptoms, so some patients may choose to wear it 24 hours a day to obtain additional relief despite the instructions. Mandibular appliances that cover only the posterior teeth can be made to be quite esthetic and have minimal speech interference. Some patients who have worn this partial - coverage appliance 24 hours a day have experienced occlusal changes to the degree that the anterior teeth now contact when the appliance is worn and the posterior teeth have an open bite the thickness of the appliance Figure 12.6. An example of a partial coverage when it is out of the mouth.4 ,16 Some appliance. This appliance occludes only with the mandibular anterior teeth and would enable the practitioners provide this appliance for practitioner to orthodontic move or restore the patients to wear during the day and a full- mandibular appliance while the patient continues to coverage appliance to wear during the night. wear the appliance. C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 143 Several prefabricated partial - coverage the patient could temporarily wear a maxillary appliances on the market may similarly induce appliance at night that only occludes with the tooth movement and not be as effective as a mandibular anterior teeth (Figure 1 2.6) . full - coverage appliance. Additionally some In the past few years, the NTI (Nociceptive prefabricated partial - coverage appliances Trigeminal Inhibition Tension Suppression cannot be molded adequately into the arch’ s System) has been heavily marketed to treat undercuts to provide satisfactory retention. If bruxism, TMD, migraine headache, and a nonretentive appliance is worn during the associated tension- t ype headache; see Figure day, the patient would most likely have to 12.7 .2 1 The marketing brochures often cite the keep the teeth closed on the appliance to hold results of an 8 - week clinical trial that it in place and many patients unconsciously compared an NTI with a 0.5- m m play with it, both of which generally aggravate thermoplastic sheet molded over all of the TMD symptoms. If a nonretentive appliance teeth on the arch (similar to a bleaching tray) is worn at night, the patient would probably and provided no “ additional determinates of do the same and may unconsciously remove it occlusion. ” This control was continually while asleep. For these reasons, no referred to as a “ full - coverage occlusal splint ” prefabricated partial - coverage appliances are and the brochures continue to imply this.2 1 – 24 recommended. There are two randomized clinical trials Partial - coverage appliances do enable (RCTs) that compared TMD symptom practitioners to avoid specifi c areas of the change among subjects provided NTI and mouth. For instance, a patient may develop stabilization appliances. 25,26 In one study, TMD symptoms while having a mandibular subjects were allowed to switch groups at the molar uprighted for the eventual fabrication 3 - month follow - up; 29% of the NTI of a bridge. If an occlusal appliance is needed, appliance subjects and none of the Figure 12.7. NTI appliance covering teeth 8 and 9 and the mesial portion of 10; it occludes with teeth 24 and 25. 144 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y stabilization appliance subjects requested to Seven NTI appliance subjects did not switch. At 6 months, stabilization appliance obtain symptom improvement, were offered a subjects reported a much greater TMD stabilization appliance, and six accepted the symptom improvement and analgesic intake offer; one judged the NTI appliance more (for TMD symptoms) reduction; see Figures pleasant and fi ve judged the stabilization 12.8 and 12.9 . 25 appliance more comfortable. Figure 12.8. The stabilization appliance provided a greater percent of patients with TMD symptom improvement than the NTI appliance.2 5 Figure 12.9. The stabilization appliance enabled a greater percent of patients to reduce their TMD medications than the NTI appliance.2 5 C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 145 The other RCT had signifi cantly different If the NTI appliance can reduce TMD groups (p = 0.02) in regard to widespread symptoms, I suspect it would similarly reduce body pain.2 6 As stressed in chapter 1, “ Patient headache symptoms for these headache Interview ” and chapter 2 , “ Review of the categories. There are no studies that ‘ Initial Patient Questionnaire, ’ ” TMD compared headache reductions for NTI and patients with widespread body pain do not stabilization appliances, but I speculate the respond as well to TMD therapies as those relative headache reductions for the two without widespread pain. 27 – 29 Hence treatment appliances would be comparable with the comparisons from this study are not accurate. reported relative TMD symptom reductions. Only the original 8 - week clinical trial and Hence, if practitioners would like to attempt fi rst stabilization appliance RCT evaluated for to reduce a patient ’ s headache symptoms occlusal changes. The 8- w eek trial found 5 of through one of these appliances, I recommend the 43 NTI subjects developed some mobility attempting it with the stabilization appliance of their mandibular incisors. 22 The other rather than the NTI appliance. A study did not observe occlusal changes at 3 recommended protocol for chronic headaches months, but at 6 months one of the 10 NTI patients is provided in Table 1.1, subjects had a signifi cant change in which the “ Recommendations for chronic headaches vertical overlap decreased by 1 millimeter patients. ” (probably similar to Figure 1 2.7) and the Since an appropriately designed and number of occluding tooth pairs had adjusted stabilization appliance provides a decreased from ten to fi ve. No occlusal better reduction in TMD symptoms, does not changes were reported with the stabilization cause occlusal changes, does not load the appliance. 25 TMJ, and more subjects fi nd it more Patients wearing appliances with only an comfortable, I do not use the NTI. A more anterior stop and no posterior tooth support thorough discussion of the NTI is provided in (as the NTI) load the TMJ when they Wright and Jundt.3 2 clench. 20,12 As discussed in chapter 10 , “ Acute Partial - coverage appliances are TMJ Disc Displacement without Reduction, ” recommended in only very rare circumstances, patients with a TMJ disc displacement with because the full - arch appliances have less reduction may develop an acute TMJ disc iatrogenic risk and are probably more displacement without reduction from effective. repeatedly loading the TMJ. Therefore it was not surprising to read that an appliance with only an anterior stop was the suspected cause Maxillary or Mandibular for a patient who recently received the appliance developing an acute TMJ disc Both maxillary and mandibular appliances can displacement without reduction. 12 be fabricated to provide virtually a perfect TMD has been associated with migraine gnathologic articulation, and they appear to with aura, migraine without aura, tension have comparable effi cacy.4 They each have headache, and combinations of these specifi c advantages, so my choice will vary headaches. Numerous studies have with a patient ’ s dental conditions and planned demonstrated that stabilization appliances may wear schedule. reduce headache symptoms and most Mandibular appliances generally cause less individuals are able to maintain these speech interference and are less visible when reductions for many years. 30,31 speaking. 4,8 It would be preferable to fabricate 146 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y Figure 12.10. A mandibular appliance depicting the guidance ramp extending anterior to the Figure 12.11. An example of patient with severe anterior teeth, enabling the maxillary anterior teeth tooth attrition, for which a maxillary appliance is to provide immediate disocclusion of the posterior recommended. teeth. Notice that the angle of the anterior guidance is only about 5 ° steeper than the appliance’ s occlusal plane. tooth attrition), the mandibular appliance’ s anterior guidance ramp will transfer more a mandibular appliance for a patient who is to lateral force to the maxillary anterior teeth wear an appliance during the day.8 ,11 For a than usual. Out of fear that excessive patient to obtain immediate disocclusion of parafunctional forces may similarly cause the posterior teeth with a mandibular fl aring of the anterior teeth even for patients appliance, the maxillary anterior teeth must with normal bone support, if a patient has guide along an anterior ramp. This guidance severe tooth attrition (Figure 12.11 ) it is ramp generally extends anterior to the recommended that a maxillary appliance be mandibular anterior teeth (Figure 1 2.10) and fabricated so as not to risk the possibility of also prevents maxillary anterior tooth contributing to the maxillary anterior teeth supereruption. If the patient has a large fl aring.3 3 overjet, this ramp is often unacceptably long,6 If a patient has missing teeth, an occlusal and the maxillary anterior teeth are generally appliance can bridge over the edentulous held superiorly by contact with the areas and provide occlusal contacts for the mandibular lip rather than the mandibular opposing teeth. The appliance can also be teeth. 8 Therefore if a patient has a large fabricated to provide posterior edentulous overjet, a guidance ramp is generally not extensions (Figure 1 2.12) . It would be needed, but observe for maxillary anterior preferable to fabricate the appliance for the tooth supereruption at follow - up arch that will provide greater occlusal appointments. stability; this is generally the arch with Maxillary appliances provide stability more missing teeth (Figures 12.13 and for the maxillary anterior teeth. Patients 12.14 ). Occlusal appliances can also be with periodontal disease of the maxillary fabricated to be worn over complete or partial anterior teeth tend to develop fl aring of dentures. these teeth. 33 Thus, if a patient has Hence, if a patient has compromised bone compromised bone support of the maxillary support of the maxillary anterior teeth or anterior teeth, it is recommended that a severe tooth attrition, a maxillary appliance is maxillary appliance be fabricated to prevent recommended. If none of these apply, it is this fl aring. recommended that the practitioner observe for If a patient has very strong parafunctional missing teeth and seek to fabricate the habits (primarily identifi ed by the degree of appliance for the arch that will provide greater C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 147 Figure 12.12. An appliance with a posterior edentulous extension enables the patient to obtain occlusal contacts over this area. The lighter colored portion of the appliance is due to it being relined. Figure 12.13. Because of the patient ’ s missing teeth, fabricating a maxillary rather than a mandibular appliance for this patient would provide greater occlusal stability. occlusal stability. If the practitioner plans for practitioner attempt to balance the difference the appliance to be worn during the day, the in occlusal stability with improved esthetics patient would probably prefer a mandibular and speech to determine the better arch on appliance. If greater occlusal stability could be which to fabricate the appliance. One can also obtained with a maxillary appliance, but the choose to fabricate a maxillary appliance for practitioner plans for the appliance to be worn nighttime wear and a mandibular appliance during the day, it is recommended the for daytime wear.1 1 148 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y Figure 12.14. The maxillary appliance fabricated for the patient in Figure 1 2.13 . Hard, Intermediate, or Soft Material The author is not aware of a study comparing wear
rates or TMD symptom For many years there were only two general changes with the intermediate materials; the categories of materials for fabricating only known comparative appliance wear study stabilization appliances — hard acrylic and soft evaluated two hard acrylic appliance materials thermoplastic (used for athletic mouth guards) using two curing techniques.3 4 Without materials. An informal survey of dental comparative and longitude studies evaluating laboratory technicians during that era revealed wear and fracture resistance, and ability to most dentists had their stabilization appliances maintain their properties (e.g., ability to not fabricated from the hard acrylic material. break down or discolor over time), the Over the past 50 years, many other following is the best insight I can provide for products have become available that dental stabilization appliances fabricated with these laboratory technicians use to fabricate materials. stabilization appliances. The greatest number There are several studies that compared the of new material choices have a fl exibility hard and soft thermoplastic appliances that between the hard acrylic and soft are discussed below. The fi ndings suggest thermoplastic materials that I call intermediate there is no signifi cant difference in TMD materials. A recent informal survey of dental symptom improvement obtained from a laboratory technicians revealed approximately well - adjusted hard and a well - adjusted soft 90% of dentists are requesting one of the stabilization appliance. intermediate materials for their stabilization I assume and clinical experience supports appliances. there is no signifi cant difference in the TMD symptom improvement obtained from a FOCAL POINT well - adjusted hard, intermediate, or soft Approximately 90% of dentists are using one of stabilization appliance. If one reviews the the intermediate materials for their stabilization hypotheses for the reasons stabilization appliances. appliances benefi t many TMD patients C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 149 (discussed at the beginning of this chapter), be an appliance fabricated with the Ivocap one will notice that probably the only material. Most methyl methacrylate allergies variation a different material would have is if are from the free - fl oating monomer and this it alters the appliance’ s ability to provide an material is so dense, it essentially has no ideal occlusal environment. free - fl oating monomer. Hard material has been the primary QUICK CONSULT appliance material for many years and has Varying Appliance Material well - documented scientifi c support for its Probably the only variation that appliance effi cacy. There are many fabrication material would have on an appliance ’ s effi cacy techniques that are used for these appliances would be related to its ability to provide an ideal in addition to using a hard thermoplastic occlusal environment. sheet molded over the patient’ s cast as the base and intraorally adding self - curing acrylic.8 Appliances fabricated with the hard or One of the more recent hard appliance intermediate materials (1) provide a precise materials is the Ivocap material (manufactured occlusal mark, allowing practitioners to obtain by Ivoclar). These stabilization appliance are a very accurate adjustment of the appliance; fabricated by continuously injecting the (2) can be fabricated with additional material material at 80 psi throughout its processing, in specifi c locations, so these areas (i.e., which provides an appliance with absolutely edentulous areas, crossbites, and other large minimal porosity and is probably the hardest discrepancies) can attain contact with the and most durable plastic appliance currently opposing dentition; and (3) may bond with available. Laboratory technicians need to self - curing acrylic, enabling practitioners to fabricate these appliances on hard die stone add missing contacts, add retention (by with minimal shrinkage or these appliances internally relining the appliances), and repair are extremely tight for patients and require fractured appliances. extensive internal adjustments. Appliances fabricated with intermediate I once had a patient who fractured her materials have the following advantages to stabilization appliance in a different location appliances fabricated with hard materials: (1) nearly every week. I had a slightly thicker they are more comfortable for the supporting Ivocap stabilization appliance fabricated for teeth, and (2) the softer material can her and it appeared to resolve the fracturing compensate for minor errors that might cause problem. I do not often use Ivocap an acrylic appliance to rock or cause pressure stabilization appliances, but without on teeth, hence the internal surface rarely comparative wear and strength studies, it needs to be adjusted. appears to be an appliance to consider for In regards to patient allergies , I telephoned patients who continually fracture or rapidly the manufacturers of the tradenamed materials wear their stabilization appliances. Another discussed in this chapter and all report there is consideration for patients who continually no latex in their product. If a patient has a fracture or rapidly wear their appliances methyl methacrylate allergy, the best choice would be to fabricate a soft thermoplastic for this patient would be an appliance stabilization appliance opposing the acrylic fabricated with one of the vinyl products appliance, as discussed in “ A ppliance (described below), which have no methyl or Examples. ” ethyl methacrylate. If the allergic patient Another more recent hard appliance needs a hard appliance, the best choice would material is the light polymerized material 150 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y Eclipse. The material comes in sealed or ethyl methacrylate. Common trade names envelopes with each envelope containing for vinyl appliances are Valplast and Flexite. enough material for one stabilization Appliances made with hybrid materials appliance. After adapting it to the cast will bond with self- c uring acrylic, so dentists (opposing cusp indications can also be will be able to reline and repair these placed), the cast and material are placed in appliances with self- c uring acrylic. Astron and a light unit, and the material is cured. Impak materials are the most common hybrid Intermediate material stabilization materials used by dental laboratories in the appliances are softer than the hard appliances United States. and more fi rm than the soft thermoplastic Appliances fabricated with Astron appliances. The softness helps to dissipate the materials are waxed, invested in hydrocolloid, clenching forces, and an informal survey of and cold cured. Common trade names for patients found that most patients prefer these Astron appliances are Clearsplint and softer appliances to the hard appliances. 35 Ultrafl ex. Other than the dual laminate material Appliances fabricated with Impak material (discussed later in this section), there are are waxed, invested, and processed similar to two basic classes of intermediate appliance the fabrication of a denture, which appears to materials, vinyl and hybrid materials. provide more dense appliances than the Appliances made from either are relatively Astron appliances, so these appliances will fi rm at room temperature, and the hybrid probably resist wear and fracture better. materials become very fl exible when warmed. Fabrication is much more labor intensive than There are many variables that determine the for the Astron appliances, so the laboratory hybrid ’s room temperature fi rmness and the price for these appliances is generally higher. temperature at which it becomes fl exible, so The powder to liquid ratio and many other hot water from your operatory’ s tap may be variables may vary from laboratory to hot enough, or you may need to make it laboratory, causing a variation with the hotter, e.g., by heating the water in a softness of these appliances from different microwave oven. laboratories. Stabilization appliances can be When adjusting the occlusion of appliances made entirely from Impak material (Figure fabricated from intermediate materials, I have 12.15 ; discussed in “ Appliance Examples ” in to be careful not to deform the appliance, this chapter) or with acrylic covering the or it may take a few seconds to bend the majority of the appliance’ s occluding surface, appliance back to the correct shape; patients helping to resist appliance wear from heavy may need to take similar care when cleaning parafunctional activity. Trade names for their appliance. Appliances made with the vinyl materials will not adhere to self - curing orthodontic acrylic, so dentists will not be able to reline or repair these appliances with self - curing acrylic. These appliances may dry out, so it is recommended that patients keep them immersed in water when not in use. There is no methyl or ethyl methacrylate in these appliances, so these appliances are Figure 12.15. An appliance fabricated with Impak recommended for patients allergic to methyl material. C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 151 comparable appliances are Remedeze and Soft material stabilization appliances are Bruxeze appliances, respectively. typically fabricated from a soft thermoplastic A laboratory can also give its own names to sheet that is warmed and formed over the cast. the various intermediate appliances, but if you Since the author is not aware of a clinically discuss the appliance materials with the above feasible method to add additional material to names, I believe you will be able to determine these appliances, it is recommended the the type and characteristic of the various 0.15 - inch (3.8 - mm) - thick material be used. appliances. This and the 4.0 - mm - thick material are the I also consider the dual laminate maximum thicknesses commercially available thermoplastic materials to be an that provide the greatest opportunity to perfect intermediate appliance material. Appliances a patient ’ s occlusion. These appliances are fast fabricated with it have a soft internal surface and easy to fabricate; it would be relatively and a hard thermoplastic external surface simple for a dental staff member to fabricate (discussed in “ Appliance Examples ” in this these in the practitioner ’ s offi ce. chapter). Once the material is molded over For many years, the fi ndings of studies the cast, self - curing acrylic is added to its evaluating the effi cacy of soft stabilization external surface by the laboratory technician appliances were contradictory. Since the or intraorally by the practitioner to provide material is resilient, some investigators did not the occluding portion of the appliance. adjust or adequately adjust these appliances. Self - curing acrylic can bond with the This resulted in fi ndings one would expect appliance ’ s hard thermoplastic external from providing TMD patients with surface, but cannot bond to the soft inner inadequately adjusted appliances — many internal surface. Therefore clinically I fi nd it patients had symptom aggravation.3 6,37 best to replace a fractured dual laminate More recently, studies have found that thermoplastic appliance. Clinical experience TMD patients obtain comparable symptom has also taught me the 1.8- m m material is too improvement with soft and hard stabilization fragile for these appliances and I use the appliances. 38,39 The different results appear to 2.5 - mm - thick or thicker material. be due to the soft stabilization appliances Clinically I observe two disadvantages with being adequately adjusted. 1 This is also dual laminate thermoplastic appliances. First, supported by clinical experience that the the appliance needs to be fabricated occlusion on soft appliances must be approximately 1 mm thicker than other hard meticulously adjusted, just as a practitioner or intermediate appliances in order to allow would adjust an acrylic appliance. 16,40,41 for the soft layer that overlays the teeth. Some practitioners fi nd that patients tend Second, the internal surface more readily to play with soft appliances and believe that discolors over time and after about 3 years soft appliances may trigger parafunctional many practitioners and patients desire for the habits. 42 Clinically it has been observed that appliance to be replaced. patients tend to play with a soft appliance that is not well adjusted. Patients given an FOCAL POINT unadjusted soft appliance often occlude Because of the advantages discussed, the vast against only one or two opposing teeth and majority of the stabilization appliances I request tend to clench on the appliance to produce are fabricated with the Impak material, and more occlusal
contacts, thereby increasing its sometimes I request acrylic cover the majority of occlusal stability. Conversely patients provided the appliance’ s occluding surface. a well - adjusted appliance with even posterior 152 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y contacts do not fi nd their stability is improved Since soft stabilization appliances are easily by clenching and thus do not have the fabricated, are inexpensive, and may be tendency to play with the appliance. inserted at an initial appointment, A study was once conducted to evaluate the practitioners may desire to use soft speed at which occlusal changes can take stabilization appliances in many situations: place. The investigators induced these changes by having patients wear unadjusted soft 1. In emergencies. For example, a patient is appliances.4 3 This study appeared to create in acute distress (especially if an acrylic concern that soft appliances may cause appliance may not be available for some occlusal changes. To determine whether this time) or presents with a nonrepairable occurs for patients wearing adjusted soft appliance that the patient depends on. appliances, another study used shim stock to 2. When the soft appliance will serve as a follow the occlusion in patients wearing prognostic tool to evaluate whether an adjusted soft appliances and determined that occlusal appliance would be benefi cial. A they do not cause the occlusion to change. 44 practitioner may be unsure whether a If a practitioner were to provide soft patient has TMD or whether appliance appliances to TMD patients without adjusting therapy will improve the patient’ s the occlusion, it is anticipated that their complaint (e.g., tinnitus or headaches). symptom response would be similar to the Patients who obtain symptom reduction fi ndings obtained by Nevarro and colleagues.3 7 with the use of a soft appliance generally After providing unadjusted soft appliances, also benefi t from the use of an acrylic they found the numbers of patients who appliance.4 7 reported TMD symptom improvement, no 3. When a practitioner desires an easily change, and aggravation were one, two, and adjustable interim appliance. For example, six, respectively. Clinically, similar patient a patient has a lateral pterygoid myospasm, responses have been observed from working the practitioner knows the patient will with practitioners who routinely did not have signifi cant occlusal changes as adjust the occlusion on their soft appliances. symptoms improve, and during this For TMD management of children during transition a soft appliance would be easy to their primary or mixed dentition, soft stabili- adjust, whereas the acrylic appliance may zation appliances are the appliance of choice. need to be relined. It is speculated they will not signifi cantly 4. When a practitioner desires to use a affect the development of the dentition and stabilization appliance with a child during will not need the number of adjustments that his or her primary or mixed dentition. the other appliances may require to accommo- 5. When a patient ’ s fi nancial situation is an date minor tooth movements. 1,45 overwhelming concern. Soft appliances can be fabricated for either the maxillary arch or the mandibular arch. An Conversely there are situations in which it is appliance to be used as an a thletic mouthpiece recommended that soft stabilization appliances should be fabricated for the maxillary arch. It is not be used: also recommended the occlusion be adjusted for athletic mouthpieces, because it makes a 1. When a patient has such a signifi cant mouthpiece more comfortable, less likely to occlusal discrepancy that the soft appliance cause occlusal changes, and less likely to cause material would not be thick enough to a patient to develop TMD symptoms.4 6 accommodate for the discrepancy. C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 153 2. When a patient has missing teeth in which reduction in TMD symptoms, the second the soft thermoplastic appliance will not be group ’ s symptom reduction took slightly able to provide occlusal contacts for the longer, and the fi rst group ’ s symptom opposing teeth. reduction took the longest time. The fi ndings 3. When a patient has moderately severe or of this study suggest that thicker appliances severe tooth attrition from nocturnal (up to the minimal EMG activity) may parafunctional habits. Soft appliances resolve TMD symptoms more quickly.5 2 A appear to wear more rapidly than acrylic second study supported these results after appliances, so patients with excessively comparing change in nocturnal EMG activity heavy parafunctional habits may wear with different appliance thicknesses and found through the soft appliance in a relatively only subjects with thick (compared with short time. nonoccluding, thin, and medium) appliances had signifi cantly lower nocturnal EMG activity. 53 Thick or Thin Through my teaching experience, it has been observed that many dentists believe an occlusal Muscle contraction is achieved by actin and appliance cannot be thicker than a patient ’ s myosin sliding along each other; its effi ciency freeway space. They fear that, if the appliance is related to the degree the actin and myosin is thicker than 2 or 3 mm, the patient may overlap, which varies with a muscle ’ s clench on it uncontrollably and increase the length.4 8,49 The optimum physiological muscle TMD symptoms. Patients also tend to fi nd length is speculated to be at the location thicker appliances more obtrusive and prefer to the muscle has its minimal surface have a thinner appliance, especially if they electromyelographic (EMG) activity. The previously had a thin appliance. vertical opening at which the masseter and It is not advocated that 8 - mm - thick temporalis muscles produce their minimal stabilization appliances be fabricated for surface EMG activity varies from patient patients, because thinner appliances appear to patient, but falls within the range of to be reasonably effective and have a high 4.5 – 18 mm. 50,51 degree of patient acceptance. It is important It has been postulated that a stabilization for dentists to realize stabilization appliances appliance would be more effective if it were can be more than 2 or 3 mm thick without fabricated at the vertical opening where the causing detrimental consequences. Therefore, muscle has its minimal surface EMG activity. the additional millimeters needed for the dual To test this hypothesis, TMD patients were laminate thermoplastic appliance’ s thickness randomized into three groups. One group should not present a problem, nor should it was provided stabilization appliances that be a problem if the practitioner ’ s laboratory increased the vertical dimension by 1 m m, the accidentally fabricated an appliance a little second group was provided appliances with thicker than requested. the thickness of one- h alf the opening that It is generally recommended that appliances produced minimal masseter muscle surface be fabricated between 1 and 4 m m thick. 4 As EMG activity (average, 4.4 m m), and the mentioned in “ M andibular Positions and third group was provided appliances with the Interocclusal Record ” in this chapter, when thickness of the opening that produced requesting a hard or intermediate stabilization minimal EMG activity (average, 8.2 m m). appliance, I ask the laboratory technician to The third group experienced the most rapid adjust the articulator’ s pin so the closest 154 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y opposing posterior tooth contact is 3 m m once There are many reasons an appliance is too the casts have been mounted. Requesting retentive. The most common reason a new stabilization appliances be fabricated at this appliance has too much retention is that it fi ts thickness generally enables me to provide the too tightly, thereby causing excessive frictional patient with an appliance that does not have retention. The appliance needs fi rst to be perforations and has suffi cient thickness for adjusted so it is comfortable (a technique attrition. explained in “ Internal Adjustments ” in this chapter); then the retention should be reevaluated. Appliance or Wire Retention Generally an appliance that fi ts comfortably and is too retentive has excessive retention in Appliance retention is achieved by portions of the posterior due to the appliance engaging too the appliance acting as guide planes while deeply into the buccal embrasures undercuts. other sections fl ex and engage into undercuts. In this situation, if wires provide the retention, The undercuts are generally in the buccal they need to be adjusted to decrease it. If the embrasures of the posterior teeth, and the inner portion of the appliance provides the portion that fl exes into the undercut can be retention, these sites should be reduced by the appliance itself or wires added to it. lightly running an acrylic bur over them. The appliance should have a similar degree When adjusting this, it is recommended that of retention as a removable partial denture. practitioners err on the side of reducing the The retention should not be so strong that it retention too little rather than too much and might cause the patient to break a fi ngernail, that these sites be repeatedly reduced until the but not so weak that he or she can dislodge proper retention is achieved. the appliance with the tongue. My personal preference is to have the Clinically it has been observed that patients appliance ’ s internal material engage the given appliances with insuffi cient retention undercuts rather than wires added to the report their TMD symptoms were aggravated appliance. by their appliances. It is speculated the symptom aggravation may be from patients holding their opposing teeth on the appliance Summary of Physical Variables to stabilize it or from playing with the loose appliance. It has also been observed that It is very rare that I recommend an appliance patients given appliances with insuffi cient other than a full- c overage stabilization retention report they unconsciously remove appliance, one that covers all of the teeth in them at night while they sleep. the arch. In deciding whether to recommend If the appliance does not have enough a maxillary or mandibular appliance, I fi rst retention, for appliances with wire retention, consider the propensity for the maxillary the wires need to be adjusted to further anterior teeth to fl are. If there is compromised engage the undercuts. For appliances without bone support of the maxillary anterior teeth wires and an internal surface that can bind or severe tooth attrition, I am afraid the with self - curing or light - curing acrylic, the maxillary anterior teeth may fl are, so I only internal surface needs to be relined. Relining recommend a maxillary appliance. If I plan the internal surface as described in “ I nternal for the patient to wear the appliance during Reline ” in this chapter generally provides an the day (usually for a few months) as a ideal amount of retention. temporary crutch until he or she breaks the C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 155 daytime habits, and there is a low propensity If the patient is a child with primary or for the maxillary anterior teeth to fl are, I mixed dentition, I try to obtain adequate generally recommend a mandibular appliance. symptom relief with nonappliance TMD Next I consider on which arch the appliance therapies recommended in this book. If I would provide the greatest occlusal stability. must use an appliance, I only use a soft Usually placing the appliance on the arch with stabilization appliance. I also provide soft the greatest number of missing teeth provides stabilization appliances for adults when they the greatest occlusal stability. Many TMD need one as an emergency appliance, as a patients have all of their teeth (except their prognostic tool, or as an interim appliance, or third molars), have good bone support of the if they need an appliance and their fi nancial maxillary anterior teeth,
have only minor tooth situation is an overwhelming concern. attrition, and will only wear the appliance at If I request the laboratory fabricate a hard night. I have no preference whether they or intermediate stabilization appliance, I ask receive a maxillary or mandibular appliance. I the laboratory technician to adjust the discuss the benefi ts of each and they may have articulator ’ s pin so the closest opposing a preference, especially if they previously had posterior tooth contact is 3 m m once the casts an appliance. From patients who have worn have been mounted. I also request the both appliances, I have not found a strong laboratory to fabricate the appliance so its tendency that patients prefer one over the retention is obtained by the appliance other appliance, except that mandibular engaging the buccal embrasures of the appliances tend to stimulate the gag refl ex less. posterior teeth. Next I consider whether the appliance should be made with hard, intermediate, or APPLIANCE ADJUSTMENTS soft material. If the patient has a history of continually fracturing or rapidly wearing his The stabilization adjustments are the most or her hard or intermediate appliance, I critical phase for providing an effective recommend one fabricated with Ivocap appliance.2 1 It is common for me to hear new material. If the patient has never worn an patients report they previously received an appliance and has severe tooth attrition, I also appliance that was too tight, causing them recommend an appliance fabricated with pain, so they stopped wearing it. Delivering a Ivocap material. well - adjusted appliance is challenging, and For the vast majority of my patients, I one fabricated entirely with acrylic takes me recommend an appliance fabricated with about 45 minutes to deliver. Impak material (comparable with Remedeze appliance). If the patient has moderate to FOCAL POINT severe tooth attrition, I request the majority of The stabilization adjustments are the most the appliance ’ s occluding surface be covered critical phase for providing an effective with acrylic, to resist appliance wear from appliance. heavy parafunctional activity (comparable with Bruxeze appliance). A fter completing my appliance adjustments, If the patient relates he or she is allergic to I ask the patient to insert the appliance, to tell methyl or ethyl methacrylate, I recommend an me whether the posterior occlusion is hitting appliance fabricated with a vinyl material; as evenly as possible, and to tell me whether common trade names are Valplast and Flexite he or she knows of anything that can be done appliances. to improve the appliance. Sometimes I am 156 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y unaware of a minor problem that may annoy these situations, the end of the mouth- m irror a patient (e.g., a rough spot on the lingual handle can be placed interproximally on the fl ange, a rough excursive movement, excessive edge of the appliance fl ange in an attempt to bulk, or a tendency for the appliance to cause forcibly work the appliance loose. gagging) and cause the patient to play with the annoyance, which could lead to TECHNICAL TIP aggravation of the TMD symptoms. Inserting an Appliance Occasionally patients report they As the appliance is initially inserted, do not use unconsciously remove their appliance during a tremendous amount of force or it may be sleep. It is my clinical experience that, in this diffi cult to remove. situation, the appliance appears to bother patients in some manner while they sleep and, If the appliance will not seat by using a once this problem is corrected, they usually moderate amount of force, ask the patient stop removing it. Four approaches have been where the appliance feels tight. Generally the found that commonly correct this problem: restriction is located along the anterior teeth, (1) tighten a loose appliance, (2) loosen a and my experience in this situation is that the tight appliance, (3) perfect the appliance’ s labial extension is often overextended. occlusion, or (4) thin a bulky appliance. Laboratory technicians fabricating appliances with hard inner surfaces (instructions are provided in appendix 8 , “ Laboratory Occlusal Internal Adjustments Appliance Instructions ” ) are instructed to extend the appliance only 1 to 1½ m m below The majority of new appliances with a hard the incisal edge of the anterior teeth. When inner surface that I receive from the the appliance is too tight over the anterior laboratory are too tight and need internal teeth and the labial extension is longer than adjustments. This section primarily pertains to requested, it is generally most productive to appliances fabricated with a hard inner fi rst shorten the extension to the requested surface, because clinical experience has shown length. that appliances with an intermediate or soft If the appliance is too tight for it to seat inner surface rarely need internal adjustments. and the labial extension is the correct length, Prior to attempting to insert an appliance in clinical experience has shown the best manner a patient ’ s mouth, ensure the appliance appears for marking tight internal areas is using appropriate and determine whether any Accufi lm (Parkell, Farmingdale, NY). Place a adjustments are indicated prior to insertion; piece of Accufi lm (the black color best marks e.g., whether it is overly bulky or whether there an appliance) between the appliance and the are sharp areas that could hurt the patient. teeth, in the area of the restriction, and fi rmly Also observe to ensure the appliance is not seat and remove the appliance (Figure 12.16 ). overextended beyond the most posterior teeth, unless this extension is to obtain the contact of TECHNICAL TIP a more posterior opposing tooth. Identifying Internal Tight Areas As the appliance is initially inserted, do The internal appliance locations that need to be not use a tremendous amount of force. relieved can be identifi ed by placing a piece of Occasionally my residents who would insert Accufi lm (the black color best marks an an appliance with too much force will have appliance) between the appliance and the teeth, great diffi culty or be unable to remove it. In and fi rmly seating and removing the appliance. C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 157 Figure 12.16. The black side of an Accufi lm sheet marks the heaviest internal contacts on an appliance. it is recommended that these fi ns also be reduced. This procedure may take repeated markings and adjustments. With a clear appliance, the practitioner can see whether the appliance is seated, and it is seated when there is no observable space between the appliance and the incisal edges or cusp tips. When adjusting the internal Accufi lm Figure 12.17 . Black Accufi lm marks on the markings, I tend to be fairly conservative in internal surface of an appliance. Note the interproximal fi ns of material that run faciolingual, the beginning and become more aggressive which fi ll in the occlusal and incisal embrasures with each successive adjustment. After fi ve to of the teeth. These can also restrict appliance ten adjustments, if the appliance does not seating. appear to be seating, I remove about 1/4 m m from the buccal and lingual surfaces, ensure The appliance ’ s retention is usually the appliance is not tight, and reline its provided by the portion of the appliance internal surface. This generally provides a that fi ts into the buccal embrasures, so at well - fi tting appliance more rapidly than fi rst attempt to remove the restriction by continuing to adjust the appliance. adjusting only nonretentive areas. In addition to adjusting the areas that mark with TECHNICAL TIP Accufi lm, there are often interproximal fi ns Adjusting Conservatively or of material that do not provide a benefi t Aggressively and can also restrict appliance seating. These When adjusting the internal Accufi lm markings, I fi ns run faciolingual as formed by the occlusal tend to be fairly conservative in the beginning or incisal embrasures of the teeth (Figure and become more aggressive with each 12.17 ). While adjusting the Accufi lm marks, successive adjustment. 158 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y Another common problem that occurs Once the appliance fi ts comfortably, check when attempting to seat a hard appliance fully its retention. The appliance should have a is that it rocks. In this situation, rock the similar degree of retention as a removable appliance back and forth to locate the partial denture. The retention should not be fulcrum. Place Accufi lm between the so strong that the patient has unwarranted appliance and the area of the fulcrum and diffi culty removing it, but be suffi cient so the apply fi rm pressure over the fulcrum to patient cannot dislodge it with the tongue. An create a defi nitive mark. Aggressively adjust appliance being too retentive is generally due the fulcrum area and err on the side of to it engaging the posterior undercuts too removing excess material. If several attempts deeply, and the depth of engagement should to remove the rock are unsuccessful, the be reduced. appliance ’ s internal surface can be relieved and relined. To do this, remove about TECHNICAL TIP 1/4 mm of acrylic from all surfaces (including Evaluating an Appliance’ s the occlusal or incisal surface) in the area of the rock, relieve retentive areas to ensure the Retention appliance is not tight, and reline its internal Once the appliance fi ts comfortably, check its surface. retention. The appliance should have a similar Once the appliance ’ s internal surface is degree of retention as a removable partial adjusted so the appliance fully seats, ask the denture. patient whether it feels too tight in the fully seated position. If it is too tight, mark the If the appliance does not have enough appliance with Accufi lm and adjust the retention, and the internal surface provides nonretentive surfaces accordingly. the retention and can bind with self - curing or Clinically it has been observed that the light - curing acrylic, reline the internal surface. anterior teeth cannot tolerate as much For appliances with wire retention, the wires pressure as the posterior teeth. If a patient is need to be adjusted to engage the undercuts unsure whether the pressure is excessive, I further. explain to the patient that an appliance is like a new pair of shoes: you will notice it is there, but over time (minutes to hours) the pressure Internal Reline sensation worsens if it is too tight. If the patient continues to be unsure, I often The appliance ’ s internal surface can be recommend the other appliance adjustments relined with self - curing or light - curing acrylic. be performed to give the patient more time to Self - curing acrylic has a bad taste, but I determine whether it is too tight. continue to teach this technique out of fear Accufi lm nicely marks hard and that the students may not have access to intermediate internal appliance surfaces where light - curing acrylic in their future dental a tooth fi rmly contacts the appliance, but it practices. When only part of the appliance will not mark soft internal appliance surfaces is being relined, it generally does not fully nor a soft - tissue impingement. For soft seat, creating a gap where the reline internal appliance surfaces, adjust the areas as material was not added (Figure 1 2.18) . the patient directs and, for discomfort from Therefore, I generally reline the entire internal the soft tissue, if needed, use pressure- surface so there are no internal gaps or indicator paste or spray. junctions. C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 159 Figure 12.18. This appliance lacked posterior retention, so acrylic was added to the
internal portion of its posterior area. The appliance was seated in the mouth, and the patient was asked to squeeze on the appliance to seat it further. Note the gap between the anterior teeth and the appliance due to the incomplete seating of the appliance. TECHNICAL TIP Relining the Internal Portion of an Appliance When relining the internal portion of an appliance, I generally reline the entire internal surface so there are no internal gaps or junctions. Prior to providing the internal reline, remove any Accufi lm marks on the internal surface; otherwise, the marks will be buried below the clear reline and may visually bother Figure 12.19. Internal appliance reline: moist the patient. It is recommended that the acrylic is added to the internal surface of the procedure be discussed and the mandibular appliance. manipulation demonstrated to patients so they will not be startled during the procedure and disrupt its progress. with a wooden tongue depressor. While To reline an appliance with self - curing mixing the acrylic, have the patient swish with acrylic, fi rst moisten the entire internal mouthwash to help lubricate the teeth and portion of the appliance with monomer desensitize the taste buds. (which makes the appliance’ s surface tacky) Put the acrylic into the appliance with the and shake out the excess. Pour approximately tongue depressor, ensuring that about 1 mm a teaspoon of powder in a paper cup, add a of the mixed acrylic covers all of the internal little more monomer than is required to surfaces, and scoop out the excess material moisten all of the powder granules, and mix with a gloved fi nger (Figure 12.19 ). Place the 160 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y appliance into the patient’ s mouth, Inserting and removing the appliance every manipulate the mandible to the position that 30 seconds appears to compress the acrylic in will be used to adjust the appliance, and ask the undercut areas properly so they are not the patient to squeeze the appliance into too deeply engaged. There appears to be a place. Using this mandibular position will critical time (approximately 3– 4 minutes into enhance the speed of adjusting the occlusal the procedure) in which the appliance portion of the appliance. suddenly takes a little more force to dislodge. Ask the patient to hold pressure on the I have had two incidents in which residents appliance for 1– 1 ½ minutes, during which a did not follow my instructions (e.g., “ I just periodontal probe can be used to remove the turned and did a little paperwork” ) , and the excess acrylic that has squeezed facially from appliance had to be removed in pieces. the appliance. If the buccal fl anges are short At the end of this procedure, patients of the undercuts, the fl anges will probably generally like to swish with mouthwash. Trim need to be extended to engage the undercuts, the reline material back to the original fl anges, so the excess acrylic should probably not be unless the buccal fl anges should be lengthened removed from these areas. Some practitioners (Figure 12.21 ). If lengthening the buccal wait and remove this excess with a pair of fl anges, trim and smooth the area, leaving scissors during one of the intermediate approximately 2 mm of material to engage occasions when the appliance is removed and the undercuts. Reevaluate the appliance ’ s the material has a rubber consistency. retention and make any adjustments that are At 1½ minutes after placing the appliance in needed. the mouth, dislodge it from the supporting The light - curing acrylic can be used to teeth (not from the mouth) and reinsert it. reline the appliance ’ s internal surface in a Continue this every 30 seconds until the acrylic similar manner. Once the light- c uring acrylic reaches its fi nal set (Figure 12.20 ). It has been has been added to the internal portion of the observed that the acrylic ’ s setting shrinkage will appliance and seated in the mouth, ask the usually cause the appliance to fi t too tightly if patient to squeeze the appliance into place one stops prior to the acrylic ’ s fi nal set. with the mandibular position that will be used Figure 12.20. Internal appliance reline: once the Figure 12.21. Internal appliance reline: excessive acrylic hardened, the appliance was removed from reline material is reduced and the edges mouth. smoothed. C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 161 to adjust the appliance. A periodontal probe appliance until it seats fully and comfortably. can be used to remove the excess acrylic that Accufi lm can be used to identify the areas of has facially expressed from the appliance. pressure or restriction. With the appliance seated, use the light Various techniques can be used to reline an wand intraorally to partially cure the acrylic appliance for a single tooth, and this is one of (for less than 1 minute). Remove the the few situations in which I perform a partial appliance, trim the excess acrylic, replace the appliance reline. It is important when appliance, and use the light wand to continue performing this reline that the added acrylic curing the acrylic. 54 Multiple partial curing does not keep the appliance from seating procedures followed by dislodging the fully. If this occurs, there will be a gap appliance may provide the best results. between the appliance’ s internal surface and Occasionally patients will need a restoration the adjacent teeth, and the appliance’ s placed on a tooth that is covered by an occlusion will have shifted. To prevent this, I occlusal appliance. Whenever a fi lling or often place a vent hole in the appliance and crown is placed on one of these teeth, the new mix the acrylic so it is a little more moist than restoration ’ s contours are different, which used in the previously discussed reline. generally keeps the appliance from seating fully. Clinical experience has shown that, if External Adjustments the patient had a small to medium- s ized fi lling placed, a few internal appliance If the appliance stimulates the gag refl ex, adjustments are often suffi cient to allow the reduce the appliance when adjusting the appliance to accommodate for the new internal surfaces. The degree of reduction is restoration, and suffi cient appliance - tooth balanced between making the appliance too contacts will remain so the tooth will not shift fragile and making it comfortable; it has to be under the appliance. acceptably comfortable or the patient will not If an appliance does not seat fully after the wear it. Clinical experience has shown that placement of a small to medium- s ized fi lling, mandibular appliances tend to stimulate the mark the appliance ’ s internal surface by gag refl ex less, but some patients suffer less attempting to seat the appliance with gagging with a maxillary appliance. Accufi lm between the new restoration and the Any lingual portion of the appliance has appliance. Aggressively remove the areas of been observed to elicit a patient ’ s gag refl ex. the appliance that were marked by the new Unless the patient directs certain areas be restoration and err on the side of removing reduced, it is recommended that the posterior too much acrylic. Generally, after a few lingual fl ange fi rst be thinned to 1/2 – 1 mm adjustments, the appliance can seat as it did thick. If this is not satisfactory, shorten the prior to the restoration. lingual fl ange as needed; I rarely have to If the patient had a crown or an extensive reduce it beyond the cervical margins of the fi lling placed, it is probably more effi cient to teeth. If necessary, cut the posterior lingual relieve and reline the internal portion of the portion so it overlaps the lingual cusps only appliance where the restoration is located. To by 1 mm and the anterior lingual fl ange to the do this, remove about 1/4 – 1/2 mm of acrylic cervical margins of the anterior teeth. from all aspects of the appliance where the Once the appliance fi ts comfortably and restoration may touch. Insert the appliance has appropriate retention, adjust its occlusion and, if the new restoration causes pressure on by using the traditional gnathologic principles or restricts seating of the appliance, relieve the used by dentists for many years. 162 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y TECHNICAL TIP while the patient seats the appliance) and, if Adjusting Appliance’ s Occlusion the cheek is caught during insertion, the Once the appliance fi ts comfortably and has practitioner would not be aware of this and appropriate retention, adjust its occlusion. continue to attempt to seat the appliance. Mark the opposing tooth contacts on the If a patient plans to wear an orthodontic appliance with two sheets of Accufi lm in retainer or partial denture opposing the the articulating forceps, using black to mark appliance, adjust the appliance with it in the centric contacts. Hold the forceps at a place. This ensures the appliance will not slight angle in the mouth so the patient can occlude too hard on the retainer or denture. mark the third molar as well as the central The appliance ’ s occlusal surface should be incisor at the same time (Figure 1 2.22) . It has fl at so the anterior teeth can slide smoothly been observed that, if the anterior teeth are along the appliance surface from the centric marked independently (Figure 1 2.23) , patients position and provide immediate disocclusion tend to protrude the mandible for these of the posterior teeth. 6,11 If the occlusal surface markings. has cuspal indentations, as the mandible With the mandible in the desired position begins to move excursively, the cusp tip may (neutral position or centric relation, as bump the indentation ’ s edge, disrupting this discussed in “ M andibular Positions and smooth fl ow. Therefore, the laboratory Interocclusal Record ” in this chapter) and the technician should not leave indentations and, Accufi lm in place, ask the patient to tap on if they are present, remove them as the the appliance. As the patient does so, ensure appliance ’ s occlusal surface is adjusted. the patient does not deviate from his or her Instruct the patient to insert and remove normal closing arch. Some patients shift their the appliance for each adjustment. This mandible to the side that is being marked. If ensures the patient can insert the appliance, this occurs, request the patient to “ t ap straight ensures the appliance does not have too much up and down with your jaw in the center. ” If retention, frees the practitioner to do other the patient cannot stop shifting the mandible, things (e.g., pick up the articulating forceps simultaneously place Accufi lm on both sides Figure 12.22. Accufi lm held in this position can mark contacts from central incisors to third molars. C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 163 Figure 12.23. It is recommended that Accufi lm never be held in this position because patients tends to protrude the mandible in this situation. of the appliance, which usually eliminates this from each posterior tooth should evenly problem. It is also important that the patient occlude with the appliance, unless the tooth is does not have his or her head tilted to the side malposed, e.g., not within the arch’ s occlusal when the appliance is marked; this causes plane, and does not occlude with the the mandible to shift to the side, and the opposing dentition. The centric marks from markings will also be incorrectly positioned. the anterior teeth should
be light or none in It is important to realize that only the comparison with the posterior marks.1 The supporting cusps provide the centric contacts canine marks may be in harmony with the from the opposing posterior teeth. Therefore, marks from the anterior or posterior teeth. the maxillary appliance occludes with the The appliance should allow the patient to mandibular buccal cusps, whereas the slide into excursive positions easily. Therefore, mandibular appliance occludes with the adjust the appliance so it has minimal maxillary lingual cusps. The nonsupporting disocclusion of the posterior teeth. 8,55 For cusps never touch the appliance, except when effi ciency, as I adjust the anterior centric a tooth is rotated to the degree that the contacts, I generally also adjust the angle of supporting cusp cannot harmoniously occlude the anterior guidance ramp so it is only about with the appliance, in which case one can 5 ° steeper than the appliance ’ s occlusal plane attempt to occlude the nonsupporting cusp (Figure 12.10 ). with the appliance. To enhance the appliance adjustment, TECHNICAL TIP adjust the centric marks with the acrylic bur’ s Occluding Cusps fl at side rather than its point (Figures 12.24 Only supporting cusps provide an appliance ’ s and 12.25 ). This helps to provide a fl at centric contacts. Therefore, the maxillary occlusal surface and reduces the probability of appliance occludes with the mandibular buccal posterior excursive interferences. cusps, whereas the mandibular appliance As the practitioner repeatedly marks and occludes with the maxillary lingual cusps. adjusts the appliance, he or she should slowly develop even, centric marks from the As the appliance is being adjusted, opposing posterior teeth. At least one contact periodically observe the distance the various Figure 12.24. If an appliance is adjusted with the fl at side of an acrylic bur, the adjustment tends also to remove potential excursive contacts, increasing the speed with which the practitioner can perform the adjustment. Figure 12.25. If an appliance is adjusted with the point of an acrylic bur, the adjustment tends to leave areas that will be excursive interferences that will need to be removed later. 164 C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 165 cusp tips are from occluding with the ask the patient to close on the appliance appliance. If most of the cusp tips are a (without Accufi lm in the mouth) and to say signifi cant distance from occluding, it may be whether the left or right side hits fi rst or faster to reline the entire occlusal surface than harder. Adjust the appliance so the patient removing acrylic to obtain the desired feels that both sides hit evenly and each side occlusion. If all of the cusp tips except one or of the appliance has marks of equal intensity two are hitting evenly on the appliance, and independent of the other side. the cusp tips are 1/2 mm or more from Since crowns supported by dental implants occluding with the appliance, it may be faster do not have periodontal ligaments, they do to add acrylic to that portion of the appliance. not compress when patients clench on them. Occasionally a cusp tip is buccal or lingual to To ensure these crowns are not overloaded the appliance ’ s occlusal surface, and the against the appliance, adjust the opposing occlusal surface needs to be extended. Adding appliance so anterior teeth supported by acrylic to an appliance ’ s external surface is dental implants are just out of occlusion and discussed in the next section, “ External Reline. ” posterior teeth supported by dental implants The amount of acrylic to remove with each produce signifi cantly lighter marks on the adjustment varies with how much each contact appliance. If the implant is a single tooth, the should be reduced. This changes with the practitioner may make the contact so it is just number of centric marks obtained and how far out of occlusion, because there is no fear that the other cusp tips are from occluding with the these teeth will extrude.5 6 Ask and follow the appliance. If only one or two contacts are patient ’ s wishes as to whether the occlusion marking the appliance and the other cusp tips on the implant needs to be relieved further. are a suffi cient distance from marking, reduce Occasionally patients cannot repeatedly each mark several times the amount that it close to the same position on the appliance, takes to remove the mark; this more rapidly even though the practitioner uses the allows the other cusp tips to come into mandibular positioning technique previously contact. When most of the cusp tips are described. In this situation, I adjust the marking and the other cusp tips are close to appliance to the degree I am able, allow the marking, I usually grind just enough to remove patient to use the appliance, and, when the each mark plus a little extra on the heavier patient returns, he or she can generally marks. When all of the desired cusp tips are provide repeatable centric contacts. marking and the practitioner is attempting to Once the desired centric contacts are create uniform centric marks, he or she should obtained (Figure 1 2.26) , begin adjusting the lighten the heavier marks by only about 50%. excursive movements. First observe the With experience, these various degrees of distance the posterior teeth separate as the adjustments become second nature. patient slides the mandible into the excursive Occasionally patients have less biting positions. This gives a feel for how much and strength on one side of their mouth and in which direction(s) the anterior guidance consistently tap lighter on that side. As the needs to be lowered. practitioner attempts to develop uniform Place two sheets of red Accufi lm in the bilateral marks of equal intensity, generally the patient ’ s mouth as previously described and appliance is inadvertently adjusted so the ask the patient to grind his or her teeth side weaker side hits harder than the stronger side. to side and forward and backward; do this for Therefore, as adjusting the appliance for both sides of the mouth. Then place the black centric contacts nears completion, periodically Accufi lm in the patient ’ s mouth and ask the 166 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y guidance provided only by the canines, which is also an acceptable technique.4 If it is planned for the patient to wear the appliance during the day, after the appliance is adjusted in the reclined position, reposition the dental chair into the sitting position and ask the patient to sit with feet to the side so they are on the fl oor. Adjust the appliance in this position because it simulates the patient’ s normal upright position. Adjusting the appliance in this position generally takes only a few additional adjustments. TECHNICAL TIP Figure 12.26. Accufi lm marks of centric contacts Adjusting Appliance for on adjusted appliance. Daytime Wear If it is planned for a patient to wear an appliance during the day, after the appliance is adjusted in the reclined position, reposition the dental chair into the sitting position, ask the patient to sit with feet to the side, and adjust the appliance with the patient in this sitting position. Clinical experience has demonstrated the appliance ’ s occlusion should be well adjusted to provide its maximal effect.2 1 Patients referred to me with a poorly adjusted appliance sometimes obtain considerable symptom improvement after having the Figure 12.27. Red Accufi lm marks of excursive contacts and black Accufi lm marks of centric appliance ’ s occlusion improved. contacts on adjusted appliance. Sometimes the appliance is perforated during adjustments. These perforations are patient to tap on the appliance to re- m ark the generally over the cusp tips of teeth centric contacts. This provides the appliance underlying the appliance, so perforations with black centric contacts on top of the red would rarely compromise its ability to support excursive marks. the occlusal contacts of the opposing teeth Repeatedly adjust the posterior portion of and would not have a detrimental effect on its the appliance so no red posterior excursive effi cacy. If I perforate the appliance, I always marks are produced and the anterior portion show the perforations to the patient, who of the appliance so the amount of separation otherwise may think the appliance is breaking. between the closest posterior contact and the Once I explain that the perforations are not a appliance is only 1/2 – 1 mm.8 ,55 I prefer to have concern and the appliance would need to be the anterior guidance distributed among as thicker for it to not have them, I have never many anterior teeth as possible (Figure 12.27 ). had a patient request the appliance be Some practitioners prefer to have the anterior thickened to eliminate them. C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 167 TECHNICAL TIP Patients who will wear a maxillary Observing Perforations appliance during the day generally prefer Appliance perforations are generally over the shorter lingual fl anges that are no thicker than 1 mm.1 1 cusp tips of teeth underlying the appliance, so For most patients to obtain perforations would rarely compromise the immediate disocclusion of the posterior teeth, appliance ’ s ability to support the occlusal a guidance ramp generally needs to extend contacts of the opposing teeth and would not lingual to the maxillary anterior teeth. Patients have a detrimental effect on the appliance’ s usually prefer the area gingival to this ramp effi cacy. to be concave, so the appliance ’ s bulk is minimized. Once the appliance ’ s occlusion is adjusted After my appliance adjustments are and the markings demonstrate the portion of completed, I ask the patient to insert the the occlusal surface that is needed to support appliance, to tell me whether the posterior the opposing teeth, contour the sides of the occlusion hits as evenly as possible, and to tell appliance. Clinically most patients appear to me whether he or she knows of anything that need only about 7 m m for anterior guidance, I can do to improve the appliance. Sometimes so any unnecessary portion of the guidance a minor problem may annoy a patient (e.g., ramp can be removed. Clinically most patients a rough spot on the lingual fl ange, a rough appear to prefer to have the appliance’ s excursive movement, excessive bulk, or a occlusal surface line angles rounded so they tendency for the appliance to cause gagging) have a similar occlusogingival curvature to the and cause the patient to play with the teeth they cover. In some cases, an occlusal annoyance, which could lead to aggravation of contact may be near the appliance’ s line angle, the TMD symptoms. so this portion of the appliance may be able Clinical experience has shown that it is not to have only minimal contouring. necessary to provide the patient with a highly Thin the fl anges and the portions that polished occlusal appliance. For appliances overlay the side of the teeth so they are with an outer acrylic surface, smooth the approximately 1 mm thick. If the appliance fl anges and along the occlusal surface edges will be worn only at night, one may desire to with coarse pumice. I do not pumice the leave these thicker so there is less chance of occlusal portion where the opposing teeth fracturing the appliance. The external surface mark, for fear that this may disrupt the needs to fl ow smoothly and have a relatively occlusal patterns. I have found there is no smooth surface; otherwise, patients tend to need to pumice with fi ner polishing agents play with areas of disharmony, which may and have never had a patient request that the cause an increase in TMD symptoms. appliance ’ s surface be more highly polished. If the appliance
will be worn during the day, patients generally prefer a mandibular appliance with the lingual surface as thin as External Reline possible. Make the entire lingual surface of the mandibular appliance 1 m m thick and There are numerous reasons for adding clear carry the fl ange below the tongue ’ s resting acrylic to the external surface of an appliance, position so patients do not continually rub and it is most commonly done when a across its border as they speak. If a patient has practitioner is inserting an appliance. For mandibular tori, trim the lingual fl ange so it instance, while adjusting the appliance, the blends into the superior portion of the tori. practitioner may observe that all of the cusp 168 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y tips except one or two occlude evenly on the wear thin, and the patient may periodically appliance and the nonmarking cusp tips are return to have acrylic added to the entire 1/2 mm or more from occluding with it. In occlusal surface. this situation, it is generally faster to add The reline technique is similar for each of acrylic to the nonmarking portion of the these situations and can be performed with appliance rather than thin the appliance until either self - curing or light - curing material. For all of the cusp tips eventually occlude. simplicity, the self - curing technique is A second situation can occur after an explained, but can be similarly used with the appliance is seated and the practitioner light - curing material. observes the occlusion with the opposing arch Begin by removing any marks on the surface is quite different than the occlusion that was that will be covered by acrylic; moisten the fabricated for the appliance. This discrepancy area with monomer and shake off the excess. could be due to an interocclusal record error, For one or two cusp tips (Figure 12.28 ), only a laboratory technician error, or the variability drop of monomer may be necessary. Pour the with neutral position. 57,58 The practitioner estimated needed acrylic powder into a paper may prefer to add acrylic to the entire occlusal cup, add only enough monomer to moisten all surface because the appliance may not be of the powder granules, and mix with a thick enough to accommodate the large wooden tongue depressor. occlusal discrepancy and the practitioner If adding acrylic only so one or two would probably fi nd it faster. In this situation, nonmarking cusp tips occlude with the I generally mark and aggressively adjust the appliance, place a piece of acrylic about 5 m m appliance contacts several times to minimize in diameter and 3 m m high onto the desired the amount of acrylic that will need to be location(s) (Figure 1 2.29) . If desired, the added to the occlusal surface. buccal portion of the appliance may be marked with a pencil to delineate the location QUICK CONSULT where the acrylic is to be added. Wait until Avoid Interocclusal Record Errors the acrylic fi rms to the consistency of clay To avoid interocclusal record errors, ensure the before placing the appliance into the mouth. patient ’ s head is maximally rotated back, tongue Sometimes, while waiting, the acrylic slumps is on the roof of the mouth and as posterior as possible, and the wax is dead soft. Some practitioners routinely intraorally add acrylic to the entire occlusal surface of certain appliances. This is most commonly done when fabricating an appliance by using a 2 - mm hard thermoplastic shell molded over the patient ’ s cast in which the occlusal contacts are obtained by adding acrylic to the appliance ’ s occlusal surface.4 An example of this appliance is presented in “ Hard Thermoplastic Stabilization Appliance ” in this chapter. The entire occlusal surface may also need to Figure 12.28. Adding single contact to an be relined for patients who heavily grind on appliance, which is missing a contact mark from their appliance at night. The appliance may the right fi rst premolar. C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 169 Figure 12.29. Adding single contact to an Figure 12.31. Adding single contact to an appliance: acrylic in clay consistency. appliance: contact added to an appliance. Figure 12.30. Adding single contact to an appliance: hardened acrylic removed from a patient ’ s mouth. Figure 12.32. Adding acrylic to an anterior or fl ows and needs to be remolded. Once the appliance segment: hardened acrylic removed from appliance is in the mouth, manipulate the a patient ’ s mouth. mandible to the position used to adjust the appliance and ask the patient to close and tap by about 50%, the Accufi lm mark(s) on the onto the appliance (similar to tapping on added acrylic will be very close to the other Accufi lm). Some patients tend not to close marks on the appliance (Figure 1 2.31) . A fully onto the appliance, resulting in the larger portion of the occlusal surface can be added acrylic being too thick. relined in a similar fashion (Figure 12.32 ). Remove the appliance and place it in warm If acrylic is to be added to the entire water so the acrylic will cure faster. A few occlusal surface, dampen the area with patients wish to rinse their mouth with monomer, place the acrylic with a tongue mouthwash at this time. Once the acrylic is depressor, and mold it with gloved fi ngers. As hard (Figure 12.30 ), mark the cuspal with the other techniques, wait for the acrylic indentation depth(s) with a pencil and use the to fi rm into the clay consistency before fl at side of the acrylic bur to reduce the added placing the appliance into the patient’ s acrylic. It has been observed that, if the acrylic mouth. The acrylic may tend to fl ow into the is reduced so the pencil mark(s) are lightened internal area of the appliance, so the appliance 170 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y is generally held with the occlusal surface toward the fl oor and the new acrylic is remolded as needed. Once the acrylic is the consistency of clay, place the appliance in the mouth, manipulate the mandible to the position where the appliance will be adjusted, and ask the patient to close slowly onto the soft acrylic. As the patient closes, observe whether the soft acrylic needs to be repositioned. If so, ask the patient to open while the soft acrylic is shaped into the proper position. Again manipulate the mandible and ask the patient to close slowly into the soft Figure 12.34. Adding acrylic to entire occlusal acrylic and to stop when the jaw is at the surface: cusp depths marked with pencil. desired vertical dimension. The appliance is removed, placed in warm water to speed the curing process, and/or placed in a pressure- c uring unit to decrease the added acrylic’ s porosity. Many patients wish to rinse their mouth with mouthwash at this time. Once the acrylic is hard (Figure 12.33 ), mark the cuspal depths with a pencil (Figure 12.34 ) and use the fl at side of the acrylic bur to reduce the added acrylic so that all of the indentations are removed and the pencil marks are lightened. The external surface of the appliance is adjusted as Figure 12.35. Adding acrylic to entire occlusal previously described (Figures 12.35 – 12.37 ). surface: Accufi lm marks of centric contacts on an Adding acrylic to the occlusal surface adjusted appliance. sometimes causes undesirable concavities along Figure 12.36. Adding acrylic to entire occlusal surface: red Accufi lm marks of excursive contacts Figure 12.33. Adding acrylic to entire occlusal and black Accufi lm marks of centric contacts on an surface: acrylic in clay consistency. adjusted appliance. C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 171 Figure 12.37. Adding acrylic to entire occlusal surface: relined appliance in mouth. the side of the appliance. These are easily fi lled I prefer to repair broken occlusal appliances by moistening the area with monomer and directly in the mouth, because it is relatively similarly mixing the acrylic, placing it in the quick and the patient does not have to be concavity, and contouring it with a gloved without the appliance. My experience is that fi nger. A smooth fi nish can be achieved by repairs of acrylic appliances do not tend to applying a little monomer over the surface and refracture in the location they previously broke, further smoothing with a gloved fi nger. but the appliances made with the 2 - mm thermoplastic material tend to refracture at that Appliance Repair location. For this reason, I have not attempted to repair appliances made of the dual laminate Fractured occlusal appliances made with thermoplastic material, and I do not know of a acrylic can be repaired by the laboratory. If no technique to repair soft thermoplastic portion of the appliance is missing and the appliances. Therefore, this appliance - repair fractured pieces can be aligned by hand, the discussion is limited to the acrylic and hybrid appliance can be given to the laboratory in intermediate material appliances. this state for repair. If a portion of the appliance is missing and the practitioner wants QUICK CONSULT the laboratory to fi x it, the appliance needs to Repairing Broken Appliances be seated on the teeth and an impression I prefer to repair broken occlusal appliances made over it. The stone cast is poured with directly in the mouth, because it is relatively the appliance seated in the impression quick and the patient does not have to be material. If the opposing dentition occludes without his or her appliance. with the missing piece, the practitioner may want the laboratory also to adjust the Occasionally patients develop a hairline occlusion with the added section. This would fracture extending along an appliance ’ s require that the practitioner also make an occlusal surface. It is speculated that these impression of the opposing teeth and provide cracks usually occur as a result of the occlusal a means to mount the opposing cast with the surface not being thick enough to withstand appliance (an interocclusal record between the the patient ’ s heavy clenching activity. appliance and the opposing teeth). Therefore, it is recommended that the fracture 172 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y be repaired and the occlusal surface thickened beveled edges for the acrylic. The halves are simultaneously. I prefer to seal the crack by removed, and the beveled edges are moistened fl owing clear acrylic into the hairline fracture, with monomer. Pour the estimated needed which requires opening the fracture to provide acrylic powder into a paper cup, add only a space for the acrylic. Open the hairline enough monomer to moisten all of the fracture with a bur (e.g., a number 330 bur). powder granules, and mix with a wooden If the appliance is suffi ciently thick along the tongue depressor. Independently place acrylic fractured area, provide a slight bevel to the on the beveled edges of each half, place both external margins of the cut made. Then reline halves onto the teeth, and press the soft the entire occlusal surface of the appliance as acrylic to join the two portions. If necessary, a described in the previous section (“ E xternal gloved fi nger can be used to add acrylic to Reline ” ) so an additional 1 – 2 mm of acrylic is overbulk the area slightly (Figure 12.39 ). added over this area. This simultaneously seals the hairline
fracture and thickens the appliance ’ s occlusal surface. The most common occlusal appliance fracture I see is the appliance that has broken into two pieces with the fracture in the anterior region. In this situation, increase the cross - sectional area of the fractured surface and provide approximately 1 mm of space between the two halves by slightly overbeveling the internal and external edges of the fracture (Figure 12.38 ). After beveling the edges, insert both halves onto the teeth to ensure both halves fi t Figure 12.38. Intraoral appliance repair: fractured properly and there is a space between the edges are beveled. Figure 12.39. Intraoral appliance repair: added acrylic hardening in the mouth. C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 173 A portion of the acrylic often fl ows or is missing and have the patient close the pressed into an interproximal undercut. opposing teeth into it. Check to ensure Therefore, the appliance needs to be raised off the added acrylic is thick enough that the the supporting teeth periodically or the acrylic supporting cups of the opposing teeth occlude residing in the undercut will harden and may into it. not allow the appliance to be removed. Approximately 2 – 3 minutes after adding Approximately 2 – 3 minutes after placing the acrylic to the appliance, carefully dislodge two halves in the mouth, raise the fractured it so the added acrylic does not lock the portion of the appliance off the teeth (not appliance into the undercuts. Reinsert the from the mouth) and reinsert the appliance. appliance and continue this every 30 seconds Continue this every 30 seconds until the until the acrylic reaches its fi nal set. Remove acrylic reaches its fi nal set. Then remove the appliance and trim the acrylic to the the appliance, trim the added acrylic to the desired shape. If the missing portion occludes desired shape, and polish the appliance with the opposing teeth, mark the cuspal (Figure 12.40 ). depths with a pencil, use the fl at side of the Occasionally patients have a portion of acrylic bur to reduce the added acrylic so the their appliance missing, such as one of my pencil marks are lightened by about 50%, and patients who related her dog got ahold of her adjust the appliance’ s occlusion in the usual appliance. After inserting the appliance to manner. ensure it fi ts properly, bevel the fracture ’ s If there does not appear to be a cause for external edge to increase its cross- s ectional the appliance breaking (e.g., a dog chewing area. Moisten the beveled edge with it), the occlusal surface may be too thin for monomer, similarly mix acrylic in a paper the patient ’ s heavy clenching activity and cup, and place the appliance onto the the occlusal surface may also need to be patient’ s teeth (without acrylic on it). As the thickened. The entire occlusal surface can be mixed acrylic loses its sheen, apply the acrylic thickened in combination with replacing the with a gloved fi nger to the area where it is missing portion of the appliance. Figure 12.40. Intraoral appliance repair: repaired appliance. 174 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y QUICK CONSULT pressure - cured appliance is more resistant to Observing Broken Appliances attrition than one that has been bench cured.3 4 If there does not appear to be a cause for the appliance breaking, the occlusal surface may be The pressure - cured appliance is more work too thin for the patient’ s heavy clenching activity for the laboratory, so the fee is generally and the occlusal surface may also need to be higher. For this appliance, the practitioner thickened. makes impressions of the maxillary and mandibular teeth and the desired interocclusal record. The casts are mounted on an If the appliance is fractured in addition to articulator with the interocclusal record missing a piece, the practitioner may desire to (Figure 12.41 ), and the desired areas are separate these into two procedures, repairing blocked out on the arch for which the the fracture fi rst and then replacing the appliance will be fabricated. (For details, see missing portion. If multiple steps will be appendix 8 , “ Laboratory Occlusal Appliance needed to repair an appliance, there comes a Instructions. ” ) I generally request the point at which it would be better to fabricate laboratory block out the deep grooves on the a new one. teeth and all undercuts except the buccal embrasures of posterior teeth (Figure 1 2.42) . This leaves the buccal undercuts of the APPLIANCE EXAMPLES posterior teeth open, which provides an appliance that engages into these undercuts, The following examples are provided to help thereby supplying retention to this area. readers better apply the principles discussed Using the mounted blocked - out cast and for stabilization appliances. These examples the opposing cast, a new registration relating were chosen because of the various procedures these casts is made. The blocked - out cast is they demonstrate, rather than recommending duplicated and mounted on the articulator by any certain appliance form or technique. using the new registration (Figure 12.43 ). The These procedures can be used in many appliance is waxed onto the duplicate cast, combinations to fabricate various appliances. and the wax pattern on the cast is placed in a The fi rst three examples are hard fl ask (Figures 12.44 and 12.45 ). In Figure appliances, the next two examples are 12.44 , note that an anterior guidance ramp intermediate appliances, and the fi nal example extends anteriorly from the mandibular is a soft appliance. In appendix 8 , “ Laboratory Occlusal Appliance Instructions, ” are fabrication guidelines for the laboratory technician. Pressure - Cured Mandibular Acrylic Stabilization Appliance Many techniques can be employed to fabricate an acrylic stabilization appliance, and the appliance ’ s attrition rate will vary with the selected acrylic and processing method. 34 Figure 12.41. Pressure -c ured mandibular acrylic When the same acrylic is used, a stabilization appliance: casts mounted. C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 175 Figure 12.45. Pressure -c ured mandibular acrylic stabilization appliance: wax pattern placed in a Figure 12.42. Pressure - cured mandibular acrylic fl ask. stabilization appliance: blockout placed on mandibular cast. Figure 12.46. Pressure -c ured mandibular acrylic Figure 12.43. Pressure - cured mandibular stabilization appliance: adjusted on articulator. acrylic stabilization appliance: duplicated cast of blocked- out model mounted with new registration. anterior teeth, enabling the appliance to provide immediate disocclusion of the posterior teeth. In Figure 1 2.45, note that the guidance ramp ’ s guidance is only about 5 ° steeper than the posterior occlusal plane. This shallow guidance angle will minimize the resistance encountered when the patient attempts to move the mandible in an excursive direction.8 Once the appliance is cured, it is removed from the fl ask. The original master cast is replaced on the articulator, and the appliance is seated on this cast. The occlusion is marked Figure 12.44. Pressure - cured mandibular acrylic and adjusted, and the appliance is polished stabilization appliance: waxed appliance. (Figures 12.46 – 12.48 ). In Figures 12.47 and 176 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y Figure 12.47. Pressure - cured mandibular acrylic stabilization appliance: completed. Figure 12.49. Pressure -c ured mandibular acrylic stabilization appliance: centric contact Accufi lm marks on adjusted appliance; it is a little heavy on the one second molar, but this will be lightened when adjusting the excursive movements. is adjusted, as explained in “ I nternal Adjustments ” in this chapter. Once the appliance fi ts comfortably, the mandible is manipulated into the desired position, and the occlusion of the appliance is adjusted. It is recommended that two sheets of black Accufi lm be placed in an articulating forceps to mark the centric contacts (discussed in “ External Adjustments ” in this chapter). Repeatedly mark and adjust the appliance so as to obtain at least one centric mark from each posterior tooth and Figure 12.48. Pressure - cured mandibular acrylic stabilization appliance: note the thickness of buccal light to no marks from the anterior teeth in and lingual fl anges, and the acrylic thickness lingual comparison with the posterior marks. The to the anterior teeth. canine marks may be in harmony with the marks from the anterior or posterior teeth (Figure 12.49 ). 12.48 , note that the entire facial and lingual While adjusting the centric contacts, portions of the appliance and the acrylic practitioners may fi nd it necessary or more lingual to the anterior teeth are approximately expedient to reline a portion of the occlusal 1 mm thick. surface (discussed in “ E xternal Reline” in this The appliance is inserted in the patient ’ s chapter). As the centric contact adjustments mouth. If the appliance cannot fully seat with near completion, periodically ask the patient a moderate amount of force or causes an to close on the appliance (without Accufi lm uncomfortable pressure, its internal surface in the mouth) and tell whether the right or C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 177 left side hits fi rst or harder. Adjust the and the forces along the guidance ramp are appliance so the patient feels that both sides distributed as evenly as possible among the hit evenly and each side of the appliance has anterior teeth (Figure 1 2.50) , as demonstrated uniform centric marks independent of the in Figures 12.51 – 12.54 . other side. If the appliance is to be worn during the Once the desired centric contacts are day, also adjust the appliance with the patient obtained, adjust the appliance so the patient in an upright position. Reposition the dental can slide easily into excursive positions, chair into the sitting position and ask the disoccluding the posterior teeth with the patient to sit with feet to the side so they are closest posterior contact being 1/2 – 1 mm from on the fl oor. Mark and adjust the appliance the appliance. To obtain a feel for how much and in which direction(s) the anterior guidance ramp will need to be adjusted, fi rst observe the distance the posterior teeth separate as the patient slides the mandible into these excursive positions. Using two sheets of red Accufi lm, mark the appliance in excursive positions. Ask the patient to grind the teeth side to side and forward and backward on the red Accufi lm. Then ask the patient to tap in the centric position on black Accufi lm to provide the appliance with black centric contact marks on top of the red excursive marks. Adjust the posterior portion of the appliance so no red posterior excursive marks are produced. Adjust the anterior guidance Figure 12.50. Pressure -c ured mandibular acrylic ramp so that, when the patient is in the stabilization appliance: red Accufi lm marks of excursive positions, the closest posterior excursive contacts and black Accufi lm marks of contact is only 1/2– 1 m m from the appliance centric contacts on the adjusted appliance. Figure 12.51. Patient occluding on appliance in the neutral position. Figure 12.52. Patient occluding on appliance in right lateral: note the minimal disocclusion of the posterior teeth. Figure 12.53. Patient occluding on appliance in left lateral: note the minimal disocclusion of the posterior teeth. Figure 12.54. Patient occluding on appliance in protrusive: note the minimal disocclusion of the posterior teeth. 178 C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N
C E 179 using the same criteria; this generally takes For the fabrication of this appliance, make only a few additional adjustments. impressions of the maxillary and mandibular Once the appliance ’ s occlusion is adjusted, teeth and an interocclusal record. Once the contour the sides of the appliance. Patients laboratory has fabricated the maxillary acrylic generally appear not to need more than stabilization appliance, attempt to insert it 7 mm for their anterior guidance, so remove into the patient ’ s mouth with a moderate any unnecessary portion of the guidance amount of force. If the appliance does not ramp. Most patients also seem to prefer to seat fully or causes an uncomfortable pressure, have the line angles of the occlusal surface then its internal surface needs to be adjusted. rounded and the buccal and lingual After the appliance seats fully and fi ts occlusogingival curvature similar to the tooth comfortably, the mandible is manipulated into that it covers. the desired position and the appliance’ s If any portion of the appliance ’ s sides are occlusion is adjusted. Using two sheets of thicker than 1 m m, consider thinning these black Accufi lm, mark the centric contacts, areas, especially if the patient plans to wear repeatedly adjusting the marks so at least one the appliance during the day. Thinner fl anges centric mark from each posterior tooth and make the appliance feel less obtrusive and light to no marks from the anterior teeth are enable the patient to speak better when obtained. The canine marks may be in wearing the appliance. harmony with the anterior or posterior marks Once the appliance is adjusted satisfactorily, (Figure 12.26 ). ask the patient to insert it. Inform the patient While adjusting the occlusion, practitioners that it will be smoothed further, but that you may fi nd it necessary or more expedient to want to ensure that the posterior teeth hit the reline a portion of the occlusal surface. While appliance as evenly as possible and determine obtaining the desired centric contacts, whether the patient knows of anything that periodically ask the patient to close on the can be done to make the appliance more appliance and to say whether the left or right comfortable. Once the appliance meets with side hits fi rst or harder. Adjust the appliance the patient ’ s approval, smooth its sides and so the patient feels that both sides hit evenly ask whether it feels satisfactorily smooth. and each side of the appliance has uniform centric marks independent of the other side. After obtaining the desired centric contacts, Maxillary Acrylic Stabilization Appliance adjust the excursive movement. The appliance should allow the patient to easily slide the The principles for the maxillary appliance are mandible into the excursive positions, almost identical to those for the mandibular disoccluding the posterior teeth with the appliance. There are two prominent closest posterior contact being 1/2 – 1 mm from differences: (1) the excursive movements are the appliance. Prior to initiating the excursive in the opposite directions on the appliance, so movement adjustments, observe the distance the anterior guidance ramp will be lingual to the posterior teeth separate as the patient the anterior teeth; and (2) the opposing slides the mandible into these positions. This supporting cusps that provide the appliance’ s provides an estimate of how much the posterior centric contacts are the maxillary anterior guidance ramp will need to be lingual cusps for the mandibular appliance, adjusted in each direction. whereas they are the mandibular buccal cusps Mark the excursive movements with two for the maxillary appliance. sheets of red Accufi lm and ask the patient to 180 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y grind the teeth side to side and forward and comfortable. Once the appliance meets with backward on the Accufi lm. Using black the patient ’ s approval, smooth its sides and Accufi lm, ask the patient to tap in the centric ask the patient whether it feels smooth position to provide the appliance with black enough. centric contact marks on top of the red excursive marks. The posterior portion of the appliance is Hard Thermoplastic Stabilization adjusted so no red marks are produced with Appliance excursive movements. The anterior guidance ramp is adjusted so the closest posterior Hard thermoplastic materials are available in contact is only 1/2– 1 m m from the appliance a large variety of thicknesses. Those that have when the patient is in excursive positions a thickness of 1 mm or less will fl ex around and the forces along the guidance ramp are the convexities of the teeth and are often distributed as evenly as possible among the used to form bleaching trays, trays used in anterior teeth (Figures 12.51 – 12.54 ). fabricating temporary crowns, etc. Those Sometimes I plan for a patient to wear the that have a thickness of 2 mm or more are maxillary appliance occasionally during the comparatively rigid and used to form items day, e.g., when driving or using the computer. such as custom impression trays and If the appliance is to be worn during the day, orthodontic retainers. also adjust it while the patient is in an upright The 2 - mm material is typically used to position. Reposition the dental chair into the fabricate occlusal appliances. 4 The 1 - mm sitting position, ask the patient to sit with feet material appears to be too fragile for long- to the side so they are on the fl oor, and adjust term appliance use, and material greater than the appliance by using the same criteria. 2 mm provides unnecessary bulk for the Contour the appliance after its occlusion is appliance. adjusted. Patients generally do not need more I use the following 2 - mm hard than 7 mm of anterior guidance, so remove thermoplastic appliance when an appliance is any unnecessary portion of the ramp. Patients desired for the patient to wear during the day prefer to have shorter and thinner lingual that is very esthetic and has minimal effect on fl anges, 11 so consider thinning any portion of speech. It is preferred that patients learn to the appliance ’ s sides that are thicker than break their daytime habits rather than rely on 1 mm, especially if the patient plans to wear wearing this appliance to relieve their TMD the appliance during the day. To minimize symptoms. Clinically it is observed that some unnecessary acrylic, create a smooth - fl owing patients who are initially provided this concavity gingival to the guidance ramp. appliance for daytime wear become Contour the appliance’ s occlusal surface line unmotivated to break their daytime habits. angles so the occlusogingival curvature is similar to the tooth that it covers. Once the appliance is satisfactory, ask the QUICK CONSULTS patient to insert it. Inform the patient that the Fabricating an Appliance for appliance will be smoothed further, but that Daytime Wear you want to ensure that the posterior teeth hit I use the 2 - mm hard thermoplastic appliance it as evenly as possible and determine whether when an appliance is desired for the patient to the patient knows of anything that can be wear during the day that is very esthetic and has done to make the appliance more minimal effect on speech. C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 181 Wearing an Appliance during the Day It is preferred that patients learn to break their daytime habits rather than rely on wearing an appliance during the day. Clinically it is observed that some patients who are initially provided a 2 - mm hard thermoplastic appliance for daytime wear become unmotivated to break their daytime habits. Therefore, though I use this appliance Figure 12.55. Hard thermoplastic stabilization infrequently, I have most often used it for appliance: the 2 mm shell. (1) patients who have been working to break their daytime habits and continue to have signifi cant daytime pain for which their should not be so strong that the patient has occlusal appliance is benefi cial, but fi nd their unwarranted diffi culty removing it, but be appliance not esthetically acceptable or that it suffi cient that the patient cannot dislodge it interferes with speech (these patients are with the tongue. An appliance that is too generally asked to wear their current appliance retentive generally engages the posterior at night and this new appliance during the undercuts too deeply, so the depth of day [never eating with it]); and (2) patients engagement should be reduced. If there is who have intermittent daytime pain, are not insuffi cient retention, the internal surface of willing to treat their pain with traditional the appliance should be relined, as explained behavioral techniques, and want an esthetic in “ Internal Reline ” in this chapter. appliance for intermittent daytime use. The thermoplastic material is 2 mm thick Since the purpose of this appliance is to prior to appliance fabrication, but thins to minimize the traditional appliance esthetic approximately 1 mm once it is warmed and and speech problems, I make a mandibular stretched across the patient’ s cast. Clinical appliance without an anterior guidance ramp experience has shown that this is rarely thick for the maxillary anterior teeth. 6 Only an enough to develop the desired maxillary impression of the mandibular teeth is needed, occlusal contacts without creating multiple and the laboratory is requested to fabricate a perforations of the appliance’ s occlusal surface. clear 2 - mm hard thermoplastic appliance, as Therefore, once the appliance fi ts comfortably, specifi ed in appendix 8 , “ Laboratory Occlusal it routinely needs to have clear orthodontic Appliance Instructions. ” acrylic added to obtain the appliance’ s Once the appliance is fabricated (Figure occlusal scheme from the maxillary fi rst 12.55 ), insert it in the patient ’ s mouth. If the premolar ’ s lingual cusp to the most posterior appliance does not seat fully with a moderate tooth. amount of force or causes an uncomfortable A grease pencil is often used on the pressure, the internal surface of the appliance appliance to delineate the anterior extent to is adjusted, as explained in “ I nternal which acrylic needs to be added. Using Adjustments ” in this chapter. Once the monomer, moisten the area of the appliance appliance is comfortable, determine whether where acrylic is to be added. Pour it is satisfactorily retentive. The retention approximately a teaspoon of acrylic powder 182 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y into a paper cup, add only enough monomer cuspal indentations are not in the desired to moisten all of the powder granules, and location. mix with a wooden tongue depressor. Place The appliance is removed, placed in warm the acrylic on the desired area, slightly water to speed the curing process, and/or overestimating the amount of acrylic needed. placed in a pressure - curing unit to decrease the Wait for the acrylic to fi rm into a clay added acrylic ’ s porosity. Some patients wish to consistency before placing the appliance into rinse their mouth with mouthwash at this the patient ’ s mouth. The acrylic may slump time. Once the acrylic is hard, mark the cuspal or fl ow while you are waiting, and it is depths with a pencil (Figure 12.57 ) and use important to ensure the acrylic does not fl ow the fl at side of the acrylic bur to reduce the into the internal portion of the appliance. added acrylic until the pencil marks are almost Therefore, the appliance is generally held so erased. Repeatedly mark the appliance with that the added acrylic is toward the fl oor, and black Accufi lm and adjust the appliance so at the acrylic generally has to be remolded once least one centric mark is obtained from each or twice during this wait. posterior tooth, these marks
appear as uniform Once the acrylic is the consistency of clay as possible, and the patient feels that both (Figure 12.56 ), place the appliance in the sides hit evenly (Figure 1 2.58) . patient’ s mouth, manipulate the mandible to Adjust the appliance so the patient can slide the position that will be used to adjust the the mandible easily into excursive positions, appliance, and ask the patient to close slowly disoccluding the posterior teeth with the into the soft acrylic. As the patient initially closest posterior contact being 1/2 – 1 mm from closes into the acrylic, observe whether it the appliance. It is preferred that the maxillary needs to be repositioned and, if needed, canines provide the posterior disocclusion, mold it into the proper position. Again but the canines generally do not touch the manipulate the mandible and ask the patient appliance, thereby preventing them from to close slowly into the soft acrylic and stop providing immediate disocclusion of the as soon as the teeth touch the hard acrylic posterior teeth. Therefore, the occluding substructure. If the patient closes further than maxillary fi rst premolar ’ s lingual cusp can be this fi rst contact, the mandible shifts and the used to disocclude the posterior until the Figure 12.56. Hard thermoplastic stabilization Figure 12.57. Hard thermoplastic stabilization appliance: acrylic of clay consistency added to the appliance: hard acrylic, with cusp depths marked shell. with pencil. C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 183 Figure 12.59. Hard thermoplastic stabilization appliance: provides a very esthetic appliance that Figure 12.58. Hard thermoplastic stabilization minimally disrupts speech; for daytime appliance appliance: black Accufi lm marks of centric contacts wear. on adjusted appliance and red Accufi lm marks of excursive contacts. the occlusal surface. These are easily fi lled by moistening the area with monomer and canine contacts the appliance and can similarly mixing the acrylic, placing it in disocclude the posterior teeth. the concavity, and contouring it with a Use red Accufi lm to mark the appliance in gloved fi nger. A smooth fi nish can be excursive positions; ask the patient to grind achieved by applying a little monomer over the teeth side to side and forward and its surface and further smoothing it with a backward on the red Accufi lm. Then ask the gloved fi nger. patient to tap in the centric position on black Once the appliance is satisfactory, ask the Accufi lm to provide the appliance with black patient to insert it. Inform the patient that the centric contact marks on top of the red appliance will be smoothed later, but that you excursive marks. Adjust the posterior portion want to ensure that the posterior teeth hit the of the appliance so no red posterior excursive appliance as evenly as possible and determine marks are produced except for the maxillary whether the patient knows of anything that fi rst premolar ’ s lingual cusps and/or canines would make the appliance more comfortable. (Figure 12.58 ). Once the appliance meets with the patient ’ s Since the patient will be wearing this approval, smooth the sides of the added appliance during the day, after adjusting the acrylic and ask the patient whether it feels appliance in the traditional manner, adjust the smooth enough. appliance with the patient in an upright I use this appliance only when the patient position. Reposition the dental chair into the needs to wear an appliance during the day sitting position and ask the patient to sit with and needs one that is very esthetic and has feet to the side so they are on the fl oor. Mark minimal effect on speech (Figure 1 2.59) . and adjust the appliance with the same There is a concern that this appliance does criteria. not provide support for the maxillary anterior Once the appliance ’ s occlusion is adjusted, and that the maxillary anterior teeth might ensure the added acrylic is smooth and supererupt if the patient wore this appliance fl owing. Sometimes, undesirable holes or full time. It appears this is not often a concavities form when acrylic is added to problem, because many people have maxillary 184 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y anterior teeth that are so far anterior that their 3. Self - curing acrylic will bond to this mandibular teeth rarely occlude with them, material, enabling me to reline its occlusal and the lower lip provides the support for surface and repair the appliance. these teeth. 8 To preclude the possibility of the 4. If the patient has a restoration placed on a maxillary anterior teeth supererupting, if the tooth covered by this appliance, its patient needs to wear an appliance at night, it fl exibility when heated may allow the is recommended one be fabricated that will practitioner to only readapt the appliance maintain the position of these teeth, i.e., a to the new restoration. maxillary appliance or mandibular appliance with an anterior guidance ramp. Since material in the interproximal undercuts will fl ex away from these undercuts during the heating/fi tting process, I like to Impak Stabilization Appliance start with an appliance that is slightly overextended into these undercuts and is too Impak is an appliance fabricated with the retentive (Figure 12.15 ). hybrid intermediate material that I use for I send the laboratory maxillary and most of my TMD patients (comparable with mandibular casts and an interocclusal record. Remedeze appliance). If the patient has The initial insertion is described above. The moderate to severe tooth attrition, I request appliances I receive from the dental laboratory the majority of the appliance’ s occluding I use are quite fi rm and require that I heat surface be covered with acrylic, to resist the water in a microwave oven to obtain the appliance wear from heavy parafunctional temperature in which the appliance will be activity (comparable with Bruxeze appliance). fl exible. I prefer the Impak stabilization appliance to If the appliance was made entirely with the hard stabilization appliance for the Impak, during the heating/fi tting process, the following advantages: mandible is manipulated into the desired position, and the patient is asked to squeeze a 1. It will become quite fl exible when placed little into the material. This helps to mold the in hot water. The practitioner repeatedly occlusal surface to better fi t the opposing seats the appliance over the patient’ s teeth occlusion. and removes it from the teeth (not from The occlusion is adjusted with an acrylic the mouth). As the appliance cools, it bur for the maxillary and mandibular assumes a slightly altered shape appliances as described for the previous compensating for minor errors with the appliances. I fi nd when I adjust the occlusion cast and reducing the amount of material for these appliances, I have to be careful not in the interproximal undercuts, generally to deform the appliance, or it may take a few providing an ideal amount of retention. It seconds to bend the appliance back to the is rare for me to provide any internal correct shape. adjustments, but if there is still too much retention, I will shorten the fl anges. 2. It is a softer material than the hard Dual Laminate Thermoplastic Stabilization appliances and provides better dissipating Appliance clenching forces, 35 and an informal survey of patients found most patients prefer these This material comes in sheets that have the softer appliances. soft thermoplastic material on one side and C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 185 the hard thermoplastic material on the other thermally laminated together so they do not separate. The material is warmed and molded over the patient ’ s cast by vacuum or positive pressure, so the soft material is against the teeth and the hard material is the external surface. Having this performed with positive pressure (up to 10 atmospheres) rather than Figure 12.60. Dual laminate thermoplastic vacuum (1 atmosphere) provides a much stabilization appliance: fabricated and adjusted on more retentive appliance, and may require articulator. telephoning laboratories to determine which ones have this capability.4 6 This provides the appliance with most of the positive qualities of both the soft and hard thermoplastic appliances; i.e., the soft material feels comfortable to the supporting teeth, the soft material can compensate for minor errors so internal adjustments are rarely needed, the hard material bonds with self - curing acrylic giving it the versatility of an acrylic appliance, and the acrylic occlusal surface marks and adjusts with the precision of acrylic appliances. In the construction of this appliance, I Figure 12.61. Dual laminate thermoplastic prefer the laboratory add the self - curing acrylic stabilization appliance: occlusal surface of a to the appliance ’ s occlusal surface. Therefore, I fabricated appliance. send the laboratory a maxillary and mandibular cast and desired interocclusal record. The laboratory technician mounts the models on the articulator, molds the dual laminate thermoplastic material over the cast, removes the excess material, and returns the cast to the articulator. At this stage, the laboratory technician is instructed to adjust the articulator ’ s incisal pin so the closest opposing tooth is 1 m m from the dual laminate ’ s occlusal surface. This provides a minimum acrylic thickness of 1 m m, which clinically appears appropriate for the needed intraoral adjustments. The laboratory technician roughens the dual laminate ’ s occlusal surface, moistens it Figure 12.62. Dual laminate thermoplastic stabilization appliance: the internal surface of a with monomer, adds self - curing acrylic, and fabricated appliance; note the thickness of buccal adjusts the acrylic occlusal surface (Figures and lingual fl anges, and the acrylic thickness lingual 12.60 – 12.62 ). The added acrylic provides the to the anterior teeth. 186 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y same occlusal surface as would be established this thickness may not be adequate for with the traditional acrylic appliance. obtaining all of the desired occlusal contacts. The laboratory technician is requested to Therefore, I routinely use this material for soft carry the labial and buccal portions of this thermoplastic stabilization appliances, even appliance to the gingival margin. The desired though the resulting fl anges are bulkier than I labial extent varies with the angulation of the desire. anterior teeth, and the requested labial extent The practitioner need only make an can be reduced as needed. If this appliance is impression of the teeth in the arch for which diffi cult to insert or the anterior portion has the appliance will be made and request the too much retention, I generally correct this by laboratory fabricate a clear soft thermoplastic reducing the labial extent, but leave at least stabilization appliance, as specifi ed in 1 – 1½ mm of material labial to the incisal edge appendix 8 , “ Laboratory Occlusal Appliance of the anterior teeth (the recommended labial Instructions. ” The appliance rarely needs extent used with acrylic appliances). internal adjustments, but, if it does not Similar to the soft thermoplastic appliances, completely seat or causes an uncomfortable the internal surface cannot be relined. Adjust pressure, determine the seating interference or the internal surface with an acrylic or number ask the patient to identify the pressure area. 8 round bur and, if this does not make the (Accufi lm does not adequately mark this appliance fully seat comfortably, have it appliance.) Adjust the internal surface with an refabricated. acrylic or number 8 round bur. If the External relines and adjustments are made appliance cannot be made to fully seat in the same way as those for acrylic comfortably, have it refabricated. appliances. Since the soft internal layer Once the appliance completely seats and is occupies a portion of the interocclusal space, comfortable, evaluate its retention, which the
vertical dimension of this appliance will varies with the depth the material penetrated be a little larger than that of comparable into the undercuts. This fl uctuates with the acrylic appliances. temperature at which the material was warmed and the amount of force obtained by the vacuum or positive pressure machine. If Soft Thermoplastic Stabilization Appliance the appliance is too retentive, use an acrylic or number 8 round bur and reduce the material Soft thermoplastic material is available in a that fi ts into the most retentive undercuts. large variety of thicknesses and is commonly If there is inadequate retention due to used for fabricating athletic mouth guards. 59 insuffi cient material penetrating into the Similar to the hard thermoplastic material, undercuts, have the appliance refabricated. once warmed and stretched across a patient’ s A positive pressure (up to 10 atmospheres) cast, it thins to approximately half its original machine will provide a much more retentive thickness. appliance than a vacuum (1 atmosphere) The 0.15 - inch (3.8 - mm) - thick and the machine;4 6 this may require telephoning 4.0 - mm - thick material are the maximum laboratories to determine which ones have this thicknesses commercially available and capability. generally provide an occlusal surface The appliance ’ s occlusal surface can be approximately 2 mm thick. This limited rapidly modifi ed to provide a close thickness is sometimes a problem and, if the approximation of the fi nal occlusal surface. In patient has a signifi cant occlusal discrepancy, order that the patient does not disrupt this C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 187 procedure and can perform the necessary the sides are contoured to fl ow smoothly onto movements, fi rst discuss the procedure with the occlusal surface. the patient, demonstrate the mandibular An indentation from at least one manipulation, and ask the patient to practice supporting cusp of every posterior tooth is the excursive movements. desired. If the initial attempt did not obtain With the appliance on the cast, use an or almost obtain these imprints, the alcohol torch to warm all areas of the aforementioned steps may be repeated. appliance that the opposing teeth may touch. For the fi nal adjustments, use the acrylic Evenly warm the appliance by repeatedly bur to adjust the occlusion marked on the sweeping the fl ame from one side of the appliance with articulating paper (Bausch appliance to the other. Clinical experience has Articulating Paper, Nashua, NH), because demonstrated that, when the appliance feels Accufi lm does not adequately mark this slightly tacky, it is ready to place in the material. The articulating paper marks are mouth. not the point contacts typically observed Once the appliance is seated on the teeth, on acrylic appliances, but broad marks manipulate the mandible to the position (Figure 12.63 ). where the appliance will be adjusted, and ask Clinical experience has demonstrated that, the patient to close into the softened even though the articulating paper marks appliance. Ask the patient to stop when the appear uniform, the patient may detect the last tooth desired to occlude with the opposing teeth are not occluding evenly on appliance is only lightly touching or just the appliance. If the patient identifi es heavier about to touch the appliance; this retains the contacts that appear as even articulating paper maximal thickness for the appliance. Then, marks, it is recommended that further ask the patient to slide the mandible across adjustments of the appliance be made with the appliance into the previously practiced the patient ’ s guidance until it feels even to the excursive positions. patient. This creates occlusal imprints of the The appliance is next adjusted so the opposing cusp tips into the appliance’ s anterior teeth disocclude the posterior teeth in occlusal surface. Place the appliance on the excursive positions. The excursive movements cast and mark the bottom of each cusp are marked with articulating paper, and the indentation with dark ink so they can easily be observed as an acrylic bur is used to modify the occlusal surface. Any nonsupporting cusp indentations present are removed well below the depth of their indentation, whereas the supporting cusp indentations are reduced so the ink marks are just barely removed. The indentations from the anterior teeth provide guidance to disocclude the posterior teeth. These indentations are retained, but, if there is material that extruded around the teeth, remove it and contour the area to allow Figure 12.63. Soft thermoplastic stabilization for smooth excursive movements. The occlusal appliance, centric articulating paper marks on surface is contoured to form a fl at plane, and adjusted appliance. 188 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y Figure 12.64. Soft thermoplastic stabilization appliance opposing an acrylic appliance. new markings on the posterior portion of the appliance are adjusted. The appliance may be polished with chloroform or halothane (a general inhalation anesthetic often used as a substitute for chloroform 60 ). To obtain a smooth fi nish rapidly, seat the appliance on the cast and rub a dampened gauze fi rmly with either agent over any rough area of the appliance. Use water to rinse off any remaining polishing agent, ask the patient to insert the appliance, and ask whether there is anything that the Figure 12.65. Articulating paper marks on patient would like done to improve the adjusted soft thermoplastic stabilization appliance appliance. opposing an acrylic appliance. Soft thermoplastic stabilization appliances can be fabricated for either the maxillary arch or the mandibular arch. Because of the child with in the primary or mixed dentition. bulkiness of its fl anges, I generally fabricate It is speculated these appliances will not this appliance for the mandibular arch. An signifi cantly affect the development of the appliance that is to be used as an athletic dentition and will not need the number of mouthpiece should be fabricated for the adjustments that the other appliances may maxillary arch. I always adjust the occlusion require to accommodate minor tooth of the athletic mouthpiece because it makes movements.1 ,45 the mouthpiece more comfortable, less likely Occasionally I will make a soft to cause occlusal changes, and less likely to thermoplastic stabilization appliance opposing cause the patient to develop TMD an acrylic appliance (Figures 1 2.64 and symptoms. 46 12.65 ). This appears helpful for (1) patients The soft thermoplastic stabilization who continually fracture or rapidly wear their appliance is the only appliance I will provide a acrylic appliances; (2) patients who have tooth C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 189 or periodontal ligament pain, associated with teeth, which may delay the practitioner from heavy clenching, that does not satisfactorily obtaining a stable occlusion on the appliance; resolve from an acrylic stabilization appliance; and it takes the patient longer to obtain the (3) patients whose bed partners complain that appliance ’ s maximal treatment effect. the noise created by the patient bruxing Whenever patients are provided an heavily on the acrylic appliance disturbs them; appliance, it is recommended they also receive and (4) patients with PTSD who awaken the “ Occlusal Appliance Care Instructions ” severely clenching from PTSD nightmares and handout (appendix 5 ) and it be reviewed with do not obtain satisfactory improvement with them. The instructions inform patients about an acrylic appliance.6 1 Some of the additional common problems they may encounter, benefi t may be a result of the resilient material maintenance of the appliance, reasons the dissipating force when the patient clenches appliance will need additional adjustments, heavily. 35 and, if discomfort occurs, to stop wearing it and return to have the discomfort relieved. Appliances can harbor microorganisms, so APPLIANCE MANAGEMENT if the patient needs treatment for a candidiasis infection or you suspect fungal growth under Great variations in the protocols that the appliance, the appliance should be treated. practitioners use when delivering occlusal The patient can treat the appliance by soaking appliances have been observed. Some it in a cup (8 fl uid ounces) of water with 4 – 5 practitioners (as myself ) attempt to refi ne the drops of household bleach during the day and occlusion fully at the insertion appointment. brushing the appliance with toothpaste prior Occasionally the lengthy appointment to placing it in the mouth. 62 Some aggravates a patient’ s TMD symptoms to the practitioners ask their patients to do this on a degree that the patient wants to stop prior to weekly basis to prevent fungal growth, but I completion of the adjustments. am afraid this may have a deleterious effect on Some practitioners make shorter insertion the intermediate and soft appliances. appointments, adjust the appliance so it is The recommended wear pattern will vary comfortable on the teeth that support it, and with the symptoms that are being treated. adjust the appliance’ s occlusion so one or two Patients who awake with TMD symptoms contacts are occluding on each side. At each that last up to several hours and/or who have follow - up appointment, its occlusion is further minimal daytime symptoms are asked to wear refi ned, and eventually the appliance becomes the appliance only at night. adjusted as described earlier. Fully adjusting the appliance at its delivery FOCAL POINT has the advantage of the patient obtaining the Patients who awake with TMD symptoms that maximal initial treatment effect from the last up to several hours and/or who have appliance, but the long procedure may cause minimal daytime symptoms are asked to wear some temporary TMD aggravation. The the appliance only at night. stepwise adjustment protocol causes minimal TMD symptom aggravation during appliance delivery, but some patients have symptom If attempting to reduce signifi cant daytime aggravation from wearing an inadequately symptoms, I would like the patient to wear adjusted appliance; the uneven occlusal the appliance during the day (1) as a reminder contacts may induce some shifting of the to help him or her observe and break the 190 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y daytime habits (Figure 14.7 ), 2,63 and (2) to appliance during these activities and its cost maximize the effects from the stable occlusal (e.g., diffi culty speaking and its visibility). environment. 2 The patient is instructed to From this, they decide how often they will wear the appliance temporarily during the day wear the appliance during the day. Alternative and never eat with it. Nighttime appliance use conservative therapies should be provided, as often provides some prolonged benefi ts that needed, so patients can stop their daytime carry over to help alleviate the daytime appliance use and limit the wear to nighttime. symptoms also. 64 Therefore, I instruct these Generally, as patients wear their new patients to wear the appliance temporarily 24 appliance, the masticatory muscles become hours a day and, over several months, reduce less tense and the TMJ infl ammation reduces. its use slowly to primarily nighttime. These changes within the masticatory system usually alter the occlusion on the appliance. It FOCAL POINT has been observed that these changes are often If attempting to reduce signifi cant daytime proportional to a patient ’ s symptoms and, symptoms with an appliance, the patient is with repeated appliance adjustments, the instructed to wear the appliance temporarily 24 occlusion stabilizes. 65 No matter how well the hours a day (except when eating) and, over appliance was initially adjusted, the patient several months, reduce its use slowly to primarily needs to return for follow - up to refi ne the nighttime. occlusion for these adaptive changes, to ensure the appliance is not causing any correctable Occasionally patients who wear an problems, to ensure the appliance is benefi cial, appliance 24 hours a day (including while and, if needed, so that additional TMD eating), and never put their teeth into therapies can
be recommended. 1 maximum intercuspation, over time lose the The length of time between the insertion ability to occlude their teeth into MI. This and follow - up appointment will vary with a situation may require orthognathic surgery to patient ’ s symptom severity and how well the enable the patient to once again occlude into appliance could be adjusted. If a patient’ s maximum intercuspation. One of the symptoms are severe and/or the appliance principal reasons patients are instructed to not cannot be adjusted adequately, the patient is eat with their appliance is that they generally given an appointment within a week. If a put their teeth into MI while eating. Patients patient has minimal symptoms and a well- are allowed to wear their appliance 24 hours a adjusted appliance was provided, the patient is day for only a relatively short period (a few generally given an appointment approximately months), during which they are closely 4 weeks later. observed to ensure they are not losing the When the patient returns for follow - up, ask ability to occlude into maximum about any problems he or she may be having intercuspation. with the appliance. Occasionally a patient Some patients recognize that their TMD relates that he or she unintentionally removes symptoms and parafunctional habits are the appliance while sleeping. It appears related to certain activities, e.g., driving a car patients subconsciously remove their or using a computer. These patients are asked appliances at night because the appliance to wear their appliance during these activities aggravates them in some manner. Four (if they are willing) and at night. During the different causes have been observed, and the initial phase of daytime wear, patients observe patient generally stops removing it once the the benefi t they obtain from wearing the cause is corrected. The four problems I probe C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 191 are whether the appliance is (1) too loose, reporting minimal improvement from the use (2) too tight, (3) not satisfactorily adjusted to of a stabilization appliance should be the opposing dentition, or (4) too bulky. The minimized by following the recommendations appropriate corrections typically stop this for when to use a stabilization appliance in problem. “ Integrating Conservative Therapies ” in Generally patients report a signifi cant chapter 19 . reduction in the TMD symptoms upon If a patient has not obtained the expected awaking, and the daytime symptom reduction improvement from using an appropriately varies with how often a patient has worn the adjusted appliance for several weeks, consider appliance during the day and/or learned to reevaluating the patient to determine whether break the daytime habits. If the appliance the chief complaint may be due to a non- needs only minor adjustments, the occlusion TMD condition and/or whether non - TMD should be perfected, but the patient often contributors (neck pain, fi bromyalgia, etc.) does not even notice the difference or have were missed during the initial evaluation.1 If a any additional symptom improvement. panoramic radiograph was not taken, the Even with the identifi ed predictors for practitioner may desire to take one at this which patients have a high probability of time. improving or not improving with stabilization appliance therapy, it is not uncommon for me QUICK CONSULT to be surprised with how effective it is for one Failing to Relieve Symptoms patient and how ineffective it is for another If a patient has not obtained the expected patient. Fortunately the percentage of patients improvement from using an appropriately who have no improvement from an appliance adjusted appliance for several weeks, consider adjusted as previously described is relatively reevaluating the patient to determine whether the small. chief complaint may be due to a non - TMD All patients who are provided an occlusal condition and/or whether non - TMD contributors appliance should have received the “ T MD (neck pain, fi bromyalgia, etc.) were missed Self - Management Therapies ” handout during the evaluation. If a panoramic radiograph (appendix 4 ) at the evaluation appointment. was not taken, the practitioner may desire to The end of this handout states that “ a take one at this time. percentage of patients receiving [TMD] therapies report no symptom improvement If a patient did not receive satisfactory (i.e., 10 – 20% of patients receiving occlusal improvement with use of the stabilization appliances report no improvement).” appliance, the practitioner may want to try a Therefore, the patient has been warned about different mandibular position to determine this possibility, but this does not decrease the whether it might make the appliance more disappointment felt by the practitioner as well effective. The most likely other position that as the patient if symptoms do not improve. would provide a benefi cial effect is at the Typically our treatments in dentistry are location where the masticatory system feels successful, whereas, in medicine, practitioners the most relaxed and comfortable for the are accustomed to having a percentage of patient. patients not benefi t from a therapy. The Ask the patient to slide the mandible slowly success of TMD therapies is similar to that of anterior and determine whether there is a other medical procedures provided for patients position at which the masticatory system feels with chronic pain. The percentage of patients more relaxed and comfortable. If the patient 192 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y can locate such a position, the practitioner may fi nd the appliance more effective with the mandible supported at this new position. As the patient protruded the mandible to the new comfortable position, the condyle also translated. If the patient has a disc displacement with reduction, and a click or pop was detected within the TMJ as the condyle translated, clinically this suggests the condyle moved onto the disc’ s intermediate zone (called the reduced position). To confi rm clinically that the disc - condyle is reduced, ask the patient to open from and close to this Figure 12.66. Appliance with occlusal protruded position and, if the disc - condyle is indentations, Accufi lm contact marks on adjusted reduced, the patient ’ s typical TMJ click or appliance. pop will no longer be present. The bottom left diagram of the “ T MJ Disc Displacements” handout (appendix 3 ) may help readers to maintain the mandible at this comfortable understand visually that, once the condyle is position. reduced, the patient can open and close from The indentations can be added to the that position without creating the normal occlusal surface of the appliance with self- joint noise. Contrary to what one would curing acrylic (Figure 12.66 ). Follow the expect, this clinical test is not accurately guidance provided in “ E xternal Reline” in this supported by MRI fi ndings.6 6,67 chapter, and ask the patient to close into the If a patient has a disc displacement with identifi ed comfortable position. Trim and reduction, and the clinical test suggests the adjust the appliance as instructed in chapter new position is where the disc - condyle is 13 . The wear schedule, warnings, and follow - reduced, the proposed new appliance would up provided for the anterior positioning be an anterior positioning one. It is appliance would probably apply for this recommended the practitioner follow the appliance. guidance provided in chapter 1 3, “ A nterior If the patient could not fi nd a comfortable Positioning Appliance, ” for this appliance. position, but meets the criteria for an anterior Acrylic can be added to the existing positioning appliance, consider providing an stabilization appliance to modify it into an anterior positioning appliance and follow the anterior positioning appliance. guidance provided in chapter 1 3. It is If the new comfortable position is only 1 or recommended stabilization appliances be 2 mm anterior from the previously used provided prior to using one of these position, and the patient can close repeatedly alternative appliances, because all have similar at this location, the practitioner may desire to effi cacy for most individuals, the risks for adjust the appliance to provide a stabilization adverse sequelae from one of these alternative appliance with the centric contacts at the new appliances is much greater, but some position. If the patient cannot close repeatedly individuals who do not fi nd a stabilization at this new location, the practitioner may appliance benefi cial may fi nd one of these want to add acrylic to provide occlusal alternative appliances dramatically indentations that will help the patient benefi cial.2 ,21,68 C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 193 Patients provided a stabilization appliance Appliance therapy should be viewed as one generally have their conditions followed for of many conservative TMD therapies. Used in several months to determine the amount of conjunction with other conservative therapies, occlusal change that occurs between it augments the symptom improvement that appointments and how sensitive the patient is patients can obtain. Appliance therapy should to these changes. From these observations, the not be viewed as temporary treatment for practitioner can determine the appropriate which occlusal rehabilitation is the fi nal time for scheduling the next follow- u p treatment approach.1 ,69 appointment. Typically patients are eventually placed on an annual recall. Using the conservative TMD therapies REFERENCES discussed in “ Integrating Conservative Therapies ” in chapter 19 , I try to reduce the 1. American Academy of Orofacial Pain. de Leeuw R patient’ s symptoms satisfactorily so that the (ed). Orofacial Pain: Guidelines for Assessment, appliance needs to be worn only at night. I Diagnosis and Management , 4th ed. Chicago : Quintessence , 2008 : 168 – 169 , 171 . plan for the great majority of my patients to 2. Clark GT , Minakuchi H . Oral appliances . In: wear their appliance at night for many years. Laskin DM , Greene CS , Hylander WL . Periodically patients forget to wear their Temporomandibular Disorders: An Evidence - Based appliance at night, which provides an Approach to Diagnosis and Treatment . Hanover unintentional test of whether the appliance is Park, IL : Quintessence , 2006 : 377 – 390 . still needed. 3. Clark GT , Beemsterboer PL , Solberg WK , TMD tends to be a cyclic disorder that is Rugh JD . Nocturnal electromyographic evaluation often related to situations occurring in a of myofascial dysfunction in patients undergoing patient’ s life, and there are many possible occlusal splint therapy . JADA 1979 ; 99 : scenarios for how often the patient will need 607 – 611 . to wear the appliance. Some patients may 4. Okeson JP . Management of Temporomandibular need to wear it every night and others on a Disorders and Occlusion , 6th ed. St. Louis : CV Mosby , 2008 : 99 , 468 – 497 . weekly basis, whereas some others may fi nd at 5. Macedo CR , Silva AB , Machado MA , Saconato H , some point that they no longer need it. If Prado GF . Occlusal splints for treating sleep patients do not wear their appliance, the teeth bruxism (tooth grinding) . Cochrane Database Syst tend to shift and, over time, the appliance Rev 2007 Oct 17 ;( 4 ): CD005514 . becomes more diffi cult and/or painful to 6. Messing SG . Splint therapy . In: Kaplan AS , Assael insert and wear. LA (eds). Temporomandibular Disorders: Diagnosis It is common to hear patients returning for and Treatment . Philadelphia : WB Saunders , a new appliance say that they no longer 1991 : 395 – 454 . needed it and so stopped wearing it. Then, 7. Young PA . A cephalometric study of the effect of 1 or 2 years later, a situation in their life acrylic test palatal piece thickness on the physiologic changes, and they once again need an rest position . J Philipp Dent Assoc appliance. Therefore, even though a
patient 1966 ; 19 ( 1 ): 5 – 15 . 8. Dawson PE . Functional Occlusion: From TMJ to no longer needs to wear the appliance, it is Smile Design . St Louis : CV Mosby , 2007 : 86 – 89 , recommended that the appliance consistently 136 , 379 – 392 . be worn every night. When the appliance 9. Nitzan DW . Temporomandibular joint “ open lock ” reaches the condition where it should be versus condylar dislocation: Signs and symptoms, replaced and is no longer needed, this is an imaging, treatment, and pathogenesis . J Oral appropriate time to discontinue its use. Maxillofac Surg 2002 ; 60 ( 5 ): 506 – 511 . 194 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y 10. Obrez A , Turp JC . The effect of musculoskeletal suppression: A preliminary report. C ranio facial pain on registration of maxillomandibular 2001 : 19 ( 4 ): 269 – 278 . relationships and treatment planning: A synthesis of 24. Shankland WE . Nociceptive trigeminal inhibition — the literature . J Prosthet Dent 1998 ; 79 ( 4 ): 439 – 445 . tension suppression system: A method of preventing 11. Dylina TJ . A common - sense approach to splint migraine and tension headaches . Compend Contin therapy . J Prosthet Dent 2001 ; 86 : 539 – 545 . Educ Dent 2002 ; 23 ( 2 ): 105 – 108 , 110 , 112 – 113 . 12. Racich MJ . A case for full - coverage hard acrylic 25. Magnusson T , Adiels AM , Nilsson HL , Helkimo non - sleep - apnea dental orthotics . J Can Dent Assoc M . Treatment effect on signs and symptoms of 2006 ; 72 ( 3 ): 239 – 241 . temporomandibular disorders — comparison 13. Dawson PE . New defi nition for relating occlusion between stabilization splint and a new type of splint to varying conditions of the temporomandibular (NTI). A pilot study . Swed Dent J 2004 ; 28 ( 1 ): joint . J Prosthet Dent 1995 ; 74 : 619 – 627 . 11 – 20 . 14. Hilsen KL (ed). Temporomandibular disorder 26. Jokstad A , Mo A , Krogstad BS . Clinical comparison prosthodontics: Treatment and management goals. between two different splint designs for Report of the Committee on Temporomandibular temporomandibular disorder therapy. A cta Odontol Disorders of the American College of Scand 2005 ; 63 ( 4 ): 218 – 226 . Prosthodontics . J Prosthodont 1995 ; 4 ( 1 ): 58 – 64 . 27. Raphael KG , Marbach JJ , Klausner J . Myofascial 15. Carlson N , Moline D , Huber L , Jacobson J . face pain: Clinical characteristics of those with Comparison of muscle activity between regional vs. widespread pain . JADA conventional and neuromuscular splints. J Prosthet 2000 ; 131 ( 2 ): 161 – 171 . Dent 1993 ; 70 : 39 – 43 . 28. Raphael KG , Marbach JJ . Widespread pain and the 16. Widmalm SE . Use and abuse of bite splints . effectiveness of oral splints in myofascial face pain. Compendium 1999 ; 20 ( 3 ): 249 – 259 . JADA 2001 ; 132 ( 3 ): 305 – 316 . 17. Douglass JB , Smith PJ . Loss of control of the 29. Rammelsberg P , LeResche L , Dworkin S , Mancl L . vertical dimension of occlusion during interocclusal Longitudinal outcome of temporomandibular acrylic resin splint therapy: A clinical report. J disorders: A 5- y ear epidemiologic study of muscle Prosthet Dent 1992 ; 67 ( 1 ): 1 – 4 . disorders defi ned by research diagnostic criteria for 18. Dahlstrom L , Haraldson T , Janson ST . temporomandibular disorders. J Orofac Pain Comparative electromyographic study of bite plates 2003 ; 17 ( 1 ): 9 – 20 . and stabilization splints. S cand J Dent Res 30. Wright EF , Clark EG , Paunovich ED , Hart RG . 1985 ; 93 ( 3 ): 262 – 268 . Headache improvement through TMD stabilization 19. Greene CS , Laskin DM . Splint therapy for the appliance and self - management therapies . Cranio myofascial pain - dysfunction (MPD) syndrome: A 2006 ; 24 ( 2 ): 104 – 111 . comparative analysis . JADA 1972 ; 84 : 624 – 628 . 31. Ekberg E , Vallon D , Nilner M . Treatment outcome 20. Ito T , Gibbs CH , Marguelles - Bonnet R , Lupkiewicz of headache after occlusal appliance therapy in a SM , Young HM , Lundeen HC , Mahan PE . randomized controlled trial among patients with Loading on the temporomandibular joints with fi ve temporomandibular disorders of mainly occlusal conditions . J Prosthet Dent arthrogenous origin . Swed Dent J 1986 ; 56 ( 4 ): 478 – 484 . 2002 : 26 ( 3 ): 115 – 124 . 21. Fricton J . Current evidence providing clarity in 32. Wright EF , Jundt JS . The NTI appliance for TMD management of temporomandibular disorders: and headache therapy. T ex Dent J Summary of a systematic review of randomized 2006 ; 123 ( 12 ): 1118 – 1124 . clinical trials for intra - oral appliances and occlusal 33. Greenstein G , Cavallaro J , Scharf D , Tarnow D . therapies . J Evid Based Dent Pract Differential diagnosis and management of fl ared 2006 ; 6 ( 1 ): 48 – 52 . maxillary anterior teeth . JADA 22. http://www.fda.gov/cdrh/pdf/k010876.pdf . Accessed 2008 ; 139 ( 6 ): 715 – 723 . June 2008 . 34. Casey J , Dunn WJ , Wright E . In vitro wear of 23. Shankland WE . Migraine and tension - type various orthotic device materials . J Prosthet Dent headache reduction through pericranial muscular 2003 ; 90 ( 5 ): 498 – 502 . C H A P T E R 1 2 S T A B I L I Z A T I O N A P P L I A N C E 195 35. Craig RG , Godwin WC . Properties of athletic Treatment . Philadelphia : Lippincott Williams & mouth protectors and materials . J Oral Rehabil Wilkins , 2001 : 21 – 23 . 2002 ; 29 ( 2 ): 146 – 150 . 50. Manns A , Miralles R , Guerrero F . Changes in 36. Okeson JP . The effects of hard and soft occlusal electrical activity of the postural muscles of the splints on nocturnal bruxism. J ADA mandible upon varying the vertical dimension. J 1987 ; 114 : 788 – 791 . Prosthet Dent 1981 ; 45 : 438 – 445 . 37. Nevarro E , Barghi N , Rey R . Clinical evaluation of 51. Rugh JD , Drago CJ . Vertical dimension: A study of maxillary hard and resilient occlusal splints [abstract clinical rest position and jaw muscle activity. J 1246] . J Dent Res (Special Issue) 1985 ; 64 : 313 . Prosthet Dent 1981 ; 45 ( 6 ): 670 – 675 . 38. Pettengill CA , Growney MR Jr , Schoff R , 52. Manns A , Miralles R , Santander H , Valdivia J . Kenworthy CR . A pilot study comparing the Infl uence of the vertical dimension in the treatment effi cacy of hard and soft stabilizing appliances in of myofascial pain - dysfunction syndrome . J Prosthet treating patients with temporomandibular disorders . Dent 1983 ; 50 ( 5 ): 700 – 709 . J Prosthet Dent 1998 ; 79 ( 2 ): 165 – 168 . 53. Hasegawa K , Okamoto M , Nishigawa G , Oki K , 39. Truelove E , Huggins KH , Mancl L , Dworkin SF . Minagi S . The design of non - occlusal intraoral The effi cacy of traditional, low - cost and nonsplint appliances on hard palate and their effect on therapies for temporomandibular disorder: A masseter muscle activity during sleep. C ranio randomized controlled trial . JADA 2007 ; 25 ( 1 ): 8 – 15 . 2006 ; 137 ( 8 ): 1099 – 1107 . 54. Dos Santos J Jr , Gurklis M . Chairside fabrication of 40. Williams WB . Pain release splint . Cranio Clin Int occlusal biteplane splints using visible light cured 1991 ; 1 : 55 – 64 . material . Cranio 1995 ; 13 ( 2 ): 131 – 136 . 41. Morgan DH , House LR , Hall WP , Vamvas SJ . 55. Nelson SJ . Principles of stabilization bite splint Diseases of the Temporomandibular Apparatus: A therapy . Dent Clin North Am Multidisciplinary Approach . St Louis : CV Mosby , 1995 ; 39 ( 2 ): 403 – 421 . 1982 : 266 – 274 . 56. Swanberg DF , Henry MD . Avoiding implant 42. Ramfjord S , Ash MA . Occlusion , 3rd ed . overload . Implant Soc 1995 ; 6 ( 1 ): 12 – 14 . Philadelphia : WB Saunders , 1983 : 362 – 365 . 57. Obrez A , Stohler CS . Jaw muscle pain and its effect 43. Singh BP , Berry DC . Occlusal changes following on gothic arch tracings . J Prosthet Dent use of soft occlusal splints. J Prosthet Dent 1996 ; 75 : 393 – 398 . 1985 ; 54 : 711 – 715 . 58. Capp NJ , Clayton JA . A technique for evaluation of 44. Wright E , Anderson G , Schulte J . A randomized centric relation tooth contacts. Part II: Following clinical trial of intraoral soft splints and palliative use of an occlusal splint for treatment of treatment for masticatory muscle pain . J Orofac temporomandibular joint dysfunction . J Prosthet Pain 1995 ; 9 : 116 – 130 . Dent 1985 ; 54 ( 5 ): 697 – 705 . 45. Attanasio R . Intraoral orthotic therapy . Dent Clin 59. Wright EF . Using soft splints in your dental offi ce . North Am 1997 ; 41 ( 2 ): 309 – 324 . Gen Dent 1999 ; 47 ( 5 ): 506 – 512 . 46. ADA Council on Access, Prevention and 60. Wilcox LR . Endodontic retreatment with halothane Interprofessional Relations; and ADA Council on versus chloroform solvent . J Endod Scientifi c Affairs . Using mouthguards to reduce the 1995 ; 21 ( 6 ): 305 – 307 . incidence and severity of sports- r elated oral injuries. 61. Wright EF , Thompson RL , Paunovich ED . Post JADA 2006 ; 137 ( 12 ): 1712 – 1720 . traumatic stress disorder: Considerations for 47. Harkins S , Marteney JL , Cueva O , Cueva L . dentistry . Quintessence Int 2004 ; 35 ( 3 ): 206 – 210 . Application of soft occlusal splints in patients 62. Brown RS , Bailey J , Winfree WJ , Harden S . Oral suffering from clicking temporomandibular joints. Candidiasis infections with limited clinical fi ndings . Cranio 1988 ; 6 : 71 – 76 . Dent Today 2006 ; 25 ( 7 ): 86 – 89 . 48. Boero RP . The physiology of splint therapy: A 63. Glaros AG , Kim - Weroha N , Lausten L , Franklin literature review . Angle Orthod 1989 ; 59 : 165 – 180 . KL . Comparison of Habit Reversal and a 49. Mense S , Simons DG , Russell IJ . Muscle Pain: Behaviorally - Modifi ed Dental Treatment for Understanding Its Nature, Diagnosis, and Temporomandibular Disorders: A Pilot 196 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y Investigation . Appl Psychophysiol Biofeedback 67. Kirk WS Jr . Magnetic resonance imaging and 2007 ; 32 ( 3 – 4 ): 149 – 154 . tomographic evaluation of occlusal appliance 64. Lavigne GJ , Kato T , Kolta
A , Sessle BJ . treatment for advanced internal derangement of the Neurobiological mechanisms involved in sleep temporomandibular joint . J Oral Maxillofac Surg bruxism . Crit Rev Oral Biol Med 1991 ; 49 ( 1 ): 9 – 12 . 2003 ; 14 ( 1 ): 30 – 46 . 68. Behr M , Stebner K , Kolbeck C , Faltermeier A , 65. Suvinen T , Reade P . Prognostic features of value in Driemel O , Handel G . Outcomes of the management of temporomandibular joint temporomandibular joint disorder therapy: pain - dysfunction syndrome by occlusal splint Observations over 13 years . Acta Odontol Scand therapy . J Prosthet Dent 1989 ; 61 ( 3 ): 355 – 361 . 2007 ; 65 ( 5 ): 249 – 253 . 66. Kurita H , Kurashina K , Ohtsuka A , Kotani A . 69. Greene CS . The etiology of temporomandibular Change of position of the temporomandibular joint disorders: Implications for treatment. J Orofac Pain disk with insertion of a disk - repositioning appliance . 2001 ; 15 ( 2 ): 93 – 105 . Oral Surg Oral Med Oral Pathol Oral Radiol Endod 1998 ; 85 ( 2 ): 142 – 145 . Chapter 13 Anterior Positioning Appliance FAQ Q: Why does eliminating the TMJ noise clinically suggest that the condyle is posi- tioned into the disc ’ s intermediate zone? A: The bottom left diagram of the “ TMJ Disc Displacements ” handout (appendix 3 ) may help readers to understand visually that, once the condyle is reduced, the patient can open from and close to that position without creating the normal joint noise. This appliance, which is traditionally used for When a patient occludes on this appliance, patients who have a disc displacement with the condyle is maintained in the reduced reduction, temporarily holds the mandible in position, causing the patient to be unable an anterior location, where the condyle is to make his or her normal TMJ clicking or positioned onto the disc’ s intermediate popping noise by opening or protruding the zone, also referred to as the location where mandible. If the mechanical disturbance the condyle is reduced onto the disc responsible for the joint noise irritates the (Figure 13.1 ). There appear to be two primary TMJ, and the patient has parafunctional mechanisms by which the anterior positioning habits that continually stimulate this appliance reduces the TMD symptoms: disturbance, wearing the appliance should (a) it removes the disc - condyle mechanical minimize the consequent irritation. disturbance, and (b) it transfers the condylar If the patient were to clench while wearing loading forces from the retrodiscal tissue to this appliance, the force transmitted through the intermediate zone. the condyle would load the disc’ s intermediate zone rather than the retrodiscal tissue. FOCAL POINT Intuitively this should benefi t patients with An anterior positioning appliance is traditionally retrodiscal tissue infl ammation.1 used for patients who have a disc displacement The retrodiscal tissue can also be protected with reduction. It temporarily holds the mandible from loading forces by a stabilization in an anterior location where the condyle is appliance. If a stabilization appliance is reduced onto the disc (Figure 13.1 ). adjusted using the neutral position (described 197 198 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y Figure 13.1. Condyle in the reduced position. in “ Mandibular Positions and Interocclusal FOCAL POINT Record ” in chapter 12 ), the condyle is not Anterior positioning appliances have been shown braced against the disc assembly. Therefore, to reduce TMJ pain, muscle pain, and TMJ noise when the patient clenches in MI on this for many patients. Stabilization appliances stabilization appliance, there is minimal load similarly improve TMD symptoms for most transferred to the disc assembly or pressure patients, even if their pain is related to a disc - created within the TMJ.2 In this manner, the condyle mechanical disturbance or intermittent stabilization appliance can also unload the locking at the opening where the noise occurs. infl amed retrodiscal tissue. Anterior positioning appliances have been It has been suggested that anterior shown to reduce TMJ pain, muscle pain, and positioning appliances may be more effective TMJ noise for many patients. Similarly in reducing some TMD symptoms than are stabilization appliances improve TMD stabilization appliances.6 Due to the probable symptoms for most patients, even if their pain effi cacy of the stabilization appliance and is related to a disc - condyle mechanical the problems associated with the anterior disturbance or intermittent locking at the positioning appliance, 7,8 it is recommended opening where the noise occurs. 3 – 5 that practitioners fi rst use a stabilization C H A P T E R 1 3 A N T E R I O R P O S I T I O N I N G A P P L I A N C E 199 appliance and other conservative TMD interocclusal record with the dental chair back therapies. Only after these fail to provide about 10 – 20 ° from its maximum upright adequate symptom relief is it recommended position. that an anterior positioning appliance be If the patient has a normal considered. maxillomandibular relationship, it is Maintaining the mandible at the desired recommended to evaluate initially whether the anterior location for an extended period may mandibular location where the maxillary and occasionally aggravate a patient’ s TMD mandibular anterior teeth touch end to end is symptoms. Clinically it has been observed that feasible. With the mandible at this location, a patient who fi nds that this mandibular ask the patient to open from and close to this location aggravates his or her TMD symptoms position several times, and observe whether will usually fi nd that this appliance the click or pop has been eliminated. exacerbates the symptoms. If the noise is eliminated, this clinically Intuitively it appears only patients who suggests that this location positions the meet all of the following criteria have a high condyle so it is reduced onto the intermediate probability of gaining additional improvement zone of the disc (Figure 13.1 ). The bottom from this appliance compared with the left diagram of the “ T MJ Disc Displacements” stabilization appliance: handout (appendix 3 ) may help readers to understand visually that, once the condyle is 1. The patient ’ s TMJ mechanical disturbance reduced, the patient can open from and close appears related to his or her pain. to that position without creating the normal 2. The TMJ noise is eliminated by placing joint noise. Practitioners should bear in mind the mandible in the recommended anterior that this clinically identifi ed mandibular location. location does not accurately identify the 3. The masticatory system feels more relaxed position for which all TMJs are fully reduced, or comfortable with the mandible located but is the technique that is traditionally used in the recommended anterior location. and provides clinically acceptable results for this appliance.1 0,11 This principle of temporarily altering a If the position does not eliminate the noise, joint so it functions in a more comfortable ask the patient to protrude the mandible position is similarly used to treat other musculoskeletal disorders in the body. 9 further and retest whether this position eliminates the TMJ noise. Once the noise is eliminated, ask the patient whether this is a MANDIBULAR POSITION AND more comfortable position than his or her INTEROCCLUSAL RECORD normal mandibular posture. If the chosen mandibular location For this appliance, the mandible should be eliminates the noise, but the position feels located where the condyle is reduced onto the uncomfortable to the patient, ask the patient disc and the masticatory system feels more to retrude the mandible slightly and retest relaxed or comfortable. The mandible cannot whether the noise continues to be eliminated be positioned excessively anterior, because but the position now feels comfortable. generally the more anterior the mandible is Experiment to fi nd the mandibular location at placed, the more strained the masticatory which the TMJ noise is eliminated and the system feels to the patient. I identify the masticatory system feels more relaxed or desired mandible location and make the comfortable. If such a mandibular location 200 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y can be identifi ed, this is the recommended location for the interocclusal record. If a mandibular location that meets these criteria cannot be identifi ed, for this patient an anterior positioning appliance will probably not be more effective than the stabilization appliance. If the anterior positioning appliance criteria are satisfi ed at the location where the anterior teeth meet end to end, this is a good location Figure 13.2. The maxillary anterior positioning to use, for at this location the practitioner can appliance occluding with opposing teeth. visualize whether the mandible returns to the same position and it provides a stable position for the patient to hold the mandible. If the identifi ed mandibular location is different than where the anterior teeth meet end to end, patients can usually feel the desired mechanical disc - condyle relationship within their TMJ and can also easily maintain or return to this location. The practitioner may desire that the patient practice opening from and closing to this position several times, so the patient does not have diffi culty fi nding this location while the interocclusal Figure 13.3. The maxillary anterior positioning record is made. appliance is constructed with a ramp. This ramp The interocclusal record can be made by prevents the patient’ s mandible from retruding behind the appliance and guides the mandible asking the patient to bite into softened wax or forward, into the desired position when the patient by syringing an interocclusal record material attempts to occlude. between the teeth, if the patient has a stable position to occlude while the material hardens. If the interocclusal record was made The maxillary anterior positioning with the teeth occluding, ask the laboratory appliance is constructed with a ramp technician to open the articulator’ s vertical immediately behind the mandibular anterior dimension approximately 1 mm. tooth contacts (Figure 1 3.3) . When people sleep, their muscles relax and the mandible tends to drift posterior. The ramp supports DESIGN AND ADJUSTMENTS the mandible as it drops posterior, helps to maintain the desired disc- c ondyle relationship, Similar to the stabilization appliance, the and guides the mandible forward into the anterior positioning appliance should cover all desired position when the patient attempts of the teeth in the arch, fi t comfortably over to occlude. A mandibular appliance can be them, and provide even occlusal contacts for constructed with a similar ramp, but there all of the opposing posterior teeth, and its is a greater tendency for patients to wear the external surface should fl ow smoothly mandibular appliance during the day, and (Figure 13.2 ). mandibular appliances tend to be less effective.7 C H A P T E R 1 3 A N T E R I O R P O S I T I O N I N G A P P L I A N C E 201 The appliance can be fabricated from any Therefore, position the mandible into the of the hard and intermediate materials, and its neutral position to determine how far the internal adjustments are made as described for patient can retrude the mandible. If the ramp the stabilization appliance. Its external is too short, add self - curing clear orthodontic adjustments are made by marking the acrylic to extend it. If the ramp is longer opposing tooth contacts with two sheets of than necessary, remove the excess portion black Accufi lm held with articulating forceps. (Figure 13.3 ). Place the forceps as described for the As the patient glides from the neutral stabilization appliance, at a slight angle in the position into the desired anterior position, mouth so the patient can mark the third use two sheets of black Accufi lm in the molar as well as the central incisor at the same articulating forceps to mark the opposing
time (see Figure 1 2.22) . anterior tooth contacts on the ramp. Some practitioners fabricate the posterior Repeatedly mark and adjust the ramp so it occlusal surface of this appliance with cuspal provides the patient even gliding marks along indentations into which the opposing teeth the ramp for the teeth, canine to canine. fi t, 12 whereas others recommend fabricating a Similar to the stabilization appliance, fl at posterior occlusal surface.8 Both are smooth the appliance and ensure the acceptable, but I prefer the fl at posterior appliance feels comfortable to the patient. occlusal surface because it is easier and faster for adjusting the appliance’ s occlusion. Repeatedly mark and adjust the appliance, APPLIANCE MANAGEMENT slowly developing even contacts from the opposing posterior teeth. Similar to the Originally anterior positioning appliances stabilization appliance, at least one contact were used to hold the mandible in the from each posterior tooth should be obtained, described anterior location for 24 hours a day and the anterior teeth should provide light or (including while eating). Over time, patients no marks in comparison with the posterior were generally not able to retrude their marks. Clinical experience has demonstrated mandible to MI because of myofi brotic that the appliance ’ s occlusion should be well contracture of the inferior lateral pterygoid adjusted to provide its maximal effect. muscle, proliferation of soft tissue posterior to the condyles, remodeling of condyles, and/or QUICK CONSULT dentoalveolar changes. 8,14,15 Adjusting Appliances After a period of time, the patient ’ s teeth Clinical experience has demonstrated that the were altered (through orthodontics and/or appliance ’ s occlusion should be well adjusted to prosthodontic reconstruction) so MI provide its maximal effect. coincided with this new mandibular location. Investigators following these cases observed Once the desired centric contacts are that, despite the extensive treatment provided, obtained, adjust the protrusive guidance ramp. patients could not maintain the desired It should be long enough that the mandibular disc - condyle relationship.1 3 anterior teeth cannot retrude behind it. If the The most comprehensive study I have read mandibular anterior teeth were to retrude that followed the posttreatment changes behind the ramp while the patient is sleeping, observed 12 patients who were fi rst provided he or she might clench in this unadjusted anterior positioning appliance therapy and location and exacerbate the symptoms. then orthodontics that established a stable 202 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y occlusion at the predetermined anterior occlude into MI, they should discontinue position. Comparing superimpositions of wearing this appliance, and the provider may the patients ’ cephalometric radiographs, the choose to convert the appliance into a investigator found that over time all of the stabilization appliance. patients had occlusal and TMJ changes, which Since the appliance was designed to hold included distal repositioning of the mandible, the mandible at the location where the intrusion of the maxillary molars, and masticatory system feels more relaxed or concomitant increase in overbite and overjet. 16 comfortable, some patients have a tendency to Therefore, it is recommended that patients wear their appliance 24 hours a day. If worn use the anterior positioning appliance only 24 hours a day, it may cause the patient to while they sleep and use their normal not be able to close into MI. This problem is mandibular position during the day. In this usually reversible if caught early, but is usually manner, patients can maintain their normal permanent if it is a long- s tanding condition. 18 MI and obtain TMD symptom relief by Therefore, instruct patients to wear this nighttime use. 7,8,13 One author indicates that appliance only while they sleep and closely nighttime wear appears to provide similar follow the cases to ensure they do not start to TMD symptom improvement as normally lose their ability to close into MI. obtained from 24 - hour wear.1 7 An easy technique for observing whether a patient is beginning to lose the ability to close FOCAL POINT into MI is to follow whether there is a change It is recommended that patients use the anterior among the opposing teeth that can hold shim positioning appliance only while they sleep and stock when the patient closes into MI (Figure use their normal mandibular position during 3.27 ). It is recommended that these cases be the day. followed every month, and it should be observed which opposing teeth can hold shim When patients fi rst wear the anterior stock. Some variations are normal, 19 but if a positioning appliance at night, they patient begins to lose the ability to close into commonly report that, once they have MI, the most posterior opposing teeth will removed the appliance upon waking, it takes start to lose their ability to hold shim stock. If up to an hour for their teeth to occlude into this occurs, the patient should immediately MI. Over the next month, this time generally discontinue wearing this appliance, and the progressively shortens. provider may choose to convert the anterior A small percentage of the patients will fi nd positioning appliance into a stabilization that it takes longer than several hours to close appliance. If only minimal changes have into MI, and this time may progressively occurred, these teeth should regain the ability lengthen. Clinically it has been observed that to hold shim stock. closing for a few seconds to minutes on a fl exible material (e.g., cotton roll, leaf gauge) QUICK CONSULT placed between the maxillary and mandibular Observing for Maximum central incisors generally retrudes the Intercuspation Changes mandible and greatly improves or resolves this An easy technique for observing whether a problem. For patients who continue to have a patient is beginning to lose the ability to close problem occluding into MI after several hours into MI is to follow whether there is a change of removing the appliance, out of fear that among the opposing teeth that can hold shim such patients may eventually not be able to stock when the patient closes into MI. C H A P T E R 1 3 A N T E R I O R P O S I T I O N I N G A P P L I A N C E 203 Since signifi cant complications are patient meets the anterior positioning associated with the anterior positioning appliance criteria and continues to have appliance, I do not view it as a potential signifi cant pain or TMJ locking after receiving long - term therapy. Once the pain and limited a stabilization appliance and other range of motion have adequately resolved, the conservative therapies, then it would be appliance should gradually be discontinued or appropriate to consider an anterior positioning replaced with a stabilization appliance. I ask appliance.8 patients who have been wearing an anterior positioning appliance for a year to stop FOCAL POINT wearing it so we can test what occurs when It is recommended practitioners use the they do not wear it. I expect to observe one stabilization appliance prior to using the anterior of three situations: (1) Their pain does not positioning appliance, because the stabilization reappear, suggesting they no longer need an appliance has minimal associated complications appliance. (2) They have only morning pain and patients who meet the anterior positioning without the appliance, so the appliance is appliance criteria typically do well with a converted into a stabilization appliance to stabilization appliance. treat this pain. (3) Their mechanical symptoms and pain return, so they continue Counsel patients who are to receive an to wear their anterior positioning appliance anterior positioning appliance about potential and their cases are followed monthly. complications associated with it and the importance of returning for their follow - up QUICK CONSULT appointments. I have had considerable Using Anterior Positioning diffi culty with some patients returning for Appliances their required follow - up appointments, especially those who have responded quite Since there are signifi cant complications well with the appliance. Therefore, prior to associated with the anterior positioning delivering this appliance, it is recommended appliance, I do not view it as a potential long - that a statement be typed in the patient ’ s term therapy. record that the patient is advised that, if he or she does not return for follow- u p Practitioners should bear the following in appointments, the patient should discontinue mind: (1) Anterior positioning appliance wearing this appliance, and have the patient therapy is not intended to correct the disc- sign this entry. condyle relationship, but to facilitate the reduction in TMD symptoms, similar to other conservative TMD treatments.2 0 (2) REFERENCES Even though a patient meets the anterior positioning appliance criteria, a stabilization 1. Dylina TJ . A common - sense approach to splint appliance is generally similarly effective in therapy. J Prosthet Dent 2 001; 8 6: 5 39– 5 45. 2. N itzan D W. A rthrocentesis for management of reducing a patient ’ s symptoms. 3,5,6 Since the severe close lock of the temporomandibular joint . anterior positioning appliance needs to be Oral Maxillofac Surg Clin North Am 1994 ; 6 : 245 – carefully followed for complications whereas 257 . the stabilization appliance has minimal 3. Behr M , Stebner K , Kolbeck C , Faltermeier A , complications, it is recommended that the Driemel O , Handel G . Outcomes of stabilization appliance be used fi rst. If the temporomandibular joint disorder therapy: 204 P A R T I I I O C C L U S A L A P P L I A N C E T H E R A P Y Observations over 13 years . Acta Odontol Scand magnetic resonance imaging. E ur J Orthod 2007 ; 65 ( 5 ): 249 – 253 . 2002 ; 24 ( 4 ): 343 – 352 . 4. Tecco S , Festa F , Salini V , Epifania E , D ’ Attilio M . 12. Anderson GC , Schulte JK , Goodkind RJ . Treatment of joint pain and joint noises associated Comparative study of two treatment methods for with a recent TMJ internal derangement: A internal derangement of the temporomandibular comparison of an anterior repositioning splint, joint . J Prosthet Dent 1985 ; 53 ( 3 ): 392 – 397 . a full - arch maxillary stabilization splint, and an 13. Clark GT , Minakuchi H . Oral appliances . In: untreated control group . Cranio 2004 ; 22 ( 3 ): Laskin DM , Greene CS , Hylander WL . 209 – 219 . Temporomandibular Disorders: An Evidence - Based 5. Anderson GC , Schiffman EL , Decker KL , Hodges Approach to Diagnosis and Treatment . Hanover J . Randomized clinical trial for TMJ disk Park, IL : Quintessence , 2006 : 377 – 390 . displacement with reduction. J Dent Res (Special 14. Baltromejus S , Ruf S , Pancherz H . Effective Issue) 1999 ; 78 : 292 , abstract no. 1492. temporomandibular joint growth and chin position 6. Fricton J . Current evidence providing clarity in changes: Activator versus Herbst treatment. A management of temporomandibular disorders: cephalometric roentgenographic study. E ur J Summary of a systematic review of randomized Orthod 2002 ; 24 ( 6 ): 627 – 637 . clinical trials for intra - oral appliances and occlusal 15. Von Bremen J , Pancherz H . Effi ciency of early and therapies . J Evid Based Dent Pract late Class II Division 1 treatment . Am J Orthod 2006 ; 6 ( 1 ): 48 – 52 . Dentofacial Orthop 2002 ; 121 ( 1 ): 31 – 37 . 7. American Academy of Orofacial Pain . de Leeuw R 16. Joondeph DR . Long - term stability of orthopedic (ed). O rofacial Pain: Guidelines for Assessment, repositioning . Angle Orthod 1999 ; 69 : 201 – Diagnosis and Management , 4th ed. Chicago : 209 . Quintessence , 2008 : 169 – 170 . 17. Schiffman EL . Recent advances: Diagnosis and 8. Okeson JP . Management of Temporomandibular management of TMJ disorders . In: Hardin JF (ed). Disorders and Occlusion , 6th ed. St Louis : CV Clark ’
s Clinical Dentistry , vol. 2 . Philadelphia : JB Mosby , 2008 : 414 , 485 – 486 . Lippincott , 1998 : 1 – 5 . 9. McCue FC , Hussamy OD , Gieck JH . Hand and 18. Kai S , Kai H , Tabata O , Tashiro H . The wrist injuries . In: Zachazewski JE , Magee DJ , signifi cance of posterior open bite after anterior Quillen WS . Athletic Injuries and Rehabilitation . repositioning splint therapy for anteriorly displaced Philadelphia : WB Saunders , 1996 : 585 – 597 . disk of the temporomandibular joint. C ranio 10. Kurita H , Kurashina K , Ohtsuka A , Kotani A . 1993 ; 11 ( 2 ): 146 – 152 . Change of position of the temporomandibular joint 19. Anderson GC , Schulte JK , Aeppli DM . Reliability disk with insertion of a disk - repositioning appliance . of the evaluation of occlusal contacts in the Oral Surg Oral Med Oral Pathol Oral Radiol intercuspal position. J Prosthet Dent Endod 1998 ; 85 ( 2 ): 142 – 145 . 1993 ; 70 ( 4 ): 320 – 323 . 11. Eberhard D , Bantleon HP , Steger W . The effi cacy 20. Attanasio R . Intraoral orthotic therapy . Dent Clin of anterior repositioning splint therapy studied by North Am 1997 ; 41 ( 2 ): 309 – 324 . Part IV Multidisciplinary Treatment Approach Occlusal appliance therapy is only one of a multitude of therapies available to treat TMD. Since TMD is a multifactorial disorder (having many etiologic factors), many therapies have been shown to have a positive impact on an individual patient’ s TMD symptoms. 1 – 3 FOCAL POINT Occlusal appliance therapy is only one of a multitude of therapies available to treat TMD. Physicians, physical therapists, chiropractors, massage therapists, and others treating the muscles and/or cervical region report positive responses to treatment of TMD symptoms. 4 – 7 Psychologists working with relaxation, stress management, cognitive - behavioral therapy, and other psychological aspects report reducing TMD symptoms with their therapies.1 ,2,8 Orthodontists, prosthodontists, and general dentists observe a positive impact on TMD symptoms by improving the occlusal stability.9 – 11 Surgeons report TMD symptom reduction from different TMJ surgical approaches. 12 – 14 Medications as well as self - management strategies used for other muscles and joints in the body have also been shown to reduce TMD symptoms.1 ,2,15 The literature advocates a large number of potentially reversible conservative therapies to treat TMD patients. Not all TMD therapies are equally effective, and no one treatment has been shown to be best for all TMD patients. By using the information obtained from the patient interview and clinical exam, practitioners can select the most cost - effective 205 206 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H evidence - based therapies that have the greatest potential for providing long - term symptom relief for a particular patient. Many of the therapies act through different mechanisms, enabling a practitioner to use multiple therapies simultaneously, which provides a synergistic effect. The most successful treatments often focus on therapies that decrease a patient ’ s perpetuating contributing factors, which have kept the body from resolving the symptoms on its own.1 ,15 These TMD management concepts are consistent with treatment of other orthopedic and rheumatologic disorders. 1,15,16 FOCAL POINTS Many of the therapies act through different mechanisms, enabling a practitioner to simultaneously use multiple therapies, which provides a synergistic effect. The most successful treatments often focus on therapies that decrease a patient’ s perpetuating contributing factors, which have kept the body from resolving the symptoms on its own. Most TMD patients can be successfully managed by general practitioners, 16 and TMD patients who receive TMD therapy obtain signifi cant symptom relief, whereas patients who do not receive treatment have minimal symptom change.3 ,17 A practitioner ’ s experience and expertise, and the availability of modalities, may impact the treatment plan. While practitioners evaluate their patients, they must be cognizant that many disorders outside of the dentist’ s realm of treatment can contribute to the perpetuation of TMD symptoms, e.g., widespread pain, neck pain, rheumatic disorders, poor sleep, or depression. Identifying (as delineated in chapter 2 , “ Review of the ‘ Initial Patient Questionnaire ’ ” ) and obtaining appropriate therapy for these disorders should greatly enhance the TMD symptom relief practitioners can obtain.1 ,15 A patient ’ s prognosis is often related to the length of time the problem has been present, the frequency and severity of the pain, the presence of other chronic pains, the degree of psychosocial contribution, the patient’ s previous response to therapy, and the patient ’ s compliance. 18 – 20 Patients do not follow through with many of our recommendations; in fact one study found their TMD patients had a mean compliance rate of 54%. 21 This is the reason I generally make a list of the recommended therapies for the patient, discuss them with the patient, and let the patient decide which he or she plans to use. I prefer to know the patient’ s plans, P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H 207 enabling me to document this in the record and saving me from writing unnecessary referrals or prescriptions. Educating the patient and a good patient - practitioner relationship are important factors in improving patient compliance. The time spent educating a patient is a signifi cant factor in developing a high level of rapport and treatment compliance.1 ,22 The time should be appropriate to educate the patient on clinical fi ndings, diagnostic data, treatment options, and prognosis. This may require the practitioner or a trained staff member to show drawings to the patient, such as the “ TMJ Disc Displacements ” diagram in appendix 3 . REFERENCES disorders: A literature review. B ehav Med 2007 ; 33 ( 3 ): 101 – 118 . 1. American Academy of Orofacial Pain . de Leeuw R 9. Luther F . TMD and occlusion part I. Damned if (ed). O rofacial Pain: Guidelines for Assessment, we do? Occlusion: The interface of dentistry and Diagnosis and Management , 4th ed. Chicago : orthodontics . Br Dent J 2007 ; 202 ( 1 ):E 2 . Quintessence , 2008 : 133 – 175 . 10. Georgaklis C , Georgaklis G . Occlusal change 2. Clark GT . Classifi cation, causation and treatment through orthodontics in TMD patients . Dent of masticatory myogenous pain and dysfunction . Today 2007 ; 26 ( 10 ): 108 - 9 . Oral Maxillofac Surg Clin North Am 2008 11. Dawson PE . Functional Occlusion: From TMJ to May; 20 ( 2 ): 145 – 157 , v. Smile Design . St Louis : CV Mosby , 2007 : 4 – 5 . 3. Gaudet EL , Brown DT . Temporomandibular 12. Schiffman EL , Look JO , Hodges JS , Swift JQ , disorder treatment outcomes: First report of a large Decker KL , Hathaway KM , Templeton RB , Fricton scale prospective clinical study . Cranio 2000 ; 18 ( 1 ): JR . Randomized effectiveness study of four 9 – 22 . therapeutic strategies for TMJ closed lock . J Dent 4. DeBar LL , Vuckovic N , Schneider J , Ritenbaugh C . Res 2007 ; 86 ( 1 ): 58 – 63 . Use of complementary and alternative medicine for 13. Montgomery MT , Gordon SM , Van Sickels JE , temporomandibular disorders . J Orofac Pain 2003 ; Harms SE . Changes in signs and symptoms 17 ( 3 ): 224 – 236 . following temporomandibular joint disc 5. Devocht JW , Long CR , Zeitler DL , Schaeffer W . repositioning surgery . J Oral Maxillofac Surg Chiropractic treatment of temporomandibular 1992 ; 50 ( 4 ): 320 – 328 . disorders using the activator adjusting instrument: A 14. Montgomery MT , Van Sickels JE , Harms SE . prospective case series . J Manipulative Physiol Ther Success of temporomandibular joint arthroscopy in 2003 ; 26 ( 7 ): 421 – 425 . disk displacement with and without reduction. O ral 6. McNeely ML , Armijo Olivo S , Magee DJ . A Surg Oral Med Oral Pathol 1991 ; 71 ( 6 ): 651 – 659 . systematic review of the effectiveness of physical 15. Fricton J . Myogenous temporomandibular therapy interventions for temporomandibular disorders: Diagnostic and management disorders . Phys Ther 2006 ; 86 ( 5 ): 710 – 725 . considerations . Dent Clin North Am 2007 7. Wright EF , Domenech MA , Fischer JR Jr . Jan; 51 ( 1 ): 61 – 83 . Usefulness of posture training for TMD patients . 16. Ats ü SS , Ayhan - Ardic F . Temporomandibular JADA 2000 ; 131 ( 2 ): 202 – 210 . disorders seen in rheumatology practices: A review. 8. Orlando B , Manfredini D , Salvetti G , Bosco M . Rheumatol Int 2006 ; 26 ( 9 ): 781 – 787 . Evaluation of the effectiveness of biobehavioral 17. Egermark I , Carlsson GE , Magnusson T . A 20 - year therapy in the treatment of temporomandibular longitudinal study of subjective symptoms of 208 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H temporomandibular disorders from childhood to 20. Garofalo JP , Gatchel RJ , Wesley AL , Ellis E . III adulthood . Acta Odontol Scand 2001 ; 59 ( 1 ): 40 – 48 . Predicting chronicity in acute temporomandibular 18. Rammelsberg P , LeResche L , Dworkin S , Mancl L . joint disorders using the Research Diagnostic Longitudinal outcome of temporomandibular Criteria . JADA 1998 ; 129 ( 4 ): 438 – 447 . disorders: A 5- y ear epidemiologic study of muscle 21. Wig AD , Aaron LA , Turner JA , Huggins KH , disorders defi ned by research diagnostic criteria for Truelove E . Short - term clinical outcomes and temporomandibular disorders. J Orofac Pain patient compliance with temporomandibular 2003 ; 17 ( 1 ): 9 – 20 . disorder treatment recommendations. J Orofac Pain 19. Raphael KG , Marbach JJ , Klausner J . Myofascial 2004 ; 18 ( 3 ): 203 – 213 . face pain: Clinical characteristics of those with 22. Carlson CR . Psychological considerations for regional vs. widespread pain . JADA 2000 ; 131 ( 2 ): chronic orofacial pain. Oral Maxillofac Surg Clin 161 – 171 . North Am 2008 May; 20 ( 2 ): 185 – 195 , vi. Chapter 14 Self - Management Therapy FAQ Q: What do you do when a patient cannot control his or her daytime habits or muscle tension adequately to reduce the daytime symptoms satisfactorily? A: Some patients cannot adequately control their daytime habits or muscle tension to reduce their daytime symptoms satisfactorily. Most of these patients are referred to a psychologist for additional help with changing these, especially if other psychosocial needs are observed. Self - management therapy encompasses 40% reduction in TMD pain from their procedures patients are instructed to perform use.2 ,3 Another study compared self - on themselves. They are convenient and management therapy and their usual TMD inexpensive, compared with patients going therapy, among TMD patients with minimal to practitioners ’ offi ces to receive therapy. psychosocial contributing factors, and found Patients generally select and use the portions no therapeutic difference between the that they personally fi nd most convenient therapies.4 and effective. A survey found approximately Once I complete my initial examination on two - thirds of TMD patients provided self - a nonemergency TMD patient, I educate the management instructions were
using various patient about his or her disorder, discuss the portions 1 month later.1 causes for the disorder (e.g., muscle tension, overloading the TMJ), and perpetuating QUICK CONSULT contributing factors (e.g., neck pain, stress). I Using Self- Management Therapies then discuss treatment options and begin with Self - management therapies are convenient and written self - management therapies.4 ,5 After inexpensive, compared with a patient going to a discussing treatment options, a surprising practitioner ’ s offi ce to receive the therapy. number of my patients choose to try the self - management therapies and escalate These therapies may be very benefi cial; two therapy if they do not obtain suffi cient studies reported TMD patients obtained a symptom relief. 209 210 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H Clinical experience has shown that the frequently use it.1 In one study of TMD amount of improvement patients obtain from self - management therapies, massage was the self - management therapy varies greatly.2 It is most often used therapy (24% used it for speculated this variation is primarily due to their TMD pain) and found to be the most the patient compliance. The practitioner or a helpful self - management therapy (61% trained staff member needs to initially instruct reported it as very or extremely benefi cial).7 As and often motivate the patient to perform the patients or massage therapists massage the self - management therapies. Once the patient muscles, they often notice tender knots within discovers the benefi t that is obtained by using the muscles (trigger points). If these trigger them, he or she tends to be more self - motivated. points are compressed or kneaded (often performed with the thumb or knuckle), they QUICK CONSULT generally inactivate the trigger point and the Implementing Self - Management muscle pain decreases. Therapies The symptom improvement obtained from The practitioner or a trained staff member needs massage is only temporary, just as one would to initially instruct and often motivate the patient not expect permanent benefi ts from taking a to perform the self - management therapies. muscle relaxant or performing an exercise. Since the benefi ts are temporary, patients who go to a massage therapist must continually This chapter provides many self - return for repeated massages to maintain the management therapies. It begins by discussing benefi ts. On the other hand, patients who are the self - management instructions (appendix 4 , instructed to perform their own muscle “ TMD Self - Management Therapies ” ) that I massage may derive benefi ts similar to those give almost every patient who is diagnosed achieved by a therapist, but without the with TMD, and is followed by self- expense and loss of time. management therapies that are provided to TMD patients whose pain is primarily of patients with specifi c conditions. muscle origin are more likely to benefi t from massage therapy, and a practitioner may desire SELF - MANAGEMENT INSTRUCTIONS to encourage patients to massage the painful areas of their masseter, temporalis, and/or A recommended self - management instructions neck muscles multiple times throughout the handout is provided in appendix 4 , “ T MD day. Some patients fi nd additional benefi t Self - Management Therapies. ” It begins with a by massaging their muscles with one of the short background about TMD, providing over - the - counter topical muscle creams, information that patients used to often ask e.g., Icy Hot (which should not be used in me. After the self- m anagement instructions, combination with capsaicin). the handout informs patients that TMD cannot be “ c ured” but has to be managed, the TECHNICAL TIP treatments are not fully predictable, and the Massaging Muscles treatment plan may need to be altered based TMD patients whose pain is primarily of muscle on a patient ’ s treatment response. origin are more likely to benefi t from massage The self - management instructions begin therapy, and a practitioner may desire to and with massage,6 because TMD patients fi nd encourage patients to massage the painful areas massage provides a high degree of pain relief, of their masseter, temporalis, and/or neck pain control, and acceptability, and they muscles multiple times throughout the day. C H A P T E R 1 4 S E L F - M A N A G E M E N T T H E R A P Y 211 Many TMD patients have additional trigger but those with severe pain (9/10 or above) points in the neck and shoulders. A common seem to fi nd heat aggravates their pain, and technique to compress cervical trigger points so prefer cold. Other patients fi nd their is to take two tennis balls and tie them symptoms respond best by alternating together (using duct tape or placing them in a between heat and cold. sock with a knot tied at the end to keep them together). The patient lies on the fl oor and TECHNICAL TIP positions the tennis balls so the neck is Recommending balanced between the two balls and the cervical Physiotherapeutics trigger points are compressed. Trigger points Empirically most TMD patients appear to prefer in the shoulder can be similarly compressed heat, but those with severe pain (9/10 or above) by the patient lying on a single tennis ball. seem to fi nd heat aggravates their pain, and so prefer cold. Other patients fi nd their symptoms TECHNICAL TIP respond best by alternating between heat and Compressing Cervical cold. Trigger Points A common technique to compress the cervical One study that compared a moist heating trigger points is for the patient to take two tennis pad to moist towels found that almost twice balls, tie them together (i.e., using duct tape), lie the percentage of patients using the moist on the fl oor, position the tennis balls so the neck heating pad did not require any additional is balanced between the two balls, and apply treatment (Figure 14.1 ).1 0 It is speculated the pressure onto the cervical trigger points. response difference is due to the heating pad maintaining the tissue at a consistently high Similar to muscle massage, trigger- point temperature, whereas the towels cool down compression is only a temporary therapy that with time. Based on this study, I recommend needs to be continually repeated. To keep the patients use a heating pad rather than a device inactivated trigger points from reactivating, that cools over time. the contributing factors perpetuating the Another study compared the intraoral disorder have to be identifi ed and adequately buccal mucosa temperatures obtained by using controlled.8 ,9 The most common perpetuating moist and dry heating pads over the cheek. 11 factors for trigger points are the cumulative The authors found there was no difference effect of long - standing repetitive overuse of between the two methods, but a few patients the muscle, chronic muscle tension, and did prefer the moist to the dry heat. emotional stress. For the masticatory system, Understanding that compliance is related to repetitive overuse would most likely be from the complexity of the requested procedure parafunctional habits, whereas, for the cervical and that dry heat is simpler to use, I inform region, it would most likely be from poor patients that a dry heating pad works just as posture. 8 well as a moist heating pad, but it is fi ne to Home physiotherapeutics can involve using use moist heat if the patient prefers. 5 heat, cold, or alternating between heat and Patients use many methods for applying cold. No study has compared which is better cold. Some desire to apply an ice cube directly for TMD patients, for specifi c TMD to their skin, others prefer to wrap it in a diagnoses, or for specifi c situations (other than wash cloth, etc. Patients who routinely use the use of cold following trauma). Empirically cold seem to prefer to take a bag of frozen most TMD patients appear to prefer heat, 9 peas, loosen the peas by hitting the bag with 212 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H Figure 14.1. A higher percentage of TMD patients related that they did not need any additional therapy following sequential use of a moist heating pad compared to moist hot towels.1 0 the heel of their hand, wrap the bag in a have diffi culty sleeping. A survey of over wash cloth, and apply it to their skin. These 3,000 individuals found an association patients generally mark the bag in some between the amount of caffeine consumed manner so they do not later accidentally cook and headaches (Figure 1 4.2) , and the amount these peas for a meal. of caffeine consumed and insomnia Many TMD patients fi nd that eating tough (Figure 14.3 ).1 4 or chewy foods aggravates their TMD Clinically one well - known muscle symptoms. Some patients observe that researcher concluded that two or more cups of simultaneously chewing on both sides of coffee or cans of soda a day aggravate muscle the mouth reduces their normal symptom trigger points (the most common source of aggravation. Therefore, patients are advised to TMD pain). 9 The amount of caffeine in eat a moderately soft diet, cut other foods into beverages varies greatly.1 3 As a general guide, I small pieces, and try evenly dividing the food tell patients that a cup of coffee, a can of on both sides of their mouth and chewing on soda, and two cups of ice tea or hot tea are both sides. Some patients with very severe equivalent. It is recommended that TMD pain may prefer to drink Ensure® or patients reduce their caffeine consumption to Sustacal ® , or place their food in a blender no more than one cup of coffee, one can of and drink it. soda, or two cups of tea a day. Caffeine has positive qualities associated Many caffeine consumers have developed a with consuming it, e.g., increased alertness, chemical dependency to their caffeine intake more positive mood, and improved and know that they will develop a severe performance on a number of tasks. 12 It may headache if they do not drink suffi cient also have negative qualities associated with its caffeine. 15 These patients can reduce their consumption, e.g., increased anxiety, muscle caffeine consumption slowly without activity, headaches, and insomnia. 13 Many developing headaches or tiredness. It has been individuals can relate to the increased muscle observed that patients consuming more than a activity and insomnia effects because they pot of coffee a day can usually reduce have experienced consuming too much consumption to one pot a day without caffeine, which caused them to shake from developing these problems. These patients are uncontrollable muscle contractions and/or asked to maintain that level for 1 week. It has C H A P T E R 1 4 S E L F - M A N A G E M E N T T H E R A P Y 213 Figure 14.2. Correlation with caffeine consumption (100 mg of caffeine is in one standard brewed cup of coffee) and headaches prevalence.1 4 Figure 14.3. Correlation with caffeine consumption (100 mg of caffeine is in one standard brewed cup of coffee) and insomnia prevalence.1 4 been observed also that these patients and of their caffeine consumption. I ask all those on lower amounts of caffeine can patients to attempt to reduce their usually reduce consumption by one cup of consumption to no more than one cup of coffee or can of soda a week without coffee, one can of soda, or two cups of tea a developing caffeine withdrawal symptoms. day, and hold this consumption level during The TMD symptom response from treatment. They are informed that, once decreasing caffeine consumption is quite treatment is complete, they are welcome to variable. Some patients report no change, resume consuming caffeine at whatever level whereas
others have a dramatic reduction or they prefer but should observe for any increase even elimination of their TMD symptoms. in their TMD symptoms related to this. With Empirically, patients who consume higher this knowledge, they can make an educated doses of caffeine appear to be more likely to decision about the amount of caffeine they have a more favorable response to restriction want to consume. 214 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H QUICK CONSULT grinding habits, especially while they are busy, Restricting Caffeine Consumption irritated, driving a car, using a computer, or Empirically, patients who consume higher doses concentrating. Therefore, patients are asked to of caffeine appear to be more likely to have a learn to keep their jaw muscles relaxed, teeth more favorable response to restriction of their separated, and tongue lightly resting on the caffeine consumption. roof of the mouth just behind their upper front teeth. Some individuals tend to tighten their Occasionally, I have an argumentative masticatory muscles or clench their teeth patient who insists the teeth are supposed to when they are busy, irritated, driving a car, be together. I ask these patients to lightly rest using a computer, or concentrating. their head against the headrest, close their Clenching or grinding the teeth requires the eyes, take a in deep cleansing breath, let it masticatory muscles to contract and often out, and concentrate on relaxing their jaw loads the TMJs. Many studies report muscles as much as possible. After 5– 1 0 correlations between masticatory muscle seconds I ask them whether their teeth are activity (even prolonged low- i ntensity activity) together and invariably they say “ n o.” I ask and TMD pain.1 6 – 20 them to open their eyes and sit up, and we talk about how they must always be holding some tension in their jaw muscles and when QUICK CONSULT Informing Patients of Tendencies they become busy, they probably squeeze their S teeth together. ome individuals tend to tighten their masticatory muscles or clench their teeth when they are busy, irritated, driving a car, using a QUICK CONSULT computer, or concentrating. This may be a Asking Patients to Observe primary contributor to masticatory muscle pain for Habits and/or TMJ infl ammation. Some TMD patients relate they rest their teeth together only lightly, but frequently unconsciously squeeze their teeth together when At the initial appointment, patients may they are busy, irritated, driving a car, using a realize that they lightly rest their teeth computer, or otherwise concentrating. together, but generally are not aware that during these times of stress, their thoughts are on this stressor, so they do not realize that Additionally patients are instructed to they are holding tension in their masticatory observe for, and avoid, habits that put muscles or squeezing their teeth together. unnecessary strain on the masticatory muscles Patients who have neck or shoulder pain often and TMJs, e.g., resting the mandible on the know they tend to hold excessive tension in hand or biting their cheeks, lips, fi ngernails, the locations of their pain. For these patients, cuticles, or any other objects they may put in it is often helpful to use the comparison that their mouth. holding tension in the neck or shoulders Posture appears to play a role in TMD similarly contributes to their pain as holding symptoms, so patients are asked to maintain tension in the masticatory system. good head, neck, and shoulder posture. They In an attempt to try to break these habits, are requested to be especially vigilant of their patients are instructed to monitor themselves posture while using a computer and to avoid closely for holding tension, clenching, or poor postural habits, such as cradling a C H A P T E R 1 4 S E L F - M A N A G E M E N T T H E R A P Y 215 telephone against their shoulder. Posture- that this handout will be reviewed with the improving exercises are provided in appendix patient, a few potential contributing factors 7 , “ Posture Improvement Exercises, ” and (e.g., caffeine consumption or sleeping discussed further in “ Posture Exercises ” in this posture) were not asked about in the initial chapter. patient questionnaire, and it was assumed they Patients are informed that their sleep would be identifi ed at this time. This review posture is also important. They are requested may be performed by any staff member to avoid positions that strain their neck or trained to provide this education.2 2 jaw, such as occurs with stomach sleeping. If they sleep on their side, they are asked to TECHNICAL TIP position their head so their cervical spinal Motivating Patients to Perform column is in alignment with the rest of their Self - Management Instructions spinal column and their mandible is in To emphasize its importance, motivate the alignment with the skull. patient, and explain any confusion with Studies show that relaxation is benefi cial for reducing TMD symptoms. 1,21 performing these procedures, it is strongly Patients are recommended that the handout be reviewed with requested to set aside time once or twice a day the patient. to relax and drain the tension from their jaw and neck. Patients often benefi t from simple relaxation techniques such as sitting in a quiet FOCAL POINT room while listening to soothing music, Based on the assumption that this handout will taking a warm shower or bath, and slow deep be reviewed with the patient, a few potential breathing. Relaxing in this manner generally contributing factors (e.g., caffeine consumption not only reduces the pain but also enables or sleeping posture) were not asked about in the patients to become aware of what tense and initial patient questionnaire, and it was assumed relaxed muscles feel like and to develop the they would be identifi ed at this time. capability to reduce their muscle tension immediately whenever they notice the muscles Clinical experience has demonstrated there are tight. is great variation in the effectiveness of the Many TMD patients fi nd that opening TMD self - management instructions and it is their mouth wide, such as in yawning, yelling, believed this difference is related to patient or prolonged dental procedures, aggravates motivation. Here are a few techniques that their TMD symptoms. Therefore, patients are may instill greater patient compliance: (1) give requested to avoid these activities. patients follow- u p appointments at which Over - the - counter medications usually they know they will be asked about provide only minor TMD symptom relief. performing the therapies; (2) obtain a promise Patients who fi nd these benefi cial are that they will perform the therapy as instructed to take them as needed, but to requested; and (3) have them determine avoid those that have caffeine (e.g., Anacin, another routinely performed activity that will Excedrin, and Vanquish). trigger them to do these therapies. For To emphasize its importance, motivate the example, if a patient decides to use the patient, and explain any confusion with heating pad while watching a nightly performing these procedures, it is strongly television program, hopefully when the show recommended that the handout be reviewed is broadcast it will remind the patient to apply with the patient. Based on the assumption the heating pad. 216 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H CLOSURE MUSCLE - STRETCHING EXERCISE uses the opening muscles (lateral pterygoid, anterior digastric, and posterior digastric) to Studies suggest that providing a TMD patient stretch the closure muscles; if a patient’ s pain whose pain is primarily in a closure muscle is primarily in an opening muscle, this (masseter, temporalis, and/or medial exercise may aggravate the symptoms. pterygoid) with stretching exercises will Additionally, if a patient has signifi cant TMJ decrease the TMD pain and increase the infl ammation, the exercise may aggravate the range of motion. 23 – 26 One study demonstrated TMJ, so it is recommended that this exercise that the amount of improvement derived from not be provided to patients who have stretching exercises was comparable to that signifi cant opening muscle or TMJ pain. A obtained from an occlusal appliance. 25 The lateral pterygoid muscle- s tretching exercise is closure muscles are often major contributors provided in the next section. to TMD pain. Appendix 6 , “ Closure Muscle - Stretching Exercise, ” is a recommended stretching - exercise handout for these closure TECHNICAL TIP muscles. As with the self- m anagement Prescribing Stretching Exercise instructions, a trained staff member can If a patient has signifi cant TMJ infl ammation, effectively educate a patient and follow the the stretching exercise may aggravate the TMJ, patient’ s use of the jaw exercises. 25 so it is recommended that this exercise not be provided to patients who have signifi cant TMJ pain. FOCAL POINT Studies suggest that providing a TMD patient whose pain is primarily of muscle origin with stretching exercises will decrease the TMD pain The benefi ts derived from stretching and increase the range of motion. exercises appear to be increased by patients applying heat to the area prior to stretching. A study compared the increase in range of If a patient is reluctant to try stretching, it motion of the shoulder when heat was applied can be helpful to introduce the concept by to the area before stretching, when stretching explaining that the pain in these muscles is was followed by an ice pack, when heat was most probably due to their overuse, secondary applied before stretching followed by an ice to excessive parafunctional activity or excessive pack, when stretching only, and when there tension. As with an individual with leg muscle was no stretching (control) (see Figure 14.4 ). pain secondary to jogging, an initial therapy The results suggest applying heat prior to for the muscle would be to stretch it prior to stretching exercises provides the greatest and after exercising. Since the patient may improvement.2 7 Therefore, if a patient be performing the parafunctional activity performs this exercise and is using heat on the or maintaining excessive muscle tension painful closure muscles, encourage performing throughout the day and night, the patient this exercise after suffi ciently warming the may have the best results from stretching the muscle. Some TMD patients warm their closure muscles periodically throughout the painful closure muscles with hot shower day. water. For patients who do this, similarly This exercise is exclusively for patients who encourage performing the exercise after have painful closure muscles. This exercise warming the muscle in this manner. C H A P T E R 1 4 S E L F - M A N A G E M E N T T H E R A P Y 217 Figure 14.4. Heat followed by a stretch exercise is more effective than stretching followed by ice; heat stretching, then ice; stretching only; or not using any of these.2 7 Figure 14.5. Stretching the lateral pterygoid muscle. LATERAL PTERYGOID MUSCLE - STRETCHING practitioner should place his or her thumb on EXERCISE the most posterior ipsilateral mandibular teeth and wrap the fi ngers around the mandible, The lateral pterygoid muscle can be stretched as depicted in Figure 1 4.5. Use of either the to reduce pain and/or tightness within it. 28 dominant or the nondominant hand may To stretch the lateral pterygoid muscle, the be preferred. Some practitioners like to place 218 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H gauze between the teeth and their thumb to this exercise by performing it after the area prevent discomfort from pressing on the cusp has been warmed suffi ciently. tips. POSTURE EXERCISES TECHNICAL TIP Stretching the Lateral Poor posture is extremely common among the Pterygoid Muscle general population
and appears to be an To stretch the lateral pterygoid muscle, the adaptive, self - perpetuating trait for which practitioner should place his or her thumb on the individuals lack the cognitive ability or desire most posterior ipsilateral mandibular teeth and to self - correct. Forward head posture, the wrap the fi ngers around the mandible, as most common form of poor posture, is very depicted in Figure 14.5 . prevalent among TMD patients2 9 and might contribute to cervical pain. 30,31 With this The practitioner should push down with posture, the head’ s center of gravity is forward the thumb and pull up on the chin. This of the spine ’ s weight - bearing axis, increasing rotates the mandible, distracts the condyle, the strain within the posterior cervical and provides more room to mobilize the muscles, ligaments, and apophyseal joints. 32 condyle. While distracting the condyle, slowly Posture training usually entails exercises push the mandible posteriorly up to that are repetitively performed within the approximately 4 pounds of force and hold for pain - free range to stretch structures that poor about 30 seconds. Release the force, but posture tends to shorten, strengthen structures maintain the hand position on the mandible. that poor posture tends to weaken, and create After about 10 seconds, repeat the 30- s econd a cognitive awareness of the new desired stretch of the lateral pterygoid muscle and posture. 24,33,34 Patients are asked to try to perform the stretch six times. Ask the patient maintain this new posture, which is thought to practice this stretch on himself or herself to prevent them from being in positions that and provide advice on performing the cause undue stress, microtrauma, and overuse maneuver as needed. on structures of the head and neck. Patients who have TMJ infl ammation may In a randomized clinical trial, the exercises aggravate their pain when pushing the provided in appendix 7 , “ Posture mandible posteriorly and thus may need to Improvement Exercises, ” were found to modulate the force of the stretch so the TMJ improve TMD and neck symptoms infl ammation is not aggravated. Patients are signifi cantly. The treatment group received asked to perform a series of six stretches, six these posture exercises and the self - times a day, holding each stretch for management instructions in appendix 4 , approximately 30 seconds. whereas the control group received only the Anatomically it would appear the lateral self - management instructions. The treatment pterygoid muscle is too deep for superfi cial group reported a mean reduction in their heat to be benefi cial, but patients with a TMD and neck symptoms of 42% and 38%, lateral pterygoid muscle disorder continually whereas the control group reported a mean report its use is benefi cial. As described for the reduction of 8% and 9%, respectively (Figure closure muscles (appendix 6 , “ Closure Muscle - 14.6 ). TMD patients who held their head Stretching Exercise ” ), patients who use heat further forward relative to the shoulders over this area should have better results with (having greater forward head posture) were C H A P T E R 1 4 S E L F - M A N A G E M E N T T H E R A P Y 219 Figure 14.6. (New Graph, 14- 6.jpg): Posture exercise and TMD self- management instructions provide greater TMD and neck pain relief than TMD self - management instructions alone.3 2 signifi cantly more likely to derive TMD Clinically this new cognizance can be combined symptom improvement from posture training easily with other self- m onitoring that should and self - management instructions.3 2 improve TMD symptoms, e.g., continually monitor tongue posture, jaw posture, and jaw muscle tension. This self - monitoring enables QUICK CONSULT Recommending Posture Exercises patients to modify their posture or behavior as soon as they begin to revert to their old The treatment group, using the exercises undesirable postures or behaviors. provided in appendix 7 , reported a mean Knowing that TMD patients with a greater reduction in TMD and neck symptoms of 42% forward head posture have a higher and 38%, whereas the control group reported a probability of deriving TMD symptom mean reduction of 8% and 9%, respectively improvement from these exercises, observe the (Figure 14.6 ). degree of the patient’ s forward head posture during the initial evaluation. The greater the Practitioners may wish to use the posture forward head posture is, the more likely I am exercises in appendix 7 to help their TMD to recommend these exercises. patients obtain these benefi ts. Follow - up appointments are necessary to ensure the exercises are being performed properly and BREAKING DAYTIME HABITS tend to motivate patients to comply better with the exercise schedule, especially if TMD symptoms related to nocturnal patients know they will be asked about their contributing factors are present when patients compliance and to demonstrate the exercises. wake up and usually last a few minutes to an Performing these exercises improperly may hour or so. If the TMD symptoms last longer, exacerbate the TMD or neck symptoms. worsen as the day progresses, or occur later in In addition to performing these exercises, the day, daytime habits (parafunctional, patients must continually monitor their emotionally induced muscle tension, etc.) posture and maintain the desired new posture. generally are contributing to them. 16,35 220 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H FOCAL POINT to let your arm relax and hang loose ” If TMD symptoms last longer than an hour upon (demonstrating this with my arms at the same awaking, worsen as the day progresses, or occur time). “ Once you learn to keep your arm later in the day, daytime habits (parafunctional, relaxed, your biceps and elbow pain will emotionally induced muscle tension, etc.) disappear. ” generally are contributing to them. I tell the patient (demonstrating it with the arm) that pressing against the knee is similar To help patients understand the to putting the teeth together and squeezing, relationship between their habits and TMD whereas holding the arm out with the muscles symptoms, the following analogy can be fl exed is similar to holding tension in the jaw helpful. A man went to the physician because muscles. You have to learn to let your jaw the man ’ s right biceps and elbow were hurting muscles relax and allow your jaw to hang and the elbow was popping and locking (I use loose (at the same time, I drop my arms and the same muscle and joint complaints as the just let them hang). When you do this, your patient’ s masticatory muscle and joint lips will lightly touch and you will fi nd your complaints). teeth are separated by an eighth to a quarter The doctor pressed on the man ’ s right of an inch. biceps and elbow, and observed their In Questions 26 through 28 of the “ Initial tenderness. He then pressed on the patient’ s Patient Questionnaire ” (appendix 2 ), patients right shoulder, left shoulder, and left arm (as I identify the percent of the day they are say these locations, I look at them) and found aware of touching their teeth together and they were not tender. The doctor said (using the daytime oral habits they are aware of an inquisitive facial expression), “ This is odd; performing. Patients should be strongly I wonder what could be causing this localized encouraged (1) to always keep the tongue tenderness in the right arm. ” As I say this, I lightly resting on the roof of the mouth and put my right hand on my knee, push down the teeth apart, (2) to stop any clenching or on the knee so my arm muscles fl ex, and grinding of the teeth (the nighttime activity is make my right arm quiver. The doctor looked beyond their control), (3) to stop performing over at his right arm and said (using an any other oral habits they may have (e.g., astonished facial expression), “ W hat are you chewing on cheeks, chewing objects, or doing with your right arm? ” The man replied, biting nails or cuticles), and (4) to observe “ You should ignore this, because it is just for any additional oral habits that may be a nervous habit I have when I get a little contributing to their TMD symptoms. anxious or frustrated; it helps me get rid of These habits usually occur or intensify my nervous energy. ” The doctor said, “ No when patients are focused on other things, wonder you have pain in your right arm; especially when they are busy, stressed, or anyone continually doing that would have concentrating (e.g., using the computer). your type of localized pain. You have to stop Therefore, they generally need cues to alert your crazy habit if you want to get rid of themselves to check for whether they are your pain. ” I take my hand off of the knee, performing these harmful habits. The cues continue to fl ex the muscles in the arm, and may be external, such as a timer that alerts make them quiver. The patient said he could them every 5 minutes. Based on the pain stop that habit, do this instead, and could still intensity ’ s fl uctuations, patients can normally get rid of his nervous energy in this manner. tell when their major contributing habits The doctor said, “ N o, you have to learn occur, which is the most benefi cial time to use C H A P T E R 1 4 S E L F - M A N A G E M E N T T H E R A P Y 221 the cues. Clinically it has been observed that Some patients fi nd using a diary to record it is best to work with the patients and help their activity and pain intensity hourly helps them determine what they will use for their them to better identify the activities related to external cues, in addition to when and how their major contributing habits and reinforces they will use them. the need to break these habits. Some patients choose to become very cognizant about their QUICK CONSULT major contributing habits, constantly monitor Using External Cues for them, and use them as internal cues to Daytime habits usually occur when patients are alert themselves to change the activity. For focused on other things, especially when they example, an individual who tends to hold are busy, stressed, or concentrating (e.g., using tension in the masseter muscle uses masseter the computer). Therefore, they generally need muscle tension as the internal cue and relaxes cues to alert themselves to check for whether the masseter muscle whenever tension is they are performing these harmful habits. noticed. If patients notice themselves reverting to their old harmful behaviors or postures, If the habits are prominent while driving, they need to institute the desired behavior or some patients choose to place a portion of a posture. yellow Post - it note over the car ’ s speedometer, so that, every time they check their speed, QUICK CONSULT they are reminded to also check for oral Recommending Diary habits. In one situation in which the habits Some patients fi nd using a diary in which they were prominent during computer use, one record their activity and pain intensity hourly patient decided to place a rolled piece of tape helps them to better identify the activities related (sticky side out) over the keyboard ’ s “ Z ” key. to their major contributing habits and reinforces This patient felt she would hit this key about the need to break these habits. every 5 minutes and, when the sticky side of the tape was touched, it would alert her to Some patients desire to use their pain check for oral habits. intensity as their internal cue. As patients Over time, external cues tend to lose their notice an increase in pain, they alert startling effect, blend into the background, themselves,
ask what they are doing to cause and stop alerting patients to check for oral this, and change it. Once they satisfactorily habits. As this occurs, patients may desire to control their habits so the pain decreases to a change the external cues or change to internal low level or becomes intermittent, ask patients cues. Internal cues are aspects within the body to change their internal cue, from pain that patients can also use to alert themselves intensity to muscle tightness or tension. In about their oral habits. The most common this manner, they alert themselves whenever internal cues that TMD patients use are the they begin to tighten their muscles and teeth touching the opposing teeth or an subsequently intentionally relax them. Patients occlusal appliance, their pain intensity, and usually fi nd this enables them to keep their muscle tension. Clinically patients appear to muscle tension from progressing and thereby have the best long - term success if they have prevents the pain from developing. Clinically learned to use internal cues to maintain their it has been observed that patients who can new behaviors or postures. Some patients master using muscle tightness or tension as prefer to fi rst work with external cues and their internal cue seem to have the greatest later progress to internal cues. long - term success in eliminating their daytime 222 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H Figure 14.7. Comparison of subjects randomly assigned to a habit- reversal stabilization appliance or habit - reversal group with both groups instructed to avoid tooth contact and relax their masticatory muscles. Subjects in the appliance group wore their appliances up to 20 hours a day and subjects in the habit - reversal group were paged every 2 hours during the day for 4 weeks and instructed to check their tooth position and masticatory muscle tension when paged. Both groups obtained signifi cant decrease in TMD pain.3 8 TMD symptoms and maintaining this appliance or a habit- r eversal group. Subjects benefi t. in both groups were instructed to avoid tooth Some patients fi nd breaking these habits contact and relax their masticatory muscles. and using the “ TMD Self - Management The appliance subjects wore their appliances Therapies ” handout (appendix 4 ) decrease up to 20 hours a day, while the habit- r eversal their TMD symptoms satisfactorily. This is subjects were not provided an appliance, but primarily observed among patients who are paged every 2 hours during the day for 4 motivated to get better on their own and weeks and instructed to check their tooth predominately have diurnal (daytime) pain. position and masticatory muscle tension Some other patients fi nd wearing a when paged. Subjects in both groups obtained stabilization appliance during the day helps a signifi cant decrease in TMD pain (Figure them to continually be more attuned to 14.7 ). This suggests if you instruct your parafunctional habits and what they are doing TMD patients to avoid tooth contact and with their oral cavity, thereby enabling them relax their masticatory muscles, patients to catch and alter their daytime habits. 16,36,37 working with reminders or wearing a If a daytime appliance is desired, some stabilization appliance as a reminder will practitioners prefer the 2- m m hard obtain similar symptom improvement. thermoplastic appliance discussed in “ H ard Empirically, I believe my patients obtain Thermoplastic Stabilization Appliance ” in better TMD symptom relief at 4 weeks chapter 1 2, because of its low impact on than the subjects in Figure 1 4.7, but that speech and esthetics. could be from my patients receiving a In one study, 38 subjects were randomly multidisciplinary approach rather a single assigned to a habit- r eversal stabilization therapy. C H A P T E R 1 4 S E L F - M A N A G E M E N T T H E R A P Y 223 For various reasons, some practitioners REFERENCES provide a maxillary or mandibular stabilization appliance for their patients to wear 1. Riley JL 3rd , Myers CD , Currie TP , Mayoral O , temporarily during the day. Patients who also H arris R G, F isher J A, G remillion H A, R obinson awake with TMD symptoms should be M E. S elf- c are behaviors associated with myofascial instructed to wear an appliance at night, too. temporomandibular disorder pain. J Orofac Pain I ask these patients to wear the same appliance 2007 ; 21 ( 3 ): 194 – 202 . 2. Mulet M , Decker KL , Look JO , Lenton PA , during the day and at night, while I observe Schiffman EL . A randomized clinical trial assessing some other practitioners providing their the effi cacy of adding 6 × 6 exercises to self - care patients with a mandibular “ d aytime for the treatment of masticatory myofascial pain . appliance ” and a maxillary “ nighttime J Orofac Pain 2007 ; 21 ( 4 ): 318 – 328 . appliance.” If patients use an appliance during 3. Herman CR , Schiffman EL , Look JO , Rindal DB . the day, I refer to it as a habit - breaking The effectiveness of adding pharmacologic appliance and instruct them that its purpose treatment with clonazepam or cyclobenzaprine to is to help alert them whenever their opposing patient education and self - care for the treatment of teeth touch the appliance. I try to have jaw pain upon awakening: A randomized clinical patients break their daytime habits within trial . J Orofac Pain 2002 ; 16 ( 1 ): 64 – 70 . several months and then request they limit the 4. Hampton T . Improvements needed in management use of the appliance to nighttime and only of temporomandibular joint disorders . JAMA 2008 ; 299 ( 10 ): 1119 – 1121 . a few hours during the day, if at all. Some 5. American Academy of Orofacial Pain . de Leeuw R patients fi nd they still prefer to continue (ed). Orofacial Pain: Guidelines for Assessment, wearing their appliance for certain activities, Diagnosis and Management , 4th ed. Chicago : e.g., driving a car. Quintessence , 2008 : 149 , 158 , 160. 6. Michelotti A , De Wijer A , Steenks M , Farella M . Home - exercise regimes for the management of non - specifi c temporomandibular disorders . J Oral QUICK CONSULT Rehabil 2005 ; 32 ( 11 ): 779 – 785 . Using a Habit- Breaking Appliance 7. DeBar LL , Vuckovic N , Schneider J , Ritenbaugh C . If patients use an appliance during the day, I Use of complementary and alternative medicine refer to it as a habit - breaking appliance and for temporomandibular disorders. J Orofac Pain instruct them that its purpose is to help alert 2003 ; 17 ( 3 ): 224 – 236 . them whenever their opposing teeth touch the 8. Fricton J . Myogenous temporomandibular appliance. disorders: Diagnostic and management considerations . Dent Clin North Am 2007 Jan; 51 ( 1 ): 61 – 83 . 9. Simons DG , Travell JG , Simons LS . Travell & Some patients cannot adequately control Simons ’ Myofascial Pain and Dysfunction: The their daytime habits or muscle tension to Trigger Point Manual , vol. 1 , 2nd ed. Baltimore : Williams & Wilkins , 1999 : 140 – 141 , 145 , 149 . reduce their daytime symptoms satisfactorily. 10. Nelson SJ , Santos J , Barghi N , Narendran S . Using Most of these patients are referred to a moist heat to treat acute temporomandibular muscle psychologist for additional help with changing pain dysfunction . Compendium 1991 ; 12 ( 11 ): 808 – these, especially if other psychosocial needs are 816 . observed. These therapies and the referral 11. Poindexter RH , Wright EF , Murchison DF . process are discussed in Chapter 16 , Comparison of moist and dry heat penetration “ Cognitive - Behavioral Intervention. ” through orofacial tissues . Cranio 2002 ; 20 ( 1 ): 28 – 33 . 224 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H 12. Smith A , Sutherland D , Christopher G . Effects motion device on pain and range of motion in of repeated doses of caffeine on mood and TMD patients not responding to fl at plane intraoral performance of alert and fatigued volunteers. appliances . Cranio 2002 ; 20 ( 1 ): 55 – 66 . J Psychopharmacol 2005 ; 19 ( 6 ): 620 – 626 . 25. Magnusson T , Syren M . Therapeutic jaw exercises 13. Bridle L , Remick J , Duffy E . Is caffeine excess part and interocclusal therapy: A comparison between of your differential diagnosis? Nurse Pract 2004 ; 29 two common treatments of temporomandibular ( 4 ): 39 – 44 . disorders . J Swed Dent 1999 ; 22 : 23 – 37 . 14. Shirlow MJ , Mathers CD . A study of caffeine 26. Dall ’ Arancio D , Fricton J . Randomized controlled consumption and symptoms: Indigestion, study of exercises for masticatory myofascial palpitations, tremor, headache and insomnia. I nt J pain [abstract 76] . J Orofac Pain 1993 ; 7 ( 1 ): Epidemiol 1985 ; 14 ( 2 ): 239 – 248 . 117 . 15. Shapiro RE . Caffeine and headaches . Curr Pain 27. Lentell G , Hetherington T , Eagan J , Morgan M . Headache Rep 2008 ; 12 ( 4 ): 311 – 315 . The use of thermal agents to infl uence the 16. Chen CY , Palla S , Erni S , Sieber M , Gallo LM . effectiveness of a low- l oad prolong stretch. J Orthop Nonfunctional tooth contact in healthy controls Sports Phys Ther 1992 ; 16 ( 5 ): 200 – 207 . and patients with myogenous facial pain. J Orofac 28. Mense S , Simons DG , Russell IJ . Muscle Pain: Pain 2007 ; 21 ( 3 ): 185 – 193 . Understanding Its Nature, Diagnosis, and 17. Glaros AG , Williams K , Lausten L . The role of Treatment . Philadelphia : Lippincott Williams & parafunctions, emotions and stress in predicting Wilkins , 2001 : 153 . facial pain . JADA 2005 ; 136 ( 4 ): 451 – 458 . 29. Fricton JR , Kroening R , Haley D , Siegert R . 18. Glaros AG , Burton E . Parafunctional clenching, Myofascial pain syndrome of the head and neck: A pain, and effort in temporomandibular disorders. J review of clinical characteristics of 164 patients . Behav Med 2004 ; 27 ( 1 ): 91 – 100 . Oral Surg Oral Med Oral Pathol 1985 ; 60 : 615 – 19. Glaros AG , Williams K , Lausten L , Friesen LR . 623 . Tooth contact in patients with temporomandibular 30. Mannheimer JS , Rosenthal RM . Acute and chronic disorders . Cranio 2005 ; 23 ( 3 ): 188 – 193 . postural abnormalities as related to craniofacial pain 20. Magnusson T , Egermarki I , Carlsson GE . A and temporomandibular disorders. D ental Clin prospective investigation over two decades on signs North Am 1991 ; 35 ( 1 ): 185 – 209 . and symptoms of temporomandibular disorders and 31. Griegel - Morris P , Larson K , Nueller - Klaus K , Oatis associated variables. A fi nal summary . Acta Odontol CA . Incidence of common postural abnormalities in Scand 2005 ; 63 ( 2 ): 99 – 109 . the cervical, shoulder and thoracic regions and their 21. Aaron LA , Turner JA , Mancl LA , Sawchuk CN , association with pain in two age groups of healthy Huggins KH , Truelove EL . Daily pain coping subjects . Phys
Ther 1992 ; 72 : 425 – 431 . among patients with chronic temporomandibular 32. Wright EF , Domenech MA , Fischer JR Jr . disorder pain: An electronic diary study. J Orofac Usefulness of posture training for TMD patients . Pain 2006 ; 20 ( 2 ): 125 – 137 . JADA 2000 ; 131 ( 2 ): 202 – 210 . 22. Dworkin SF , Huggins KH , Wilson L , Mancl L , 33. Decker KL , Bromaghim CA . Utilizing physical Turner J , Massoth D , LeResche L , Truelove E . A therapy in the treatment of temporomandibular randomized clinical trial using research diagnostic disorders . In: Clark JW , Curtis JW (eds). Clark ’ s criteria for temporomandibular disorders- a xis II to Clinical Dentistry , vol. 2 , chap. 41. Philadelphia : JB target clinic cases for a tailored self- c are TMD Lippincott , 1994 : 1 – 14 . treatment program . J Orofac Pain 2002 ; 16 ( 1 ): 34. Liddle EJ . A comparison of round shoulder posture 48 – 63 . with thoraco - cervical - shoulder pain and an 23. McNeely ML , Armijo Olivo S , Magee DJ . A asymptomatic control group [MS thesis]. O klahoma systematic review of the effectiveness of physical City : University of Oklahoma Health Sciences therapy interventions for temporomandibular Center , 1994 : 1 – 6 . disorders . Phys Ther 2006 ; 86 ( 5 ): 710 – 725 . 35. Wright EF . How daily TMD symptom patterns 24. Maloney GE , Mehta N , Forgione AG , Zawawi KH , may affect treatment approach. A m Acad Orofac Al - Badawi EA , Driscoll SE . Effect of a passive jaw Pain Newsl 2000 ; 5 ( 3 ) 15 – 16 . C H A P T E R 1 4 S E L F - M A N A G E M E N T T H E R A P Y 225 36. Kreiner M , Betancor E , Clark GT . Occlusal 38. Glaros AG , Kim - Weroha N , Lausten L , Franklin stabilization appliances: Evidence of their effi cacy . KL . Comparison of Habit Reversal and a JADA 2001 ; 132 ( 6 ): 770 – 777 . Behaviorally - Modifi ed Dental Treatment 37. Glaros AG , Owais Z , Lausten L . Reduction in for Temporomandibular Disorders: A Pilot parafunctional activity: A potential mechanism for Investigation . Appl Psychophysiol Biofeedback the effectiveness of splint therapy . J Oral Rehabil 2007 ; 32 ( 3 – 4 ): 149 – 154 . 2007 ; 34 ( 2 ): 97 – 104 . Chapter 15 Physical Medicine In the fi eld of TMD, physical medicine TMD symptoms (see chapter 16 , “ Cognitive - procedures are referred to as adjunctive TMD Behavioral Intervention ” ). Some of the therapies and generally provide additional adjunctive TMD therapies are directed improvement in TMD symptoms. If patients primarily at peripheral structures, whereas have not changed their perpetuating contrib- others provide primarily a central effect. uting factors, many of the improvements Those primarily acting on the peripheral obtained through physical medicine proce- tissues are heat or cold applications, mastica- dures are only temporary, unless patients are tory muscle exercises, physical therapy taught to perform these procedures and modalities, massage, trigger - point compres- continually use them on their own. sion, trigger - point injections, chiropractics, and magnetic therapy, whereas treatments primarily having a central effect include QUICK CONSULT Using Physical Medicine acupuncture, relaxation therapy, biofeedback, and stress management. Procedures Adjunctive TMD therapies are discussed In the fi eld of TMD, physical medicine proce- separately, but are generally used in combina- dures are referred to as adjunctive TMD thera- tion with other therapies. Not all of the pies and generally provide additional physical medicine procedures discussed are improvement in TMD symptoms. recommended for TMD patients, but are presented in order that practitioners may FOCAL POINT make informed treatment decisions. If patients have not changed their perpetuating Many TMD patients desire adjunctive contributing factors, many of the improvements physical medicine procedures. Over a 1- y ear obtained through physical medicine procedures period in which TMD patients were being are only temporary, unless patients are taught to followed for symptom changes from cognitive - perform these procedures and continually use behavorial interventions, 23%, 20%, 4%, and them on their own. 3% of the subjects also sought treatment by a chiropractor, massage therapist, physical In addition to physical medicine therapies, therapist, and acupuncturist, respectively. 1 cognitive - behavioral intervention provides Myofascial pain , which is the most other commonly used adjunctive TMD common source of TMD pain, 2,3 is character- therapies that have also been shown to reduce ized by localized tender nodules, known as 227 228 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H trigger points , within the muscles. TMJ weekly, which is time consuming and costly infl ammation is another common source of for patients. If patients are taught to use TMD pain, which is characterized by TMJ self - massage, they may have an effective tenderness. Cervical pain is a third prevalent adjunctive treatment to use whenever they disorder among TMD patients, causing them desire it. Some patients may fi nd adding a to not obtain the usual TMD symptom topical liniment (e.g., Icy Hot) provides improvement.4 ,5 Most physical medicine additional benefi t. Two surveys of TMD procedures used to improve TMD symptoms patients found muscle massage to be one of are directed at one or more of these three the most benefi cial of the alternative treat- disorders. ments evaluated, and one found 24% of Many of the physical medicine therapies TMD patients use muscle massage for their used to inactivate trigger points provide only TMD symptoms.7 ,8 temporary improvement. To keep the trigger points inactivated, the therapy typically needs QUICK CONSULT to be continually repeated or the contributing Recommending Self- Massage and factors perpetuating the trigger - point activa- tion must be adequately controlled. 2,6 Trigger - Topical Liniments point activation is generally a cumulative If patients are taught to use self- massage, they effect from various perpetuating factors, with may have an effective adjunctive treatment to the most common being repetitive overuse use whenever they desire it. of the muscle, chronic muscle tension, and emotional stress. 2 Parafunctional habits are the YOGA most frequent cause of repetitive overuse of the masticatory system, whereas poor posture Yoga was developed thousands of years ago; it is the most frequent cause of repetitive uses physical postures and breathing exercises overuse of the cervical region. to improve muscle strength and fl exibility and In the literature, comparisons are made to promote relaxation. 9 A survey taken within between adjunctive TMD therapies and the United States suggests 3.8% of Americans occlusal appliances. When these are discussed used yoga in the previous year and performing in chapters 1 5 and 1 6, the appliances are yoga did not cost 76% of them any money. acrylic stabilization appliances unless specifi ed The primary reasons these individuals per- differently. formed yoga in the previous year were for wellness (64%), for health conditions (48%), and for back or neck pain (21%). 10 MUSCLE MASSAGE Yoga has been shown to provide signifi cant benefi t for low back pain, 11,12 migraine Massage therapists can treat myofascial pain by headache, 13 osteoarthritis symptoms,1 4 chronic compressing and inactivating trigger points pain, 15 fi bromyalgia,1 6 irritable bowel syn- during the massage. Muscle massage generally drome, 17 stress,1 8 – 21 anxiety, 17,19 – 21 and depres- decreases the pain and increases the mobility sion. 20,21 There are many forms of yoga, and of the region, and massage for the masticatory the investigators probably used the form they and cervical regions is discussed in chapter 14 , thought would provide the greatest effect for “ Self - management Therapy. ” the outcomes they assessed. Most massage therapists want to treat No studies have evaluated whether yoga is myofascial pain by repeating the massage benefi cial for TMD, and I have not clinically C H A P T E R 1 5 P H Y S I C A L M E D I C I N E 229 followed patients who began yoga while I local anesthetic effect), and the pain never treated them for TMD and observed whether quite returns to the original level. Weekly they obtained TMD symptom improvement sequential injections are generally provided, from it. However, if a TMD patient with which enables the practitioner to obtain a stress, anxiety, neck pain, or other musculosk- stair - step reduction in the pain.2 5,26 eletal disorders relates he or she is considering Other agents that have been used in to start yoga, I encourage the patient to follow trigger- point injections are nonsteroid anti - through on the contemplation. Patients can infl ammatory drugs, corticosteroid, and identify a conveniently located yoga class by botulinum toxin type A and type B. Systemic placing “ y oga” followed by their city in an reviews are questioning whether botulinum internet search engine, or they can purchase a toxin is better or longer lasting than other yoga CD. Based upon the literature, yoga can standard trigger - point techniques. 27,28 be a cost - effective program that has the As with other adjunctive therapies, if the potential for benefi ting TMD symptoms. perpetuating factors have not been adequately reduced, the trigger points tend to reactivate.2 5 Generally trigger - point injections are provided TRIGGER - POINT COMPRESSION only after traditional conservative manage- ment in addition to exercises and other This procedure is often provided in conjunc- physical therapy modalities have failed to have tion with massage therapy. It attempts to a lasting effect. 29 inactivate trigger points, thereby decreasing muscle pain and increasing mobility of the QUICK CONSULT region. Some muscle therapists are specifi cally Recommending Trigger- Point trained to use this technique in treating Injections myofascial pain. 22 Trigger - point compression Generally trigger- point injections are provided is discussed in chapter 14 , “ Self - Management only after traditional conservative management in Therapy, ” and patients instructed in this addition to exercises and other physical therapy technique may have an effective tool for modalities have failed to have a lasting effect. maintaining trigger - point inactivation. Trigger - point injections into the mastica- TRIGGER - POINT INJECTION tory and neck muscles can be provided by dentists, and a recommended step - by - step This is another technique used to inactivate detailed technique is presented by Abdel- trigger points. Clinically it is often observed Fattah.2 3 Practitioners desiring to refer a that patients relate the injection allowed them patient for this therapy will fi nd that some to relax and stretch their muscle, thereby physicians provide these injections in their decreasing the symptoms from the muscle. offi ce, and most pain clinics have practitioners Typically 2% lidocaine without vasocon- experienced in providing them. strictor is injected into the active trigger point. This generally provides immediate PHYSICAL THERAPY relief, and it is recommended practitioners stretch the injected muscle and apply superfi - This encompasses a wide variety of evaluation cial heat after the injection.2 3,24 The relief techniques and treatments commonly used for normally lasts days (much longer than the musculoskeletal disorders. Physical therapy 230 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H generally entails conservative noninvasive A randomized clinical trial found that therapies that are typically used in combina- TMD patients given the posture improvement tion with other treatments for TMD. 30,31 It is exercises (appendix 7 ) and TMD self - manage- appropriate and common for dentists to refer ment instructions (appendix 4 ) , on average, TMD patients to physical therapists to reduce reported a 42% reduction in their TMD
TMD pain or improve TMJ function, range symptoms and 38% reduction in neck of motion, and daytime or sleeping postures, symptoms. Patients who held their head or to evaluate and treat neck symptoms.3 0 – 33 further forward relative to their shoulders had The goal in physical therapy is to improve a higher probability of deriving TMD TMD symptoms and teach patients to symptom improvement from the exercises and maintain this improvement. Therefore, instructions.3 6 Practitioners may desire to refer patients do not need to continually return for TMD patients who have more signifi cant treatment, minimizing the cost and time spent forward head posture to physical therapy for in therapy. 31 posture exercises or directly instruct and follow the cases of patients with the posture FOCAL POINT improvement exercises (appendix 7 ). The goal in physical therapy is to improve TMD The effi cacy of physical therapy increases symptoms and teach patients to maintain this when performed in conjunction with occlusal improvement. Therefore, patients do not need to appliance therapy. 30,31,37 I often consider continually return for treatment, minimizing the referring TMD patients to physical therapy cost and time spent in therapy. for any of the following: Physical therapists often provide TMD 1. The patient has neck pain. TMD patients with education and a combination of patients with neck pain do not respond to therapies. Patients most frequently receive TMD therapy as well as those without exercises rather than passively receiving neck pain. 38 Some TMD symptoms treatments that do not require them to partici- primarily come from the neck, and physi- pate actively in their own improvement.3 1 cal therapy in conjunction with home Most of the passive treatments are referred to exercises can provide long - term benefi t for as physical therapy modalities , which may neck pain. 30,31,39 include superfi cial heat, superfi cial cold, 2. The patient has cervicogenic headaches. combination of heat and cold, ultrasound Cervicogenic headaches are headaches that (deep heat), phonophoresis (deep heat with an originate in the neck, and clinically it anti - infl ammatory or anesthetic medication appears TMD patients tend to hold more driven by ultrasound waves), electrical stimula- tension in their masticatory muscles when tion, microcurrent electrical nerve stimulation they have a headache. Therefore, TMD (MENS), transcutaneous electrical nerve patients with cervicogenic headaches who stimulator (TENS), and iontophoresis (a have their neck treated should have fewer charged anti - infl ammatory or anesthetic headaches and may also obtain substantial medication driven by an electrical gradient). TMD symptom improvement. Studies The literature suggests that exercises have the report physical therapy ’ s benefi cial effect greatest potential for therapeutic benefi t and on cervicogenic headaches, 40,41 and an enable patients to maintain this improvement. example of one cervical exercise’ s long- Therefore, physical therapists now tend to use term effect is demonstrated in Figure more active therapies than in the past. 31,34,35 15.1 . 42 C H A P T E R 1 5 P H Y S I C A L M E D I C I N E 231 Figure 15.1. Demonstrates the clinically signifi cant long- term effect a single cervical exercise can have on cervicogenic headaches. 29 3. The patient has moderate to severe 7. The patient is to have TMJ surgery. forward head posture. These patients may Patients who receive physical therapy after obtain signifi cant TMD symptom TMJ surgery may have signifi cantly better improvement from posture exercises in results.4 3 It is appropriate for these patients combination with TMD self- m anagement to be referred for physical therapy prior to instructions3 6 and be most likely to derive surgery in order that they may learn about substantial TMD symptom improvement and possibly start the postsurgical exercises, from these. and schedule the recommended postsurgi- 4. The patient ’ s TMD symptoms increase cal appointments. with abnormal postural activities. Instructing these patients in body mechan- Two examples of physical therapy referrals ics (teaching patients how to perform tasks are provided in appendix 10 , “ Examples of without straining the body) should help Physical Therapy Consultations. ” To refer a them maintain good posture, thereby TMD patient to a physical therapist, the reducing their TMD symptoms.3 0,31 practitioner can write the following on the 5. The patient desires help in changing prescription pad or offi ce stationery: poor sleep posture. Stomach sleeping perpetuates TMD and neck symptoms. 1. The patient ’ s chief complaint. Physical therapists are trained to help 2. The patient ’ s TMD diagnosis, e.g., change the sleep position of patients who myofascial pain and TMJ infl ammation. cannot stop sleeping on their stomach. 30 3. What the practitioner prescribes the 6. The patient did not obtain adequate physical therapist to perform. I generally TMD symptom relief from other thera- write “ Please evaluate and treat ” ; this allows pies. Physical therapists are trained to treat the physical therapist to perform whatever musculoskeletal disorders throughout the treatment is believed necessary. Many body and can apply their skills to the third - party payers also require the requested masticatory system. frequency and duration of treatment be 232 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H documented; two to three times a week for If a practitioner is not aware of an appro- a month is a reasonable request. priate physical therapist to whom they can 4. Any precautions the physical therapist refer a patient, many physical therapists with should be aware of (e.g., previous surgery, skills or interest in such special areas as TMD, tumor, screws, or wires in the region) and the neck, or the spinal column will list these medical disorders that could complicate areas in their telephone book ’ s yellow pages therapy (e.g., angioedema). advertisement. Practitioners can also talk with other dentists in the area who refer their As with dentistry, TMD is not a primary fi eld TMD patients to physical therapists, to of physical therapy education. Physical thera- determine who they have found can obtain pists ’ TMD knowledge greatly varies with the satisfactory results. university attended, and much of it is generally Physical therapy is a benefi t of most obtained from continuing education courses. medical insurance policies. Some third- p arty Very few physical therapists have specialized payers require their patients use in - house or training or extensive experience treating TMD contracted physical therapists, and some patients, and great variations are observed in require the consults to go through a physician. their abilities to treat TMD patients. Because of the complexities with the medical I am aware of two physical therapy certifi ca- insurance or if the dentist is not knowledge- tion programs that certify individuals with able about the physical therapists in the area, expertise in treating TMD patients. These practitioners may desire to write the afore- organization websites list their certifi ed mentioned items on their prescription pad physical therapists, so practitioners can identify and request that patients see their primary trained therapists to refer their patients. The care providers for the referral. Some patients one certifi cation is titled Certifi ed Cervical may desire to speak with their third - party and Temporomandibular Therapists (CCTT) payer concerning referral procedures and and therapists with this certifi cation are listed copayment prior to making the physical on the American Academy of Orofacial Pain therapy appointment. website ( http://www.aaop.org/ ). The other certifi cation is titled Certifi cation in Cranio - Facial (CFC) and therapists with this certifi ca- ACUPUNCTURE tion are listed on the University of St. Augustine website ( http://www.usa.edu/ ). The T his intervention has been used to treat pain names and addresses of these therapists are for over 3,000 years and has well - documented easily obtained by placing the certifi cation title support for its ability to relieve pain for several in an internet search engine and clicking the pain conditions, e.g. acute dental pain. 44 selection for the organization. When acupuncture is used to treat chronic pain, it generally takes repeated treatments QUICK CONSULT and several weeks to obtain its maximum Selecting a Physical Therapist therapeutic effect. Each treatment session I am aware of two physical therapy certifi cation usually lasts 25 – 45 minutes and is generally programs that certify individuals having expertise provided on a weekly basis. Once the treat- in treating TMD patients. These organization ments stop, acupuncture generally slowly loses websites list their certifi ed physical therapists, so its benefi cial effect over several weeks. 45 practitioners can identify certifi ed therapists to The pain relief acupuncture provides whom they can refer these patients. appears to be mediated by analgesic brain C H A P T E R 1 5 P H Y S I C A L M E D I C I N E 233 mechanisms through the release of endog- Two randomized clinical trials compared enous opiates (e.g., endorphins, dynorphins). the percent of patients who obtained any It has characteristics similar to other uses of TMD symptom improvement from acupunc- opiates, i.e., a substantial portion can be ture and stabilization appliance therapy; their reversed by the opioid antagonist naloxone, a fi ndings are summarized in Figure 15.2 .5 3 – 55 tolerance occurs from prolonged acupuncture, In one study, patients were allowed to cross and a cross - tolerance occurs with over and receive the treatment provided to morphine.4 5,46 the other group at the 6 - month follow - up. Even though its effect is short term, Among the patients who received the stabili- occasionally studies observe that patients with zation appliance and chose to receive acu- a long -t erm pain disorder improve from puncture, only 17% had any further acupuncture, such as with chronic low back subjective improvement from acupuncture.5 3 pain. 47 It is speculated that the temporary These studies suggest that, after six to eight pain relief obtained through acupuncture acupuncture treatment sessions, patients allows patients to mobilize the region and initially obtain good symptom relief, but this thereby obtain the long - term relief.4 5 decreases over time, and patients who do not Acupuncture has similarly been shown to derive satisfactory improvement from an provide short - term benefi t for TMD,4 8 – 50 in orthopedic appliance tend not to receive addition to when it is combined with manual additional improvement from acupuncture. therapy. 51 TMD patients generally need six to Acupuncture can provide signifi cant short - term eight treatment sessions for TMD symptoms TMD symptom improvement, but there are to respond adequately, and if it is a chronic simpler and less invasive therapies that provide disorder, patients need to return periodically sustained and comparable symptom relief. for additional sessions to maintain these benefi ts. 29,52 My clinical observation of TMD FOCAL POINT patients whose treatment is limited to acu- Acupuncture can provide signifi cant short- term puncture is that most need an acupuncture TMD symptom improvement, but there are treatment every 2 or 3 weeks to maintain simpler and less invasive therapies that provide their symptom relief. sustained and comparable symptom relief. Figure 15.2. Initially, acupuncture was more effective than appliance therapy, but over time acupuncture lost its effectiveness and appliance therapy was superior. 234 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H CHIROPRACTICS that the patient receive more traditional interventions rather than further chiropractic A moderate percentage of TMD patients seek therapy. There are no studies to suggest when TMD symptom relief from chiropractors. 1,55,56 a chiropractic referral would be the preferred Chiropractic training varies considerably from intervention for cervical pain. school to school; therefore, chiropractors’ treatment approaches and capabilities also vary greatly. 57 Some chiropractors attempt to QUICK CONSULT relieve TMD - type symptoms through cervical Recommending Chiropractic spine manipulation, whereas other chiroprac- Treatments tors work directly with the masticatory After two or three chiropractic treatments, if system. 58 – 60 adequate neck pain relief is not obtained or the There
is only one known clinical trial that improvement is not maintained without contin- evaluated TMD symptom change from spinal ued spinal manipulation, then it is recommended and masticatory chiropractic therapy, and all that the patient receive more traditional interven- patients obtained short - term TMD benefi t tions rather than further chiropractic therapy. from this intervention.6 0 My clinical observa- tion of chiropractors treating patients for TMD is that most chiropractors do not teach MAGNETIC THERAPY the patients how to eliminate their perpetuat- ing contributing factors, so I speculate this For centuries the use of magnetics has been therapy would only provide a short- t erm advocated for relieving pain. It is estimated benefi t for most TMD patients with chronic that Americans spend $500 million per year symptoms. on magnets to treat pain. 62 There are many It is speculated that dentists who refer anecdotal reports of their effectiveness in TMD patients to chiropractors do so primar- relieving pain, and it has been reported that ily to treat coexisting neck pain, and the therapeutic magnets have been worn by 90% literature suggests that chronic mechanical of the senior Professional Golfers’ Association neck disorders have the best long - term results players. 63 Studies have found therapeutic from mobilization and/or manipulation when magnets to be benefi cial for a broad range of patients are provided exercises to do on their pain disorders, e.g., neuropathic, infl amma- own. 61 Clinically, I observe most chiropractors tory, musculoskeletal, fi bromyalgic, rheumatic, do not teach their patients exercises to menstrual, and postsurgical.6 4 – 67 maintain the symptom benefi ts, but generally Therapeutic magnets come in many forms, instruct their patients to return on a routine e.g., disks, patches, bracelets, necklaces, shoe basis for long- t erm chiropractic therapy. insoles, mattress pads, pillows, and cushions. If a provider refers a patient to a chiroprac- The therapeutic strengths vary from 300 to tor for cervical pain and the patient obtains 5,000 gauss, in comparison to refrigerator and is able to maintain cervical pain resolu- magnets, which vary from 35 to 200 gauss, tion after two or three chiropractic treatments, and MRI procedures, which can use up to this would appear to have been an effective 200,000 gauss. 62 A problem for consumers treatment approach. On the other hand, if and clinical investigators is that some magnet adequate relief is not obtained or the improve- suppliers are signifi cantly overrating the ment is not maintained without continued strength designation of their magnets, and a spinal manipulation, then it is recommended study of comparing clinical trials found the C H A P T E R 1 5 P H Y S I C A L M E D I C I N E 235 magnet ’ s strength was an important compo- 3. Yap AUJ , Dworkin SF , Chua EK , List T , Tan nent as to whether subjects found the magnet KBC , Tan HH . Prevalence of temporomandibular benefi cial.6 4,68 disorder subtypes, psychologic distress, and Therapeutic magnets are considered safe, psychosocial dysfunction in Asian patients. J Orofac but individuals with pacemakers, insulin Pain 2003 ; 17 ( 1 ): 21 – 28 . 4. Raphael KG , Marbach JJ , Klausner J . Myofascial pumps, and other devices that may be affected face pain: Clinical characteristics of those with by a magnetic fi eld are advised not wear one.6 9 regional vs. widespread pain . JADA Therapeutic magnets produce a magnetic fi eld 2000 ; 131 ( 2 ): 161 – 171 . that extends only several millimeters beyond 5. Raphael KG , Marbach JJ . Widespread pain and the its surface and should therefore be placed effectiveness of oral splints in myofascial face pain. in direct contact with the painful area. 64,65 JADA 2001 ; 132 ( 3 ): 305 – 316 . Consequently, magnetic bracelets or necklaces 6. Simons DG , Travell JG , Simons LS . Travell & that dangle from an individual’ s body may Simons ’ Myofascial Pain and Dysfunction: The provide less than optimal benefi t. Trigger Point Manual , vol. 1 , 2nd ed . Baltimore : There are many theories for the underlying Williams & Wilkins , 1999 : 140 – 141 . mechanisms that account for the magnet’ s 7. Riley JL 3rd , Myers CD , Currie TP , Mayoral O , proposed pain relief, but the underlying Harris RG , Fisher JA , Gremillion HA , Robinson ME . Self - care behaviors associated with myofascial physiologic mechanism is still unclear. 64,70 temporomandibular disorder pain. J Orofac Pain Their effi cacy is also in question; among the 2007 ; 21 ( 3 ): 194 – 202 . two systematic reviews that evaluated well- 8. DeBar LL , Vuckovic N , Schneider J , Ritenbaugh C . conducted controlled trials, one concluded Use of complementary and alternative medicine for that static magnets are able to induce pain temporomandibular disorders. J Orofac Pain relief, 64 while the other concluded the evi- 2003 ; 17 ( 3 ): 224 – 236 . dence does not support the use of static 9. Parshad O . Role of yoga in stress management . magnets for pain relief. 69 West Indian Med J 2004 ; 53 ( 3 ): 191 – 194 . There are no known clinical trials evaluat- 10. Saper RB , Eisenberg DM , Davis RB , Culpepper L , ing the effi cacy of magnetic therapy for TMD Phillips RS . Prevalence and patterns of adult yoga symptoms. Clinically it has been observed that use in the United States: Results of a national a number of patients have found magnetic survey . Altern Ther Health Med 2004 ; 10 ( 2 ): 44 – 49 . therapy benefi cial for their TMD pain, 11. Tekur P , Singphow C , Nagendra HR , Raghuram whereas a few others have found that the N . Effect of short - term intensive yoga program on coldness of the magnet aggravates their pain. pain, functional disability and spinal fl exibility in Esthetic considerations limit the use of chronic low back pain: A randomized control study . magnets to primarily evening and nighttime. J Altern Complement Med. 2008 Jul; 14 ( 6 ): 637 – 644 . 12. Chou R , Huffman LH ; American Pain Society; REFERENCES American College of Physicians. N onpharmacologic therapies for acute and chronic low back pain: A 1. Gatchel RJ , Stowell AW , Wildenstein L , Riggs R , review of the evidence for an American Pain Ellis E III . Effi cacy of an early intervention for Society/American College of Physicians clinical patients with acute temporomandibular disorder– practice guideline. A nn Intern Med related pain: A one - year outcome study . JADA 2007 ; 147 ( 7 ): 492 – 504 . 2006 ; 137 ( 3 ): 339 – 347 . 13. John PJ , Sharma N , Sharma CM , Kankane A . 2. Fricton J . Myogenous temporomandibular Effectiveness of yoga therapy in the treatment of disorders: Diagnostic and management consider- migraine without aura: A randomized controlled ations . Dent Clin North Am 2007 Jan; 51 ( 1 ): 61 – 83 . trial . Headache 2007 ; 47 ( 5 ): 654 – 661 . 236 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H 14. Kolasinski SL , Garfi nkel M , Tsai AG , Matz W , Van and saline for trigger- p oint therapy. A nesth Analg Dyke A , Schumacher HR . Iyengar yoga for treating 1981 ; 60 : 752 – 755 . symptoms of osteoarthritis of the knees: A pilot 27. Ho KY , Tan KH . Botulinum toxin A for myofascial study . J Altern Complement Med trigger point injection: A qualitative systematic 2005 ; 11 ( 4 ): 689 – 693 . review . Eur J Pain 2007 ; 11 ( 5 ): 519 – 527 . 15. Morone NE , Greco CM . Mind - body interventions 28. Clark GT , Stiles A , Lockerman LZ , Gross SG . A for chronic pain in older adults: A structured critical review of the use of botulinum toxin in review . Pain Med 2007 ; 8 ( 4 ): 359 – 375 . orofacial pain disorders . Dent Clin North Am 2007 16. Da Silva GD , Lorenzi - Filho G , Lage LV . Effects of Jan; 51 ( 1 ): 245 – 261 . yoga and the addition of Tui Na in patients with 29. Wright EF , Schiffman EL . Treatment alternatives fi bromyalgia . J Altern Complement Med for patients with masticatory myofascial pain. J ADA 2007 ; 13 ( 10 ): 1107 – 1113 . 1995 ; 126 ( 7 ): 1030 – 1039 . 17. Kuttner L , Chambers CT , Hardial J , Israel DM , 30. Kraus S . Temporomandibular disorders, head and Jacobson K , Evans K . A randomized trial of yoga orofacial pain: Cervical spine considerations . Dent for adolescents with irritable bowel syndrome. P ain Clin North Am 2007 Jan; 51 ( 1 ): 161 – 193 . Res Manag 2006 ; 11 ( 4 ): 217 – 223 . 31. American Academy of Orofacial Pain. de Leeuw R 18. Cohen BE , Chang AA , Grady D , Kanaya AM . (ed). Orofacial Pain: Guidelines for Assessment, Restorative yoga in adults with metabolic syndrome: Diagnosis and Management , 4th ed. Chicago : A randomized, controlled pilot trial . Metab Syndr Quintessence , 2008 : 164 – 167 . Relat Disord 2008 ; 6 ( 3 ): 223 – 229 . 32. The scope of TMD/orofacial pain (head and neck 19. Smith C , Hancock H , Blake - Mortimer J , Eckert K . pain management) in contemporary dental practice. A randomised comparative trial of yoga and Dental Practice Act Committee of the American relaxation to reduce stress and anxiety . Complement Academy of Orofacial Pain . J Orofac Pain Ther Med 2007 ; 15 ( 2 ): 77 – 83 . 1997 ; 11 ( 1 ): 78 – 83 . 20. Kjellgren A , Bood SA , Axelsson K , Norlander T , 33. Dental Practice Parameters Committee . American Saatcioglu F . Wellness through a comprehensive Dental Association ’ s dental practice parameters: yogic breathing program — a controlled pilot trial . Temporomandibular (craniomandibular) disorders . BMC Complement Altern Med 2007 ; 7 : 43 . JADA Suppl 1997 ; 128 (Feb): 29 – 32 - S . 21. Michalsen A , Grossman P , Acil A , Langhorst J , 34. McNeely ML , Armijo Olivo S , Magee DJ . A L ü dtke R , Esch T , Stefano GB , Dobos GJ . Rapid systematic review of the effectiveness of physical stress reduction and anxiolysis among distressed therapy interventions for temporomandibular women as a consequence of a three - month intensive disorders . Phys Ther 2006 ; 86 ( 5 ): 710 – 725 . yoga program . Med Sci Monit 35. Medlicott MS , Harris SR . A systematic review of 2005 ; 11 ( 12 ): CR555 – 561 . the effectiveness of exercise, manual therapy, 22. Bonnie Prudden Myotherapy . Bonnie Prudden electrotherapy, relaxation training, and biofeedback Myotherapy web site. “ http://www.bonnieprudden. in the management of temporomandibular disorder. com/ . ” Accessed September 16, 2008 . Phys Ther 2006 ; 86 ( 7 ): 955 – 973 . 23. Abdel - Fattah RA . Evaluating and Managing 36. Wright EF , Domenech MA , Fischer JR Jr . temporomandibular injuries , 3rd ed. Boca Raton, Usefulness of posture training for TMD patients . FL : Radiance Publishing Co , 2008 : 572 – 575 . JADA 2000 ; 131 ( 2 ): 202 – 210 . 24. Mense S , Simons DG , Russell IJ . Muscle Pain: 37. Ismail F , Demling A , Hessling K , Fink M , Understanding Its Nature, Diagnosis, and Treat- Stiesch - Scholz
M . Short - term effi cacy of physical ment. Philadelphia : Lippincott Williams & Wilkins , therapy compared to splint therapy in treatment of 2001 : 267 – 271 . arthrogenous TMD . J Oral Rehabil 25. Hong CZ . Considerations and recommendations 2007 ; 34 ( 11 ): 807 – 813 . regarding myofascial trigger point injection . J 38. Raphael KG , Marbach JJ , Klausner J . Myofascial Musculoske Pain 1994 ; 2 ( 1 ): 29 – 59 . face pain: Clinical characteristics of those with 26. Hameroff SR , Crago BR , Blitt CD , Womble J , regional vs. widespread pain . JADA Kanel J . Comparison of bupivacaine, etidocaine, 2000 ; 131 ( 2 ): 161 – 171 . C H A P T E R 1 5 P H Y S I C A L M E D I C I N E 237 39. Gross AR , Hoving JL , Haines TA , Goldsmith CH , temporomandibular joint myofascial pain: A Kay T , Aker P , Bronfort G ; Cervical Overview randomised controlled trial . J Dent Group . A Cochrane review of manipulation and 2007 ; 35 ( 3 ): 259 – 267 . mobilization for mechanical neck disorders . Spine 51. Shin BC , Ha CH , Song YS , Lee MS . Effectiveness 2004 ; 29 ( 14 ): 1541 – 1548 . of combining manual therapy and acupuncture on 40. Jull G , Trott P , Potter H , Zito G , Niere K , Shirley temporomandibular joint dysfunction: A retrospec- D , et al. A randomized controlled trial of exercise tive study . Am J Chin Med 2007 ; 35 ( 2 ): 203 – 208 . and manipulative therapy for cervicogenic headache . 52. List T , Helkimo M , Andersson S , Carlsson GE . Spine 2002 ; 27 ( 17 ): 1835 – 1843 . Acupuncture and occlusal splint therapy in the 41. Bronfort G , Nilsson N , Haas M , Evans R , treatment of craniomandibular disorders. Part I: Goldsmith CH , Assendelft WJJ , Bouter LM . A comparative study . Swed Dent J 1992 ; 16 : Non - invasive physical treatments for chronic/ 125 – 141 . recurrent headache . Cochrane Pain, Palliative and 53. List T , Helkimo M . Acupuncture and occlusal Supportive Care Group Cochrane Database of splint therapy in the treatment of craniomandibular Systematic Reviews . 4 , 2007 . disorders . II: A 1 - year follow - up study. Acta 42. Hall T , Chan HT , Christensen L , Odenthal B , Odontol Scand 1992 ; 50 ( 6 ): 375 – 385 . Wells C , Robinson K . Effi cacy of a C1 - C2 54. Johansson A , Wenneberg B , Wagersten C , self - sustained natural apophyseal glide (SNAG) in Haraldson T . Acupuncture in treatment of facial the management of cervicogenic headache . J Orthop muscular pain. A cta Odontol Scand Sports Phys Ther 2007 ; 37 ( 3 ): 100 – 107 . 1991 ; 49 ( 3 ): 153 – 158 . 43. Oh DW , Kim KS , Lee GW . The effect of physio- 55. Raphael KG , Klausner JJ , Nayak S , Marbach JJ . therapy on post- t emporomandibular joint surgery Complementary and alternative therapy use by patients. J Oral Rehabil 2002 ; 29 ( 5 ): 441 – 446 . patients with myofascial temporomandibular 44. Ernst E , Pittler MH . The effectiveness of acupunc- disorders . J Orofac Pain 2003 ; 17 ( 1 ): 36 – 41 . ture in treating acute dental pain: A systematic 56. DeBar LL , Vuckovic N , Schneider J , Ritenbaugh C . review . Br Dent J 1998 ; 184 ( 9 ): 443 – 447 . Use of complementary and alternative medicine for 45. Staud R . Mechanisms of acupuncture analgesia: temporomandibular disorders. J Orofac Pain Effective therapy for musculoskeletal pain? Curr 2003 ; 17 ( 3 ): 224 – 236 . Rheumatol Rep 2007 ; 9 ( 6 ): 473 – 481 . 57. Kaptchuk TJ , Eisenberg DM . Chiropractic: Origins, 46. Feine JS , Thomason JM . Physical medicine . In: controversies, and contributions . Arch Intern Med Laskin DM , Greene CS , Hylander WL . Temporo- 1998 ; 158 : 2215 – 2222 . mandibular Disorders: An Evidence- B ased 58. Curl DD . Chiropractic management of capsulitis Approach to Diagnosis and Treatment . Hanover and synovitis of the temporomandibular joint . J Park, IL : Quintessence , 2006 : 359 – 375 . Orofac Pain 1993 ; 7 ( 3 ): 283 – 294 . 47. Fox EJ , Melzack R . Transcutaneous electrical 59. Boline PD , Kassak K , Bronfort G , Nelson C , stimulation and acupuncture: Comparison of Anderson AV . Spinal manipulation vs amitriptyline treatment for low - back pain . Pain 1976 ; 2 ( 2 ): for the treatment of chronic tension - type headaches: 141 – 148 . A randomized clinical trial . J Manipulative Physiol 48. Schmid - Schwap M , Simma - Kletschka I , Stockner A , Ther 1995 ; 18 ( 3 ): 148 – 154 . Sengstbratl M , Gleditsch J , Kundi M , Piehslinger E . 60. Devocht JW , Long CR , Zeitler DL , Schaeffer W . Oral acupuncture in the therapy of craniomandibu- Chiropractic treatment of temporomandibular lar dysfunction syndrome — a randomized controlled disorders using the activator adjusting instrument: A trial. Wien Klin Wochenschr 2006 ; 118 ( 1 – 2 ): prospective case series . J Manipulative Physiol Ther 36 – 42 . 2003 ; 26 ( 7 ): 421 – 425 . 49. Goddard G . Short term pain reduction with 61. Gross AR , Hoving JL , Haines TA , Goldsmith CH , acupuncture treatment for chronic orofacial pain Kay T , Aker P , Bronfort G ; Cervical Overview patients . Med Sci Monit 2005 ; 11 ( 2 ):CR 71 – 74 . Group . A Cochrane review of manipulation and 50. Smith P , Mosscrop D , Davies S , Sloan P , Al - Ani Z . mobilization for mechanical neck disorders . Spine The effi cacy of acupuncture in the treatment of 2004 ; 29 ( 14 ): 1541 – 1548 . 238 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H 62. National Center for Complementary and Alterna- 67. Eccles NK . A randomized, double - blinded, tive Medicine . Questions and answers about using placebo - controlled pilot study to investigate the magnets to treat pain. J Pain Palliat Care Pharmaco- effectiveness of a static magnet to relieve dysmenor- ther 2005 ; 19 ( 2 ): 59 – 72 . rhea . J Altern Complement Med 63. Reeser JC , Smith DT , Fischer V , Berg R , Liu K , 2005 ; 11 ( 4 ): 681 – 687 . Untiedt C , Kubista M . Static magnetic fi elds 68. Blechman AM , Oz MC , Nair V , Ting W . neither prevent nor diminish symptoms and signs of Discrepancy between claimed fi eld fl ux density of delayed onset muscle soreness. A rch Phys Med some commercially available magnets and actual Rehabil 2005 ; 86 ( 3 ): 565 – 570 . gaussmeter measurements. A ltern Ther Health Med 64. Eccles NK . A critical review of randomized 2001 ; 7 ( 5 ): 92 – 95 . controlled trials of static magnets for pain relief. 69. Pittler MH , Brown EM , Ernst E . Static magnets for J Altern Complement Med 2005 ; 11 ( 3 ): 495 – 509 . reducing pain: Systematic review and meta - analysis 65. Vaile JM , Gill ND , Blazevich AJ . The effect of of randomized trials . CMAJ 2007 Sep contrast water therapy on symptoms of delayed 25; 177 ( 7 ): 736 – 742 . onset muscle soreness. J Strength Cond Res 70. Kuipers NT , Sauder CL , Ray CA . Infl uence of 2007 ; 21 ( 3 ): 697 – 702 . static magnetic fi elds on pain perception and 66. Panagos A , Jensen M , Cardenas DD . Treatment of sympathetic nerve activity in humans. J Appl myofascial shoulder pain in the spinal cord injured Physiol 2007 ; 102 ( 4 ): 1410 – 1415 . population using static magnetic fi elds: A case series . J Spinal Cord Med 2004 ; 27 ( 2 ): 138 – 142 . Chapter 16 Cognitive - Behavioral Intervention FAQ s Q: Are all psychologists able to help TMD patients satisfactorily control their daytime oral parafunctional and muscle tension habits? A: Few psychologists have specialized training or extensive experience in using cogni- tive - behavioral intervention to treat TMD symptoms, and those not experienced in treating TMD patients would initially appreciate suggestions of specifi c behaviors that need to be changed. Q: Since relaxation has been shown to be benefi cial for TMD symptoms, wouldn ’ t it be helpful if I provide my TMD patients with a relaxation audio compact disc (CD) program? A: Clinically it has been observed that, when TMD patients are handed a relaxation audiotape or CD program, few have the motivation to listen to the tape or CD and practice the therapy consistently. Q: How could a biofeedback machine help patients learn to relax their muscles? A: Biofeedback enables patients to observe how different relaxation techniques can change their muscle tension and, with the feedback system, they usually can learn to relax their masticatory muscles and reduce their TMD symptoms. It is well recognized that daytime parafunc- coping poorly with “ life ’ s stuff, ” etc., nega- tional habits, tension, stress, anxiety, anger, tively impact patients’ TMD symptoms and depression, catastrophizing (thinking the their ability to improve from conservative worst of situations), pain - related beliefs, TMD therapy.1 – 4 Cognitive - behavioral 239 240 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H interventions are adjunctive TMD therapies QUICK CONSULT that attempt to help patients reduce their Differentiating Patients’ Needs daytime parafunctional habits, daytime Patients with minor daytime habits and minor muscle tension, and psychosocial contributing psychosocial contributors can often satisfactorily factors. reduce their habits when they realize how these contribute to their pain, whereas those with FOCAL POINTS signifi cant persistent daytime habits and/or It is well recognized that daytime parafunctional psychosocial contributors often need additional habits, tension, stress, anxiety, anger, depres- help from a practitioner trained in cognitive - sion, catastrophizing (thinking the worst of behavioral interventions. situations), pain- related beliefs, not coping well with “ life ’ s stuff,” etc., negatively impact patients ’ Clinical trials demonstrate that the “ average ” TMD symptoms and their ability to improve from patient who receives cognitive - behavioral conservative TMD therapy. therapy gains comparable TMD symptom Cognitive -b ehavioral interventions are adjunc- improvement as that acquired from occlusal tive TMD therapies that attempt to help patients appliance therapy (see Figures 16.1 and reduce their daytime parafunctional habits and 16.2 ).6 – 8 If used in conjunction with an occlusal psychosocial contributing factors. appliance, patients generally obtain additional symptom improvement (Figure 1 6.2) .8 It has The “ TMD Self - Management Therapies ” also been demonstrated that TMD patients handout (appendix 4 ) provides patients with with poor psychosocial adaptation have some techniques they can use to reduce these signifi cantly greater symptom improvement contributors. Patients with minor daytime when the dentist’ s TMD therapy is combined habits and minor psychosocial contributors with cognitive - behavioral intervention. 9,10 can often satisfactorily reduce their habits when they realize how these contribute to FOCAL POINTS their pain. Patients with signifi cant
persistent Clinical trials demonstrate that the “ average ” daytime habits and/or psychosocial contribu- patient who receives cognitive - behavioral tors often need additional help from a practi- therapy gains comparable TMD symptom tioner trained in cognitive- b ehavioral improvement as acquired from occlusal appli- interventions.5 ance therapy (see Figures 16.1 and 1 6.2 ). Figure 16.1. Occlusal appliance therapy and biofeedback can provide signifi cant TMD improvement. 7 C H A P T E R 1 6 C O G N I T I V E - B E H A V I O R A L I N T E R V E N T I O N 241 Figure 16.2. Occlusal appliance therapy alone, relaxation and stress management (BF/SM) alone, and their combination can provide signifi cant TMD improvement.8 If cognitive - behavioral therapy is used in “ Initial Patient Questionnaire” (appendix 2 ) is conjunction with an occlusal appliance, patients ’ designed to help identify these contributing symptoms generally improve more than from factors. either single therapy (Figure 16.2 ). During the initial TMD evaluation, Cognitive - behavioral interventions primarily patients commonly deny having daytime encompass habit reversal, relaxation, hypnosis, parafunctional habits and psychosocial biofeedback, stress management, and cognitive contributors. Many questions in the “ I nitial therapy (focuses on changing patients ’ dis- Patient Questionnaire ” (appendix 2 ) are torted thoughts). These therapies are generally designed to help identify these contributing provided by psychologists in a combined factors. While contemplating the answers they comprehensive strategy thought most effective will mark on the questionnaire, many patients for the patient and/or disorder. Their long - reason what treatment may be recommended term effi cacy for TMD symptoms has been if they disclose psychosocial contributors, so demonstrated,1 0,11 and they are more effective for patients with daytime symptoms.1 0,12 some modify their answers. On occasion, patients did not respond to therapy as antici- pated and, on further questioning, were found QUICK CONSULT to have not been honest with these “I nitial Comprehending Cognitive- Patient Questionnaire ” answers, primarily Behavioral Interventions because they were not open to receiving the Cognitive - behavioral interventions primarily needed cognitive - behavioral therapy. encompass habit reversal, relaxation, hypnosis, biofeedback, stress management, and cognitive QUICK CONSULT therapy (focuses on changing patients ’ distorted Identifying Daytime Habits and thoughts). Psychosocial Contributors During the initial TMD evaluation, patients Relaxation is often used with most of these commonly deny having daytime parafunctional cognitive intervention therapies, and patients habits and psychosocial contributors, but the are often requested to practice relaxing at least 242 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H once a day. Practitioners should keep in mind Minimal intervention programs for patients that these therapies are time consuming, and with TMD will often have them use diaries the patient must be motivated to practice and implement interventions (e.g., habit them so maximum benefi t is obtained and reversal, progressive muscle relaxation, and maintained over time. cognitive coping skills) that are thought to be most useful for the majority of them. 16 If a QUICK CONSULT suffi cient number of patients are referred for Understanding Patient’ s Role this therapy, the psychologist may be able to Practitioners should keep in mind these thera- provide it in a classroom setting. This would pies are time consuming, and the patient must minimize the cost of the therapy, and most of be motivated to practice them so maximum my patients related they preferred the group benefi t is obtained and maintained over time. setting rather than individual instruction. 13 Clinically it is observed that patients generally need to implement three phases to It has been observed that, to identify which obtain substantial daytime symptom improve- therapies may be most benefi cial for a patient, ment. The degree of TMD symptom improve- some psychologists prefer to perform psycho- ment and required assistance will vary with the logical testing prior to the cognitive- b ehavioral severity of the patient’ s habits and psychoso- intervention. Other psychologists may provide cial factors. These phases are as follows: a standard brief cognitive - behavioral interven- tion and test only those patients who do not 1. Patients must learn how to make their improve suffi ciently. A standard brief masticatory muscles relax (or drain the cognitive - behavioral intervention has been tension from these muscles) and learn shown to be benefi cial for most TMD what relaxed masticatory muscles feel like. patients but is not suffi cient for some, such as those with dysfunctional chronic pain. 13 – 15 For some patients, relaxation training is insuffi cient, and they will need biofeedback to help them learn to relax their muscles. TECHNICAL TIP 2. Patients must learn to identify when they Treating with a Standard Brief are performing parafunctional habits and/ Cognitive - Behavioral Intervention or their masticatory muscles are tense. This A standard brief cognitive - behavioral interven- is usually done through internal and/or tion has been shown to be benefi cial for most external cues (explained in “ B reaking TMD patients but is not suffi cient for some, such Daytime Habits ” in chapter 14 ). as those with dysfunctional chronic pain. 3. When patients are performing parafunc- tional habits, they must learn to stop them For many years, my patients who needed and relax their muscles; when their masti- cognitive - behavioral intervention were catory muscles are tense, they must learn primarily referred to a minimal intervention to drain the tension from these muscles. program, which entailed three sessions that These activities generally occur when were 2 hours long and 1 week apart. This patients are frustrated, busy, or thought- intervention was suffi cient for most of my fully engaged, as when using a computer TMD patients and, if satisfactory improve- or driving a car. Some patients do not ment was not obtained, psychological testing want to release their tension or anger and was performed to identify which additional may need stress management or cognitive therapies might be most benefi cial.1 3 therapy to help them with this. C H A P T E R 1 6 C O G N I T I V E - B E H A V I O R A L I N T E R V E N T I O N 243 Few psychologists have specialized training appointment. The patient would tell the or extensive experience in using cognitive - psychologist the problem during the initial behavioral intervention to treat TMD symp- visit, and the psychologist would assess the toms. There are many alternatives for selecting patient and then generally telephone the a psychologist who can provide this therapy. dentist to discuss the problem and the treat- Behavioral psychology is a specialty, and ment approach. psychologists with this training should be Practitioners may prefer to write a note or able to apply their training easily to TMD summary on their prescription pad or offi ce patients. Some psychologists have specialized stationery. I fax the psychologist patient training in pain management and should be contact information and a summary of my experienced in using relaxation and biofeedback thoughts, such as examples provided in in addition to treating psychological conditions appendix 11 . common among patients with chronic pain. Some medical organizations or third - party Numerous psychologists use relaxation, bio- payers may require the practitioner to write a feedback, and techniques for breaking other consult as in the appendix. Some require their behaviors, e.g., smoking cessation and weight patients to use in- h ouse or contracted psy- loss. These psychologists should be able to chologists, and some require the consults to apply these techniques readily in treating go through their physicians. Patients may TMD patients. Psychologists not experienced need to speak with their third- p arty payer in treating TMD patients would initially regarding referral procedures and copayments appreciate suggestions of specifi c behaviors prior to the practitioner making the referral. that need to be changed, e.g., elimination of Cognitive - behavioral intervention is a daytime parafunctional habits and holding benefi t of most medical insurance policies. tension in the masticatory muscles. Because of the complexities of the medical The Biofeedback Certifi cation Institute insurance, or if the practitioner is not knowl- of America (BCIA) is an organization that edgeable about the psychologists in the area, requires practitioners meet specifi c biofeed- the practitioner may write a summary on a back education and training requirements, prescription pad and request the patient see his plus pass a written examination. Their web or her primary care provider for the referral. site ( www.bcia.org ) enables individuals to search for certifi ed practitioners in a selected BREAKING DAYTIME HABITS city and state. Biofeedback is used for many disorders other than TMD, so psychologists Most TMD patients with signifi cant noctur- found through this source will probably also nal parafunctional habits report their TMD appreciate suggestions of specifi c behaviors symptoms are worse upon awaking and most that need to be changed. TMD patients with signifi cant daytime Many dentists have worked with a psychol- parafunctional habits (including holding an ogist for problems such as dental anxiety and excessive amount of tension in their mastica- needle phobia. Practitioners can telephone one tory muscles) report their TMD symptoms are of the psychologists with whom they have worse later in the day or evening. 12,17 Theo- worked and ask whether someone in the retically patients with signifi cant daytime pain community has expertise in treating TMD can become aware of their parafunctional symptoms. Referring patients to a psychologist habits and/or muscle tightness, break them, can be as easy as giving them the psycholo- and thus dramatically reduce or eliminate gist ’ s name and asking them to make an their daytime pain (see Figure 1.5 ). 244 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H QUICK CONSULT successful, the daytime TMD symptoms Understanding the Cause of should correspondingly decrease, motivating the Daily Symptom Pattern patients to continue work at breaking their Most TMD patients with signifi cant nocturnal daytime habits. parafunctional habits report their TMD symptoms If a patient appears suffi ciently motivated are worse upon awaking and most TMD patients and has minimal daytime symptoms and/or with signifi cant daytime parafunctional habits minimal psychosocial contributors, it is report their TMD symptoms are worse later in recommended that the patient attempt to the day or evening. break the daytime parafunctional habits as part of the self - management therapies. In one study, TMD patients were These daytime parafunctional or muscle - instructed to avoid touching their teeth tightening habits are often subconscious, and together to keep their masticatory muscles the patient may be totally unaware of per- relaxed. They were randomly assigned to be forming them. Patients will often uncon- paged every 2 hours during the day in which sciously cross their ankles while they are they were to check their tooth position and sitting in the dental chair, and correlating this masticatory muscle tension, or to receive a with their oral habits has often been found habit - reversal stabilization appliance that was helpful. It is explained to them that, if they worn up to 20 hours a day. At 4 weeks, had knee pain that was aggravated by crossing subjects in both groups obtained a signifi cant their ankles, they would need to change this decrease in TMD pain (see Figure 1 4.7) . 18 unconscious ankle- c rossing habit. Since their Hence, an occlusal appliance can also be pain is in the jaw, they need to identify and temporarily used as a reminder to help break their oral habits. patients observe and break their daytime Question 26 ( “ What percent of the day are habits (for specifi c recommendations, see your teeth touching? ” ) of the “ Initial Patient “ Appliance Management ” in chapter 12 ). Questionnaire ” will give the practitioner a sense of the patient ’ s
awareness of possible clenching activity. Many TMD patients TECHNICAL TIP lightly rest their teeth together and uncon- Breaking Daytime Habits sciously squeeze them together when they If a patient appears suffi ciently motivated and become busy, concentrate, are irritated, drive has minimal daytime symptoms and/or minimal a car, or use a computer. A pain diary often psychosocial contributors, it is recommended help patients to correlate the activities that are that the patient attempt to break the daytime most associated with their parafunctional or parafunctional habits as part of the self- muscle- tightening activities. management therapies. Decreasing these habits often entails having patients become very aware of their oral habits and masticatory muscle tension during the Habit - reversal therapy has been effectively activities that are most associated with an used by psychologists for many years to treat aggravation of their TMD symptoms or nervous repetitive motion habits such as lip throughout the entire day. They then attempt biting, cheek biting, tongue biting, nail biting, to break the behaviors by repeatedly remind- and tooth clenching. Psychologists often ask ing themselves to keep their masticatory patients to begin with external cues to identify muscles relaxed during this time. If they are and break these habits. An external cue could C H A P T E R 1 6 C O G N I T I V E - B E H A V I O R A L I N T E R V E N T I O N 245 be a piece of a yellow Post - it note placed over Relaxation has been shown to reduce TMD the car’ s speedometer, so that every time the symptoms1 0,20,21 and is traditionally provided patient looks at the speedometer, it reminds in conjunction with habit - reversal and bio- him or her to stop any habit and release any feedback therapies. 7,15 Generally patients fi nd tension in the masticatory muscles. relaxation not only temporarily reduces their Therapy also entails teaching patients what pain but also helps them become aware of relaxed feels like and how to relax their what tense and relaxed masticatory muscles masticatory muscles. With practice patients feel like and develop the capability to relax are able to learn to quickly drain any tension these muscles rapidly whenever they notice found in these muscles. their muscles are tight. As patients are able to make themselves pain Unfortunately practitioners cannot simply free by relaxing their muscles, psychologists hand a relaxation audiotape or CD program often teach patients to use internal cues. An to patients and expect them to listen to it and internal cue that is often used for TMD receive the benefi ts. When TMD patients are patients is to constantly be aware of the level of handed an audiotape program, few have the their masticatory muscle tension. Whenever motivation to listen to the tape or CD and any tension develops within a masticatory practice the therapy consistently. Hence muscle, this immediately alerts the patients. By minimal improvement is observed with this this time these patients are usually aware that if strategy (Figure 16.3 ).2 2 Most TMD patients they allow the tension to build, it will develop appear to need a trained relaxation instructor into pain. Over time this becomes an uncon- to motivate them to practice and assist them scious habit for them and hence they are able with problems they may encounter. to remain pain free throughout the day. Occasionally patients prefer to practice this More examples of external and internal therapy on their own. They can be given the cues are provided in “ Breaking Daytime options of using a relaxation tape or compact Habits ” in chapter 14 . disk purchased from a bookstore; quietly listening to soothing music; taking a warm, RELAXATION relaxing shower or bath; quietly sitting and Progressive muscle relaxation, imagery, hypnosis, yoga, prayer, and meditation appear to provide a similar physiological relaxation response. This response counters the hyper- arousal state individuals may have from overstimulation of their fi ght - or - fl ight mecha- nism. 10 In a survey of TMD patients, relax- ation was one of the self- m anagement therapies that provided patients the most relief from their TMD pain.1 9 TECHNICAL TIP Reducing Hyperarousal State Relaxation counters the hyperarousal state Figure 16.3. Minimal TMD symptom improvement individuals may have from overstimulation of is obtained by only providing TMD patients with their fi ght - or - fl ight mechanism. relaxation tapes.2 2 246 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H taking slow deep breaths; etc. Some patients session, patients maintain control of their may prefer to do this while using a heating thoughts and can come out of the relaxed pad. They should be encouraged to use the state whenever they desire.2 4 Explaining this therapy form that provides them the greatest to patients generally reduces any fear of degree of relaxation and enjoyment. The more adverse reactions. pleasurable the experience is, the greater is the During hypnotherapy, TMD patients are probability of long - term compliance. usually given hypnotic suggestions to release Each of these techniques should help all physical and emotional stress and anxiety. patients obtain the physiological relaxation They generally receive an audiocassette or response and teach them what relaxed muscles compact disk that they listen to repeatedly at feel like. Hopefully patients will thus develop home, enabling them to practice reaching this the ability to reestablish this relaxed state relaxed state and to deal with any residual or whenever they choose. The next step is for future stress or anxiety.2 4,26 them to identify when they are tensing their This provides a similar effect as relaxation masticatory muscles or performing parafunc- therapy, which is aimed to improve daytime tional habits, and consciously stop these habits symptoms. Patients must similarly learn to and induce the relaxed state they have learned. identify when they are tensing their mastica- tory muscles or performing parafunctional HYPNOTHERAPY habits, consciously stop these habits, and bring forth the learned relaxed state. Often, Hypnotherapy or hypnosis, which has been listening to the tape just prior to sleep enables used for pain management since the mid - patients to sleep more peacefully and decreases nocturnal parafunctional habits. 27 1980s, assists patients to reach a deep level of relaxation. Some patients and/or psychologists may prefer hypnotherapy for treating TMD symptoms and it has been shown benefi cial BIOFEEDBACK for treating those symptoms (Figure 16.4 ).2 3 – 25 Hypnotherapy sessions generally last Biofeedback was developed in the 1960s to between 20 and 60 minutes. Throughout the provide patients a manner for observing Figure 16.4. The TMD treatment effect from hypnotherapy.2 5 C H A P T E R 1 6 C O G N I T I V E - B E H A V I O R A L I N T E R V E N T I O N 247 changes in certain physiological measures an occlusal appliance worn at night is more (e.g., muscle activity, blood pressure, and skin effective for patients with nighttime parafunc- temperature). Feedback of muscle activity tional habits.3 1 – 33 It is important for patients (electromyelography [EMG]) is routinely used receiving biofeedback to be taught to transfer with TMD patients, who are taught how to the learned techniques from the therapist ’ s lower their masticatory muscle EMG activity offi ce into their everyday life. It is occasionally to relax these muscles.1 0 The feedback enables found that some biofeedback therapists do not patients to observe how different relaxation help their patients incorporate this relaxed techniques can change their muscle tension state into the stressful, hectic portion of the and, with the feedback system, they usually patient ’ s day, and thus these patients often can learn to relax their masticatory muscles derive minimal benefi t from the therapy. and reduce their symptoms. This is similar to how someone wanting to lower his or her weight would fi nd feedback from a scale TECHNICAL TIP benefi cial. Comparing Biofeedback with Biofeedback is routinely supplemented with Relaxation and an Occlusal relaxation to increase the treatment effect. A Appliance study that compared TMD patients who were Studies suggest that biofeedback with relaxation restricted to only one of these two therapies is more effective for patients with daytime found the average decrease in pain was 35% parafunctional habits, whereas an occlusal for the biofeedback group and 56% for the appliance worn at night is more effective for relaxation group. 28 This suggests relaxation is patients with nighttime parafunctional habits. actually the more benefi cial component when these therapies are combined. Studies demon- At one facility where I practiced, patients strate that biofeedback with relaxation has a with signifi cant daytime symptoms were similar effi cacy as occlusal appliance therapy, routinely taught habit - reversal and relaxation and biofeedback with relaxation provides 29,30 techniques. Patients who related they could long - term TMD symptom relief. relax their entire body except for their masti- catory muscles found biofeedback often QUICK CONSULT exceptionally benefi cial in reducing their Understanding Biofeedback with remaining daytime symptoms. Relaxation Therapy Effi cacy Generally patients with daytime muscle - The study suggests relaxation is actually the tightening or parafunctional habits will have more benefi cial component of the biofeedback signifi cant TMD symptom improvement with relaxation therapy. from breaking these habits, biofeedback with relaxation (relaxation being the more impor- tant component), and/or an occlusal appliance In general, TMD patients with signifi cant temporarily worn during the day to increase daytime parafunctional habits complain about their awareness of these habits. daytime or evening symptoms, whereas patients with signifi cant nighttime parafunc- tional habits complain of symptoms when they STRESS MANAGEMENT fi rst awake. Studies suggest that biofeedback with relaxation is more effective for patients Stress management is a cognitive approach with daytime parafunctional habits, whereas to deal with the stresses, irritations, or 248 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H frustrations that patients encounter. Some TECHNICAL TIP studies suggest the average TMD patient Avoiding the Word “ Stress ” does not cope as well with stress as patients It is observed that TMD patients tend to deny without TMD. 34,35 TMD patients tend to they are stressed, but agree they are busy, tighten their masticatory muscles in these frustrated, irritated, and hold tension in their situations, 36 and stress management teaches muscles. Therefore, I avoid using the word coping skills to help them better manage “ stress, ” and use the terms “ busy, ” “ frustrated, ” these situations and their thoughts about “ irritated, ” and “ hold tension in your muscles.” them. TMD patients often receive stress manage- FOCAL POINT TMD patients tend to tighten their masticatory ment in combination with biofeedback and muscles in stressful, irritating, or frustrating relaxation therapies, and this combination situations, and stress management teaches generally provides a signifi cant reduction in coping skills to help them better manage TMD symptoms that is maintained over these situations and their thoughts about time.8 ,14,37 them. REFERENCES Tension and emotional states are highly correlated with TMD patients ’ pain levels.3 1. Sipil ä K , Yl ö stalo PV , Ek E , Raustia AM . Associa- Clinically it appears TMD is often related to tion of stress level with facial pain: The role of the minor stresses and TMD patients com- coping . Cranio 2008 ; 26 ( 3 ): 216 – 221 . monly discount the contribution of stress. 2. Turner JA , Holtzman S , Mancl L . Mediators, Many say their life is not stressful, but moderators, and predictors of therapeutic change in acknowledge they often hold tension in their cognitive - behavioral therapy for chronic pain . Pain 2007 ; 127 ( 3 ): 276 – 286 . jaw, neck, and/or shoulders and are frustrated 3. Glaros AG , Williams K , Lausten L . The
role of or irritated a considerable amount of the time parafunctions, emotions and stress in predicting (see Question 22 of the “ I nitial Patient facial pain . JADA 2005 ; 136 ( 4 ): 451 – 458 . Questionnaire ” [appendix 2 ]). TMD symp- 4. Kafas P , Leeson R . Assessment of pain in temporo- toms tend to become aggravated when patients mandibular disorders: The bio - psychosocial are busier, more frustrated, or irritated, and complexity . Int J Oral Maxillofac Surg sometimes it takes a daily pain/busyness diary 2006 ; 35 ( 2 ): 145 – 149 . for them to see these associations. 5. T ü rp JC , Jokstad A , Motschall E , Schindler HJ , It is observed that TMD patients generally Windecker - G é taz I , Ettlin DA . Is there a superiority agree with these tendencies when the terms of multimodal as opposed to simple therapy in “ busy, ” “ frustrated, ” “ irritated, ” and “ hold patients with temporomandibular disorders? A tension in your muscles ” are used rather than qualitative systematic review of the literature . Clin Oral Implants Res 2007 ; 18 Suppl 3 : the word “ stress. ” It is then explained that 138 – 150 . they need to learn to release the tension held in 6. Carlson CR . Psychological considerations for their masticatory muscles and learn coping chronic orofacial pain . Oral Maxillofac Surg Clin skills to minimize the amount of time they feel North Am 2008 May; 20 ( 2 ): 185 – 195 , vi. busy, frustrated, or irritated. With this discus- 7. Dahlstrom L . Conservative treatment of mandibular sion, patients are usually open to work with dysfunction: Clinical, experimental and electromyo- someone to learn relaxation and/or stress graphic studies of biofeedback and occlusal management. appliances . Swed Dent J Suppl 1984 ; 24 : 1 – 45 . C H A P T E R 1 6 C O G N I T I V E - B E H A V I O R A L I N T E R V E N T I O N 249 8. Turk DC , Zaki HS , Rudy TE . Effects of intra - oral Investigation . Appl Psychophysiol Biofeedback appliance and biofeedback/stress management alone 2007 ; 32 ( 3 – 4 ): 149 – 154 . and in combination in treating pain and depression 19. Riley JL 3rd , Myers CD , Currie TP , Mayoral O , in patients with temporomandibular disorders. J Harris RG , Fisher JA , Gremillion HA , Robinson Prosthet Dent 1993 ; 70 ( 2 ): 158 – 164 . ME . Self - care behaviors associated with myofascial 9. American Academy of Orofacial Pain . de Leeuw R temporomandibular disorder pain. J Orofac Pain (ed). O rofacial Pain: Guidelines for Assessment, 2007 ; 21 ( 3 ): 194 – 202 . Diagnosis and Management , 4th ed . Chicago : 20. Dworkin SF , Turner JA , Wilson L , Massoth D , Quintessence , 2008 : 161 . Whitney C , Huggins KH , Burgess J , Sommers E , 10. Orlando B , Manfredini D , Salvetti G , Bosco M . Truelove E . Brief group cognitive - behavioral Evaluation of the effectiveness of biobehavioral intervention for temporomandibular disorders . Pain therapy in the treatment of temporomandibular 1994 ; 59 ( 2 ): 175 – 187 . disorders: A literature review. B ehav Med 21. Carlson CR , Bertrand PM , Ehrlich AD , Maxwell 2007 ; 33 ( 3 ): 101 – 118 . AW , Burton RG . Physical self - regulation training 11. Gardea MA , Gatchel RJ , Mishra KD . Long - term for the management of temporomandibular effi cacy of biobehavioral treatment of temporoman- disorders . J Orofac Pain 2001 ; 15 ( 1 ): 47 – 55 . dibular disorders. J Behav Med 22. Okeson JP , Moody PM , Kemper JT , Haley JV . 2001 ; 24 ( 4 ): 341 – 359 . Evaluation of occlusal splint therapy and relaxation 12. Wright EF . Multidisciplinary treatment recommen- procedures in patients with temporomandibular dations vary with daily TMD symptom pattern. disorders . JADA 1983 ; 107 ( 3 ): 420 – 424 . TMDiary 2007 ; 22 ( 2 ): 44 – 45 . 23. Stam HJ , McGrath PA , Brooke RI . The effects of a 13. Bogart RK , McDaniel RJ , Dunn WJ , Hunter C , cognitive - behavioral treatment program on Peterson AL , Wright EF . Effi cacy of group temporo - mandibular pain and dysfunction cognitive behavior therapy for the treatment of syndrome. Psychosom Med 1984 ; 46 ( 6 ): 534 – 545 . masticatory myofascial pain . Mil Med 24. Loitman JE . Pain management: Beyond pharmacol- 2007 ; 172 ( 2 ): 169 – 174 . ogy to acupuncture and hypnosis . J Am Med Assoc 14. Turner JA , Mancl L , Aaron LA . Brief cognitive - 2000 ; 283 ( 1 ): 118 – 119 . behavioral therapy for temporomandibular disorder 25. Simon EP , Lewis DM . Medical hypnosis for pain: Effects on daily electronic outcome and temporomandibular disorders: Treatment effi cacy process measures . Pain 2005 ; 117 ( 3 ): 377 – 387 . and medical utilization outcome. O ral Surg Oral 15. Townsen D , Nicholson RA , Buenaver L , Bush F , Med Oral Pathol Oral Radiol Endod 2000 ; 90 ( 1 ): Gramling S . Use of a habit reversal treatment for 54 – 63 . temporomandibular pain in a minimal therapist 26. Dubin LL . The use of hypnosis for temporoman- contact format . J Behav Ther Exp Psychiatry dibular joint (TMJ) . Psychiatr Med 1992 ; 10 ( 4 ): 2001 ; 32 ( 4 ): 221 – 239 . 99 – 103 . 16. Auerbach SM , Laskin DM , Frantsve LM , Orr T . 27. Somer E . Hypnotherapy in the treatment of chronic Depression, pain, exposure to stressful life events, nocturnal use of a dental splint prescribed for and long - term outcomes in temporomandibular bruxism . Int J Clin Exp Hypn 1991 ; 39 ( 3 ): disorder patients. J Oral Maxillofac Surg 145 – 154 . 2001 ; 59 ( 6 ): 628 – 633 . 28. Funch DP , Gale EN . Biofeedback and relaxation 17. Rossetti LM , Pereira de Araujo Cdos R , Rossetti therapy for chronic temporomandibular joint pain: PH , Conti PC . Association between rhythmic Predicting successful outcome . J Consult Clin masticatory muscle activity during sleep and Psychol 1984 ; 52 ( 6 ): 928 – 935 . masticatory myofascial pain: A polysomnographic 29. Rinchuse DJ , McMinn JT . Summary of evidence - study . J Orofac Pain 2008 ; 22 ( 3 ): 190 – 200 . based systematic reviews of temporomandibular 18. Glaros AG , Kim - Weroha N , Lausten L , Franklin disorders . Am J Orthod Dentofacial Orthop KL . Comparison of Habit Reversal and a 2006 ; 130 ( 6 ): 715 – 720 . Behaviorally - Modifi ed Dental Treatment for 30. Gardea MA , Gatchel RJ , Mishra KD . Long - Temporomandibular Disorders: A Pilot term effi cacy of biobehavioral treatment of 250 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H temporomandibular disorders. J Behav Med 35. Takemura T , Takahashi T , Fukuda M , Ohnuki T , 2001 ; 24 ( 4 ): 341 – 359 . A sunuma T , M asuda Y , K ondoh H , K anbayashi T , 31. Pierce CJ , Gale EN . A comparison of different Shimizu T . A psychological study on patients with treatments for nocturnal bruxism . J Dent Res masticatory muscle disorder and sleep bruxism . 1988 ; 67 : 597 – 601 . Cranio 2006 ; 24 ( 3 ): 191 – 196 . 32. Hijzen TH , Slangen JL , Van Houweligen HC . 36. Gremillion HA , Waxenberg LB , Myers CD , Benson Subjective, clinical and EMG effects of biofeedback MB . Psychological considerations in the diagnosis and splint treatment . J Oral Rehabil 1986 ; 13 : and management of temporomandibular disorders 529 – 539 . and orofacial pain . Gen Dent 2003 ; 51 ( 2 ): 168 – 172 . 33. Dahlstrom L , Carlsson SG . Treatment of mandibu- 37. Gardea MA , Gatchel RJ , Mishra KD . Long - term lar dysfunction: The clinical usefulness of biofeed- effi cacy of biobehavioral treatment of temporoman- back in relation to splint therapy . J Oral Rehabil dibular disorders . J Behav Med 1984 ; 11 : 277 – 284 . 2001 ; 24 ( 4 ): 341 – 359 . 34. Sipil ä K , Yl ö stalo PV , Ek E , Raustia AM . Associa- tion of stress level with facial pain: The role of coping . Cranio 2008 ; 26 ( 3 ): 216 – 221 . Chapter 17 Pharmacological Management FAQ s Q: Do muscle relaxants also help reduce a TMD patient ’ s anxiety related to stress? A: It has been speculated that muscle relaxants may be particularly effective for patients with an acute condition related to a short - term stressful situation, because they can generally help alter a patient ’ s perception of the situation or its emotional impact. Q: Will dentists be accused of treating psychological disorders if we prescribe tricyclic antidepressants for our TMD patients? A: At the low doses tricyclic antidepressants are used in treating TMD, they do not provide an antidepressant effect, euphoria, or mood elevation, and have low abuse potential. Q: Is glucosamine benefi cial for patients with TMJ osteoarthritis? A: Yes. A study among symptomatic TMJ osteoarthritis patients found glucosamine provided the subjects with signifi cant symptom improvement. Clinical experience and controlled studies pharmacological principles used for musculo- demonstrate that pharmacological manage- skeletal disorders of other areas of the body ment can generally reduce a patient’ s pain and apply for the pharmacological management of sometimes speed recovery. Practitioners tend TMD, because medications generally affect to have a favorite medication to prescribe to the rest of the musculoskeletal system as they their TMD patients, even though no one drug do the masticatory musculoskeletal system. has been shown best for the wide spectrum of TMD is often comparable to repetitive TMD conditions. Many of the motion disorders in other parts of the body. 251 252 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H FOCAL POINT TMD pharmacological management most Practitioners tend to have a favorite medication commonly involves over - the - counter analge- to prescribe to their TMD patients, even though sics (including NSAIDs) and prescription no one drug has been shown best for the wide anti - infl ammatory drugs, muscle relaxants, spectrum of TMD conditions. low - dose tricyclic antidepressants, topical medications, and nutritional supplements. Patients with chronic TMD symptoms The “ TMD Self - Management Therapies ” typically need to change their perpetuating handout (appendix 4 ) recommends over- factors to obtain long- t erm control of their the - counter medications for patients who symptoms. Clinically it is observed that some prefer to try one. Practitioners must weigh patients with chronic symptoms who are the medication ’ s potential benefi ts against initially prescribed medication(s) that provide its side - effect risks, along with their adequate symptom relief prefer to stay on competence in managing patients taking these medication(s) long term rather than the medication. change their perpetuating factors. Therefore, There are reports that the selective sero- prescribing muscle relaxants to patients who tonin reuptake inhibitor (SSRI) antidepres- have chronic TMD symptoms
is avoided, sants, in addition to many other medications, unless they have an acute exacerbation. may contribute to TMD symptoms.1 ,2 The Patients with chronic symptoms who desire a knowledge regarding which medications are prescription are typically prescribed medica- more prone to cause this side effect is cur- tions that can be used long term, i.e., non- rently insuffi cient to recommend a patient ’ s steroidal anti - infl ammatory drugs (NSAIDs) physician change the medication. Therefore, if on an as - needed basis and/or tricyclic antide- it is believed a medication is contributing to a pressants. If possible, chronic TMD symp- patient ’ s TMD symptoms, this possibility is toms are preferably controlled through discussed with the patient, this medication is nonpharmaceutical management, e.g., self- considered a possible contributing factor, and management therapies, occlusal appliance the patient is treated in the usual protocol, therapy, or cognitive - behavioral interventions. presented in this book. Psychoactive medications prescribed for psychiatric disorders should be provided by QUICK CONSULTS psychiatrists or physicians as part of compre- Understanding Some Patients’ hensive mental health therapy. Treatment Desires Clinically it is observed that some patients with chronic symptoms who are initially prescribed ANALGESICS medication(s) that provide adequate symptom relief prefer to stay on these medication(s) long The salicylates, acetaminophen, ibuprofen, term rather than change their perpetuating factors. naproxen sodium, ketoprofen, and capsaicin are the major analgesics available without a Using Pharmaceutical prescription in the United States. Acetamino- Management phen produces few gastric problems and does If possible, chronic TMD symptoms are preferably not interfere with the clotting mechanism, but controlled through nonpharmaceutical manage- chronic use (more than 5,000 pills in a ment, e.g., self- management therapies, occlusal lifetime) has been associated with approxi- appliance therapy, or habit- breaking techniques. mately a 2.5- f old increase in kidney failure. 3 C H A P T E R 1 7 P H A R M A C O L O G I C A L M A N A G E M E N T 253 NSAIDs are a commonly used analgesic for her parafunctional habits, the TMJ infl amma- TMD as well as for other pains in the body, tion and associated symptoms return after the and patients whose TMD pain is primarily medication is stopped. caused by TMJ infl ammation may obtain signifi cant improvement from an NSAID.4 Although NSAIDs are generally well tolerated, QUICK CONSULT they have a dose - related association with a wide spectrum of adverse effects. 5 A retrospec- Observing the Effects of Anti- tive analysis of patients with end - stage kidney infl ammatory Medications disease requiring hemodialysis demonstrated Clinically it is common to observe anti - infl am- an association between chronic NSAID use matory medications reducing TMJ infl ammation (more than 5,000 pills in a lifetime) and a and associated symptoms while the patient ninefold increase risk of end- s tage kidney is taking the medication; but, if a patient disease. 3 with chronic symptoms has not adequately Over - the - counter NSAID sales are 30 reduced his or her parafunctional habits, billion dollars annually. 5 Combining acet- the TMJ infl ammation and associated aminophen with an NSAID can provide symptoms return after the medication is better pain relief, allow for lower doses to be stopped. used, and reduce the potential for adverse effects. 6 A topical NSAID can be prescribed and has fewer side - effect risks (see “ Topical Anti - infl ammatory medication is generally Medications ” in this chapter). benefi cial for patients with acute TMJ infl am- Capsaicin (Zostrix), another analgesic mation caused by conditions such as acute agent that has been advocated for treatment of disc displacement without reduction or TMD, is specifi cally designed for topical secondary to acute trauma. Patients with acute application7 (see “ Topical Medications ” in this TMJ disc displacement without reduction chapter). typically fi nd that anti - infl ammatory medica- tion reduces the infl ammation associated with the pain, enabling them to stretch the retro- ANTI -I NFLAMMATORY MEDICATIONS discal tissue and move their disc further anterior. With the disc more anterior, patients TMD therapy uses anti - infl ammatory medica- regain their opening, thereby decreasing the tions primarily to reduce infl ammation within disc ’ s interference, and the infl ammation is the TMJ. As the medication reduces TMJ less likely to return. infl ammation, the associated pain and dys- For mild or moderate pain related to function correspondingly decrease. Practitio- TMJ infl ammation in which I would like ners should remember that chronic TMJ a patient to take an anti - infl ammatory infl ammation is generally secondary to medication, naproxen or naproxen sodium excessive parafunctional activity overloading is generally recommended.4 For more s evere the TMJ.8 Therefore, clinically it is common pain (6 of 10 or greater) related to TMJ to observe anti - infl ammatory medications infl ammation, a short course of oral cortico- reducing TMJ infl ammation and associated steroids followed by an NSAID is generally symptoms while the patient is taking the prescribed. These regimens are discussed medication; but, if a patient with chronic further in their corresponding following symptoms has not adequately reduced his or sections. 254 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H The nutritional supplement glucosamine (220 mg naproxen sodium), and Orudis KT has also been shown to be benefi cial for (12.5 mg ketoprofen). I may ask the patient to patients with TMJ infl ammation and to have increase the over - the - counter dosages and/or minimal side effects. 9 If it is preferred that a combine it with acetaminophen. patient use an anti- i nfl ammatory medication Clinically it appears to me that patients long term, the nutritional supplement or an who have primarily muscle pain fi nd ibupro- NSAID taken on an as- n eeded basis would be fen more effective, whereas those whose pain reasonable choices (see “ Nutritional Supple- is primarily from TMJ infl ammation fi nd ments ” in this chapter). naproxen or naproxen sodium more effective. If an NSAID is used to treat a patient with acute TMJ infl ammation, I generally prescribe Nonsteroidal Anti- infl ammatory Drugs naproxen, 500 mg b.i.d., for 2 weeks. Clini- (Ingested Form) cally it is observed that naproxen appears to lose its effectiveness if a patient uses this Since the association of rofecoxib (Vioxx) and dose on a continuous basis for more than 2 cardiovascular events was reported, there have weeks.1 3 Therefore, I generally ask patients to been intense discussions over the safety of take 500 mg naproxen twice a day for 2 weeks selective COX2 inhibitors and nonselective and then only as needed (no more than a (traditional) NSAIDs. This resulted in some couple of times a week), if they desire to COX 2 inhibitors being removed from the continue using it. market, recommendations to use acetamino- phen more frequently for patients with TECHNICAL TIP musculoskeletal pain, and recommendations Observing Ibuprofen and to better monitor patients taking NSAIDs long term.5 ,10 Naproxen Differences Clinically it appears to me that patients who NSAIDs usually provide some relief for have primarily muscle pain fi nd ibuprofen more mild to moderate TMJ infl ammation and/or effective, whereas those whose pain is primarily muscle pain. No individual NSAID has been from TMJ infl ammation fi nd naproxen or found to be superior in analgesic effect, and naproxen sodium more effective. individual patient response is highly variable. Therefore, if a patient does not obtain satisfactory improvement with one NSAID, Gastrointestinal symptoms (epigastric pain, this does not indicate that a different NSAID bloating, nausea, and heartburn) are the most would not be of benefi t. 11,12 common reason patients discontinue NSAID The typical NSAIDs and dosages I pre- therapy. The NSAID - induced upper gastroin- scribe are i buprofen (Motrin), 800 mg t.i.d. testinal symptoms can be reduced if patients or q.i.d.; naproxen (Naprosyn), 500 mg b.i.d.; also takes a proton pump inhibitor (e.g., and n aproxen sodium (Anaprox), 550 mg Prilosec) during the period they use the NSAID. 5b.i.d. A 550 - mg tablet of naproxen sodium (Anaprox) is equivalent to a 500 - mg Naprosyn tablet. Primarily due to poor QUICK CONSULT prescription insurance benefi ts, some patients NSAID - Induced Gastrointestinal prefer to take one of the three over - the - Symptoms counter NSAID formulations available, which The NSAID - induced upper gastrointestinal are Motrin IB (200 mg ibuprofen), Aleve symptoms can be reduced if the patient also C H A P T E R 1 7 P H A R M A C O L O G I C A L M A N A G E M E N T 255 takes a proton pump inhibitor (e.g., Prilosec) and the patient is referred to a physician for during the period that the NSAID is used. long - term monitoring and management. Since NSAIDs are responsible for a wide spectrum of adverse effects, acetaminophen COX2 inhibitors have an effi cacy compa- is being recommended more frequently for rable to nonselective NSAIDs, 16 and even low patients with musculoskeletal pain. Arthritis doses as well as short - term COX2 inhibitors organizations recommend NSAIDs be reserved use have increased risk for myocardial infarc- for osteoarthritis patients who do not respond tions and arrhythmias. 5 The COX2 inhibitors to acetaminophen.5 Additionally, the American celecoxib (Celebrex) and meloxicam (Mobic) Heart Association recommends patients with are available in the United States and etori- cardiovascular disease who need medication coxib (Arcoxia) should be on the market soon. for acute musculoskeletal pain be provided Keep in mind that these medications are medications in a stepwise approach starting expensive, and NSAIDs generally do not with acetaminophen, followed by aspirin, then provide TMD patients with much relief. tramadol, etc. 14 Naproxen and ibuprofen NSAIDs are primarily ingested and this appear to be the safest with respect to cardio- section pertains to these formulations. If a vascular risk and ibuprofen appears to be the patient has cardiac, renal, or gastrointestinal safest with respect to gastrointestinal risk. 5,11 risks from ingesting an NSAID, the practitio- Due to the potential adverse effects from ner may recommend a topical NSAID. They long - term NSAID use, patients are generally have comparable effi cacy with low risk of the not maintained on an NSAID long term, other effects; see “ Topical Medications ” in except on an as - needed basis. Also, clinically it this chapter. NSAIDs have also been given is observed that most TMD patients do not through trigger- point injections 17 and TMJ obtain suffi cient symptom relief to merit phonophoresis. 18 taking an NSAID on a continuous basis. If a patient needs to be on an NSAID long term, the preferred NSAID and dose are deter- Steroidal Anti - infl ammatory Drugs mined, and the patient is referred to a physi- cian for long - term monitoring and Corticosteroids are potent anti - infl ammatory management. 5,15 medications that can be used to treat moder- ate to severe pain (6 of 10 or greater) from infl ammation. Due to their potential adverse QUICK CONSULT effects from extended use, a short course is Prescribing an N SAID Long Term typically prescribed for TMD patients, Due to the potential adverse effects from followed by an NSAID. An expedient method long - term NSAID use, patients are generally not of providing a 6 - day declining dose of cortico- maintained on an NSAID long term, except on an steroid is by prescribing a Medrol Dosepak , as - needed basis. which is 21 methylprednisolone tablets conveniently packaged with easy - to - follow directions. 19 TECHNICAL TIP If an oral corticosteroid is the preferred Maintaining Patients on NSAID s treatment, I generally prescribe a Medrol If a patient needs to be on an NSAID long term, Dosepak and 2 or more weeks of naproxen. the preferred NSAID and dose are determined, Patients are routinely requested to start the 256 P A R T I V M U L T I D I S C I P L I
N A R Y T R E A T M E N T A P P R O A C H naproxen on day 4 of Medrol Dosepak use; needed to induce muscle relaxation locally, this decreases the likelihood of adverse leading some investigators to believe the gastrointestinal symptoms in the beginning observed muscular relaxation is primarily when the corticosteroid dose is high, and accomplished through sedation and reduction extends the anti- i nfl ammatory response. The of psychoemotional stress.1 3,21 It has been prescriptions are written as follows: Medrol speculated that muscle relaxants may be Dosepak, 1 package, take as directed on particularly effective for patients with an acute package (m. dict. on package), and naproxen, condition related to a short- t erm stressful 500 mg b.i.d., start on the fourth day of the situation, because they can generally help alter Dosepak. a patient ’ s perception of the situation or its emotional impact. 13,21 The more common TECHNICAL TIP central - acting muscle relaxants include Prescribing an Oral Corticosteroid diazepam (Valium), carisoprodol (Soma), I methocarbamol (Robaxin), chlorzoxazone f an oral corticosteroid is the preferred treat- (Parafl ex), and cyclobenzaprine (Flexeril). ment, I will generally prescribe a Medrol Occasionally I would like to decrease a Dosepak and 2 or more weeks of naproxen, in patient ’ s nocturnal muscle activity temporarily which the patient starts the naproxen on day 4 and can generally accomplish this pharmaceu- of Medrol Dosepak use. tically by prescribing a central- a cting muscle relaxant.2 ,21 For instance, at the initial exami- Corticosteroids are most often taken orally, nation, a patient may relate that, for the past but can be provided for TMD patients month, he or she routinely awakes with an through topical application, phonophoresis, acute TMJ disc displacement without reduc- iontophoresis, and injection into the TMJ or tion that lasts half an hour and has been another source of the infl ammation.1 3,19 TMJ worsening over the past few days. A concern corticosteroid injections are benefi cial for is that, before a stabilization appliance can reducing TMJ infl ammation, but chronic be provided, the disorder may worsen and injections can cause condylar degeneration; the TMJ may not unlock one morning. therefore, they are usually limited to two Therefore, the patient is prescribed a central- injections during any 1- y ear period. 13,19 acting muscle relaxant to take at bedtime Surgeons generally also use a corticosteroid (e.g., 5 mg diazepam, 1 – 2 tablets h.s.) to at the end of arthrocentesis and arthroscopic decrease the nocturnal muscle activity and procedures to obtain its potent anti - thereby decrease the probability of the dis- infl ammatory response postoperatively. 20 order worsening. One study suggests this regimen is similarly benefi cial to a stabiliza- tion appliance. 22 MUSCLE RELAXANTS These decrease skeletal muscle tone and are TECHNICAL TIP generally prescribed for TMD patients with Decreasing Nocturnal Muscle acute muscle pain or to decrease muscle Activity activity temporarily.1 3,2 Most muscle relaxants Occasionally I would like to decrease a patient ’ s are primarily central acting agents , and their nocturnal muscle activity temporarily and can mechanism of action is not clearly under- generally accomplish this pharmaceutically by stood. The oral doses are well below the levels prescribing a central - acting muscle relaxant. C H A P T E R 1 7 P H A R M A C O L O G I C A L M A N A G E M E N T 257 Another situation in which I would con- Patients are generally prescribed 5 - mg sider prescribing patients a central- a cting tablets of diazepam and asked to take 1– 2 muscle relaxant to decrease their nocturnal tablets at bedtime. On occasion, patients muscle activity would be one in which the would like to take a muscle relaxant during patient relates at the initial examination that the day. I discuss starting with one - fourth to he or she awakes with signifi cant pain and one - half of the 5 - mg diazepam tablet in the would like some relief prior to my being able morning and afternoon. If a practitioner to provide a stabilization appliance. A central - prefers, diazepam can be prescribed in 2 - mg acting muscle relaxant taken prior to bed tablets. I add to the prescription “ if does not should decrease a patient’ s nocturnal muscle cause drowsiness ” and discuss with the patient activity temporarily, thereby decreasing the trying the medication in such a manner that it morning pain. This should reduce pain caused will not be dangerous if it causes drowsiness. by either the muscle or TMJ infl ammation. If It is observed that patients are generally the pain is primarily due to TMJ infl amma- responsible when practitioners take the time tion, naproxen or naproxen sodium may also to discuss these issues. provide adequate benefi t. Rarely do I have a patient take a central - The primary muscle relaxants and dosages acting muscle relaxant for more than 3 often prescribed for TMD are diazepam weeks. Some patients have a combination (Valium), 2 – 10 mg h.s. (low doses may be of acute TMJ infl ammation and muscle able to be taken during the day); methocarba- pain, for which they may be prescribed a mol (Robaxin), 500 mg h.s. or t.i.d.; and central - acting muscle relaxant together cyclobenzaprine (Flexeril), 10 mg h.s. (half a with an NSAID or aspirin, and tablet may be taken in the morning and acetaminophen. afternoon). All are sedating and are preferably Baclofen (Lioresal) is a peripheral - acting taken only at bedtime. muscle relaxant that works at the spinal cord Diazepam has been shown benefi cial in level.2 3 Since the masticatory muscles are treating muscle pain.2 1,13 When I would like primarily innervated by the fi fth cranial nerve a TMD patient to take a muscle relaxant, I (the posterior digastric muscle is innervated prefer to prescribe diazepam, because it is very by the seventh cranial nerve), it is understand- inexpensive and patients generally have heard able that most of my TMD patients relate of Valium and know that it is not to be taken baclofen is not benefi cial for their masticatory long term. Hence, I have not had patients symptoms, but they generally fi nd it valuable wanting to do so, while I have had patients for their neck pain. Occasionally 1 tablet of given other similar muscle relaxants wanting 10 mg baclofen, q4h p.r.n., is prescribed for to rely on the medication to control their neck pain and, since it does not act centrally, TMD symptoms rather than changing the it typically does not cause sedation. It is necessary contributing factors. preferable that patients have their neck symptoms treated by nonpharmaceutical therapies, i.e., by improving their posture QUICK CONSULT and learning neck exercises (usually taught Prescribing Muscle Relaxants by a physical therapist). Sometimes baclofen I prefer to prescribe diazepam, because it is is prescribed prior to the patient getting an very inexpensive and patients seem to have appointment with the physical therapist heard of Valium and know that it is not to be and on an as- n eeded basis for residual taken long term. symptoms. 258 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H TRICYCLIC ANTIDEPRESSANTS Amitriptyline (Elavil), nortriptyline (Pamelor), and desipramine (Norpramin) are Tricyclic antidepressants (TCAs) were origi- frequently used TCAs in the treatment of nally prescribed to treat depression, but over chronic pain,3 3 and the degree of sedation the the last 50 years have been used to treat average patient receives from these varies from chronic musculoskeletal disorders and neuro- extensive to none. Clinically one of these pathic pain in doses well below those used for TCAs is selected based on the degree of sleep depression.2 1,24 At these low doses, they do not disturbance the patient reports and whether induce euphoria or mood elevation, and have the medication is needed while the patient is low abuse potential. 25 asleep or awake. Patients are asked to titrate A meta - analysis of 39 placebo - controlled the medication within the limits of the studies that evaluated TCAs for patients with prescription so it provides the most desirable chronic pain indicates TCAs can provide effect. statistically signifi cant pain relief.2 4 Their Amitriptyline (Elavil) has substantial primary therapeutic effect is thought to be sedation associated with it, and clinically it is related to their ability to increase the neuro- observed that amitriptyline is most effective transmitters serotonin and norepinephrine at for patients who have a signifi cant sleep the synapses within the central nervous problem and awake with pain. I prescribe system. 19,21 10 mg tablets and recommend 10 – 50 mg 1 – 6 TCAs have been reported to decrease TMD hours prior to bed. The patient is asked to pain, decrease masticatory nocturnal electro- start with 10 mg 3 – 4 hours prior to bed and myelographic (EMG) activity, and provide increase the dose slowly, adjust the time the masticatory muscle relaxation for TMD medication is taken prior to bed that is best patients.2 6 – 29 Individual TMD patient for him or her, and balance the benefi ts and response is highly variable, and some indi- side effects of medications within the limits of viduals will fi nd no benefi t from taking the prescription. TCAs. 2,30,31 Nortriptyline (Pamelor) has much less Disturbed sleep is a common problem sedation associated with it, and clinically it is among TMD patients that tends to worsen observed that nortriptyline is most effective the TMD symptoms, and TMD patients with for patients who have no or mild sleep disturbed sleep tend not to improve as much disturbance and awake with pain. I prescribe from conservative TMD therapy as do other 10 mg tablets and recommend 10 – 50 mg 0 – 3 patients.1 ,32 Sedation is a side effect for most hours prior to bed. The patient is asked to TCAs and, if the TCA is properly chosen and start with 10 mg 1 hour prior to bed and titrated, it might improve the quality of a increase the dose slowly, adjust the time the patient’ s deep restorative sleep in addition to medication is taken prior to bed that is best providing the traditional TCA benefi ts.2 1 for him or her, and balance the benefi ts and side effects of medications within the limits of QUICK CONSULT the prescription. Some patients fi nd a low Prescribing T CA s dose in the morning and afternoon benefi cial Sedation is a side effect for most TCAs and, if if the dose does not cause drowsiness. the TCA is properly chosen and titrated, it might Desipramine (Norpramin) essentially has improve the quality of the patient ’ s deep no sedation associated with it, and I use it for restorative sleep in addition to providing the patients with daytime pain. I prescribe 25 m g traditional TCA benefi ts. tablets and recommend 25 m g in the morning C H A P T E R 1 7 P H A R M A C O L O G I C A L M A N A G E M E N T 259 and afternoon, as needed. Some patients have Compared with TCAs, selective serotonin reported to me that taking it at bedtime keeps reuptake inhibitor (SSRI) antidepressants are them from falling asleep. not as effective for treating chronic pain.1 9,23 Occasionally I will prescribe amitriptyline The SSRIs are very good medications for or nortriptyline to be taken prior to bed in treating depression with comparatively combination with desipramine to be taken in minimal side effects and have the potential to the morning and afternoon. The benefi cial increase parafunctional activity. 1,2 effects from taking TCAs typically occur within 3 days. 33 When prescribing a TCA, it is strongly recommended that the side effects TOPICAL MEDICATIONS be reviewed with the patient. These medica- tions are associated with many side effects There are several topical agents that may be (listed in most medication manuals) that
can benefi cial for the masticatory and cervical have a profound effect on patients. regions. As with ingested medications, they I prescribe TCAs for TMD, neck, and generally only provide temporary improve- headache pain and studies support their ment for the time they are used. Included effectiveness for these disorders.2 6,29,34 I among these topical agents are two topical generally do not prescribe these until I fi nd NSAIDs, the prescription diclofenac sodium that nonpharmaceutical interventions have not gel and a soon to be released over - the - counter provided satisfactory relief. ketoprofen in Transfersome gel. If topical medications are used in the masticatory TECHNICAL TIP region, patients need to be careful not to get For What to Prescribe T CA s them in their eyes. I prescribe TCAs for TMD, neck, and headache Over - the - counter counter - irritant creams pain and studies support their effectiveness for (e.g., Icy Hot ) generally contain irritating these disorders. agents that cause a counter- i rritant cascade. This cascade begins with dilatation of skin blood vessels, followed by an increase in blood TCAs can be used long term; they are fl ow (provides a warm soothing feeling), nonhabituating and very rarely cause organ which generally results in pain relief. The toxicity with long - term use.3 3 If a patient counter - irritant may also irritate sensory nerve needs to be on a TCA long term, the TCA endings, which thereby alters pain perception and preferred dose range are determined and in the underlying muscle or joints. 35 the patient referred to a physician for long- A randomized clinical trial was conducted term monitoring and management. among TMD patients with primary TMJ or masticatory muscle pain who applied a QUICK CONSULT counter - irritant cream twice a day. The Prescribing T CA s Long Term subjects reported that the cream signifi cantly TCAs can be used long term; they are non- reduced their TMJ and muscle pain, but was habituating and very rarely cause organ toxicity more effective for their masticatory muscles. with long- term use. If a patient needs to be on Once the therapy stopped, their pain slowly a TCA long term, the TCA and preferred dose returned. 36 range are determined and the patient referred Capsaicin (Zostrix) is a topical analgesic to a physician for long- term monitoring and cream whose mechanism of action is not management. clearly understood. It has been advocated for 260 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H arthritis and neuropathic pain in other parts headache.4 0 The lidocaine patch has not been of the body and some of my TMD patients evaluated for TMD pain, but I have heard fi nd it benefi cial over their TMJ and/or spinal colleagues relate it is benefi cial for patients column. One clinical trial reported that 3 days who have had multiple TMJ surgeries and after applying 0.075% capsaicin four times a who are unable to obtain satisfactorily relief day, subjects had a signifi cant decreased ability from traditional TMD therapies. to perceive pain, while normal tactile percep- Lidoderm comes in a box of 30 patches (you tions were not affected. Once the therapy had generally need to prescribe for an entire box), stopped, the ability to perceive pain slowly and the size of the patch is 10 cm by 14 cm. returned.3 7 Patients can use a pair of scissors to cut the Capsaicin comes in various strengths and patch to the appropriate size, prior to remov- should be applied 3– 4 times a day. I recom- ing the liner covering the adhesive. A patch can mend patients purchase the 0.1% capsaicin be worn up to 12 hours in a 24- hour period over - the - counter formula and regulate the (12 hours on and 12 hours off ). There is dosing by the amount of cream applied. Most minimal systemic absorption of lidocaine, but over - the - counter high - potency (generally local skin irritation can occur.1 9,41,42 abbreviated on the package as HP) formulas are 0.1% capsaicin. TECHNICAL TIP Capsaicin is the hot substance in chili Prescribing Lidoderm peppers, so patients should be warned to wash You may want to consider a lidocaine transder- their hands after applying the cream or they mal patch for patients who have had multiple may later rub their eyes and feel a burning TMJ surgeries and are unable to obtain satisfac- sensation in their eyes. Some of my patients torily relief from traditional TMD therapies. fi nd washing their hands after application does not completely remove the medication, so they prefer to use plastic wrap over their Diclofenac sodium gel (Voltaren Gel) is fi ngers while applying the capsaicin. the fi rst topical NSAID prescription on the A common side effect is a warm feeling U.S. market for treating osteoarthritis pain on the skin. I recommend patients not use and has been found benefi cial for the knees, capsaicin in conjunction with a heating pad or ankles, hands, and shoulders. Topical NSAID any of the other topical medications discussed. formulations provide similar symptom benefi t as the oral formulations. 43 – 46 Topical NSAIDs reduce the plasma drug levels to 5 – 15% of TECHNICAL TIP the oral formulations, 23 so adverse gastrointes- Recommending Capsaicin tinal and renal effects are minimized without I recommend patients purchase the 0.1% loss of effi cacy. 44 Local irritation is rare and capsaicin over- the -c ounter formula and regulate similar to that of the placebo. 45,46 the dosing by the amount of cream they apply. Voltaren Gel is prescribed as a 100 - gram Most over - the -c ounter high- potency (generally gel. For use over the TMJ, patients are abbreviated on the package as HP) formulas are instructed to measure ½ gram of gel with 0.1% capsaicin. the dosing card (comes with the medication) and apply this amount over the TMJ four Lidocaine transdermal patch 5% (Lido- times a day as needed. Patients should not derm) has been shown to be benefi cial for low wash the area for at least 1 hour after back pain, 38 knee osteoarthritis pain,3 9 and application. 47 C H A P T E R 1 7 P H A R M A C O L O G I C A L M A N A G E M E N T 261 TECHNICAL TIP Large multicenter randomized clinical trials Prescribing Voltaren Gel and comprehensive meta - analysis studies You may want to consider diclofenac sodium among patients with osteoarthritis in other gel for patients with TMJ infl ammation and a joints of the body have reported contradictory history of gastrointestinal symptoms from results from glucosamine and chondroitin ingesting an NSAID, for whom you would like a taken individually and together. Hence, no medication to decrease the TMJ infl ammation. consensus of opinion has developed on their effi cacy for reducing pain or slowing the progression of osteoarthritis.5 0 – 55 Ketoprofen in Transfersome gel should Their most appropriate doses have never be on the U.S. market soon and will be an been evaluated, but studies typically use over - the - counter topical NSAID; the ingested 500 mg glucosamine three times a day and/or formulation of ketoprofen (Orudis) is already 400 mg chondroitin three times a day. If a an over - the - counter NSAID. Ketoprofen in patient is interested in trying these agents, Transfersome gel provided similar symptom these doses are generally recommended. relief for knee osteoarthritis as oral celecoxib Glucosamine is inexpensive compared with (Celebrex), and its adverse gastrointestinal chondroitin and may provide adequate benefi ts symptoms were similar to the placebo. 48 by itself. Therefore, patients are asked to start with glucosamine alone and, if it does not provide adequate relief, then add chondroitin. TECHNICAL TIP Symptom relief from these supplements is Recommending Ketoprofen in slower than with NSAIDs, and it is recom- Transfersome Gel mended patients use them for 30 days before Y deciding whether they are benefi cial.4 9 ou may want to consider ketoprofen in Transfersome gel, when it becomes available, for These agents are available as nutritional patients with TMJ infl ammation and a history of supplements, they are not FDA evaluated or gastrointestinal symptoms when taking an recommended, and the number of toxicity NSAID medication. studies (particularly long term) is limited. Studies in the United States have revealed that a number of preparations have less agent in NUTRITIONAL SUPPLEMENTS each tablet than the container’ s label states. 56 An independent laboratory evaluates the Glucosamine is one of the most popular contents of over - the - counter supplements and dietary supplements sold in the United States, reveals on their web site ( www.consumerlab. has not had any reported signifi cant supple- com ) which brands contain the amount ment - drug interactions, and has been shown claimed on the label. to be benefi cial for TMJ osteoarthritis.4 9 A Another nutritional supplement that may randomized clinical trial among symptomatic benefi t patients with TMD symptoms, TMJ osteoarthritis patients found that those although its effi cacy has not been substanti- who took 500 m g glucosamine three times a ated by clinical trials among TMD patients, is day had greater improvement than subjects magnesium . Clinically it appears to act as a who took 400 m g ibuprofen three times a day. mild muscle relaxant, has been demonstrated Seventy - one percent of these subjects had at to be benefi cial in treating headaches and least a 20% decrease in TMJ pain during myofascial pain, and is often recommended to function. 9 be taken in combination with calcium. 57 – 59 If 262 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H a TMD patient would like to try magnesium, 7. Winocur E , Gavish A , Halachmi M , Eli I , Gazit E . 250 mg twice a day, taken in combination Topical application of capsaicin for the treatment of with calcium, is recommended; some brands localized pain in the temporomandibular joint area. have the two combined into one tablet. J Orofac Pain 2000 ; 14 ( 1 ): 31 – 36 . Surveys estimate that 8% of TMD patients 8. Milam SB . TMJ Osteoarthritis . In: Laskin DM , Greene CS , Hylander WL . Temporomandibular use an over - the - counter herbal supplement for Disorders: An Evidence - Based Approach to their TMD pain, and nearly 70% of patients Diagnosis and Treatment . Hanover Park, IL : given a prescription do not discuss their Quintessence , 2006 : 105 – 124 . supplement use with their health care pro- 9. Thie NM , Prasad NG , Major PW . Evaluation of viders.6 0,61 There are a number of potential glucosamine sulfate compared to ibuprofen for the herbal supplements patients can use for TMD treatment of temporomandibular joint osteoarthri- symptoms, and some target the same bio- tis: A randomized double blind controlled 3 mechanism that TMD prescription medica- month clinical trial . J Rheumatol 2001 ; 28 ( 6 ): tions target. 62 Hence, it is recommended 1347 – 1355 . providers inquire about herbal supplements 10. Raffa R . Pharmacological aspects of successful prior to prescribing patients medications. long - term analgesia . Clin Rheumatol 2006 ; 25 Suppl 1 : S9 – 15 . 11. Sharav Y , Benoliel R . Pharmacotherapy of acute REFERENCES orofacial pain . In: Sharav Y , Benoliel R . Orofacial Pain and Headache . St. Louis : CV Mosby , 1. Fricton J . Myogenous temporomandibular 2008 : 349 – 376 . disorders: Diagnostic and management consider- 12. Syrop SB . Initial management of temporomandibu- ations . Dent Clin North Am 2007 Jan; 51 ( 1 ): 61 – 83 . lar disorders . Dent Today 2002 ; 21 ( 8 ): 52 – 57 . 2. Winocur E ,
Gavish A , Voikovitch M , Emodi - 13. Dionne RA . Pharmacologic approaches . In: Laskin Perlman A , Eli I . Drugs and bruxism: A critical DM , Greene CS , Hylander WL . Temporomandibu- review . J Orofac Pain 2003 ; 17 ( 2 ): 99 – 111 . lar Disorders: An Evidence - Based Approach to 3. Perneger TV , Whelton PK , Klag MJ . Risk of Diagnosis and Treatment . Hanover Park, IL : kidney failure associated with the use of acetamino- Quintessence , 2006 : 347 – 357 . phen, aspirin, and nonsteroidal antiinfl ammatory 14. Antman EM , Bennett JS , Daugherty A , Furberg C , drugs . N Engl J Med 1994 ; 331 ( 25 ): 1675 – 1679 . Roberts H , Taubert KA ; American Heart Associa- 4. Ta LE , Dionne RA . Treatment of painful temporo- tion . Use of nonsteroidal antiinfl ammatory drugs: mandibular joints with a cyclooxygenase- 2 inhibitor: An update for clinicians: A scientifi c statement from A randomized placebo - controlled comparison of the American Heart Association. C irculation celecoxib to naproxen . Pain 2004 ; 111 ( 1 – 2 ): 13 – 21 . 2007 ; 115 ( 12 ): 1634 – 1642 . 5. Herndon CM , Hutchison RW , Berdine HJ , Stacy 15. House AA , Silva Oliveira S , Ronco C . Anti - ZA , Chen JT , Farnsworth DD , Dang D , Fermo infl ammatory drugs and the kidney . Int J Artif JD ; Ambulatory Care, Cardiology, and Pain and Organs 2007 ; 30 ( 12 ): 1042 – 1046 . Palliative Care Practice and Research Networks of 16. Takemoto JK , Reynolds JK , Remsberg CM , the American College of Clinical Pharmacy. Vega - Villa KR , Davies NM . Clinical pharmacoki- Management of chronic nonmalignant pain with netic and pharmacodynamic profi le of etoricoxib . nonsteroidal antiinfl ammatory drugs. Joint opinion Clin Pharmacokinet 2008 ; 47 ( 11 ): 703 – 720 . statement of the Ambulatory Care, Cardiology, and 17. Simons DG , Travell JG , Simons LS . Travell & Pain and Palliative Care Practice and Research Simons ’ Myofascial Pain and Dysfunction: The Networks of the American College of Clinical Trigger Point Manual , vol. 1 , 2nd ed. Baltimore : Pharmacy . Pharmacotherapy 2008 ; 28 ( 6 ): 788 – 805 . Williams & Wilkins , 1999 : 147 . 6. Altman RD . A rationale for combining acetamino- 18. Shin S - M , Choi J - K . Effect of indomethacin phen and NSAIDs for mild - to - moderate pain . Clin phonophoresis on the relief of temporomandibular Exp Rheumatol 2004 ; 22 ( 1 ): 110 – 117 . joint pain . Cranio 1997 ; 15 ( 4 ): 345 – 358 . C H A P T E R 1 7 P H A R M A C O L O G I C A L M A N A G E M E N T 263 19. Hersh EV , Balasubramaniam R , Pinto A . Pharma- administration of amitriptyline on sleep bruxism: A cologic management of temporomandibular double - blind crossover clinical study . Cranio disorders . Oral Maxillofac Surg Clin North Am 2001 ; 19 ( 1 ): 21 – 25 . 2008 May; 20 ( 2 ): 197 – 210 , vi. 32. Kafas P , Leeson R . Assessment of pain in temporo- 20. Dolwick MF . Temporomandibular joint surgery for mandibular disorders: The bio - psychosocial internal derangement . Dent Clin North Am 2007 complexity . Int J Oral Maxillofac Surg Jan; 51 ( 1 ): 195 – 208 . 2006 ; 35 ( 2 ): 145 – 149 . 21. American Academy of Orofacial Pain . de Leeuw R 33. Pettengill CA , Reisner - Keller L . The use of tricyclic (ed). O rofacial Pain: Guidelines for Assessment, antidepressants for the control of chronic orofacial Diagnosis and Management , 4th ed. Chicago : pain . Cranio 1997 ; 15 ( 1 ): 53 – 56 . Quintessence , 2008 : 162 – 164 . 34. Lin J , Zhang W , Jones A , Doherty M . Effi cacy of 22. Rizzati - Barbosa CM , Martinelli DA , Ambrosano topical non - steroidal anti - infl ammatory drugs in the GMB , et al. Therapeutic response of benzodiaz- treatment of osteoarthritis: Meta - analysis of epine, orphenadrine citrate and occlusal splint randomised controlled trials . BMJ 2004 ; association in TMD pain . Cranio 329 ( 7461 ): 324 . 2003 ; 21 ( 2 ): 116 – 120 . 35. Bandolier . Bandolier web site. “ http://www. 23. Benoliel R , Sharav Y . Pharmacotherapy of chronic medicine.ox.ac.uk/bandolier/booth/painpag/topical/ orofacial pain . In: Sharav Y , Benoliel R . Orofacial Topintro.html . ” Accessed October 26, 2008 . Pain and Headache . St. Louis : CV Mosby , 36. Lobo SL , Mehta N , Forgione AG , Melis M , 2008 : 377 – 405 . Al - Badawi E , Ceneviz C , Zawawi KH . Use of 24. Onghena P , Van Houdenhove B . Antidepressant - Therafl ex - TMJ topical cream for the treatment of induced analgesia in chronic non - malignant pain: A temporomandibular joint and muscle pain . Cranio meta - analysis of 39 placebo - controlled studies . Pain 2004 ; 22 ( 2 ): 137 – 144 . 1992 ; 49 ( 2 ): 205 – 219 . 37. Lee YS , Kho HS , Kim YK , Chung SC . Infl uence 25. Brown RS , Bottomley WK . The utilization and of topical capsaicin on facial sensitivity in response mechanism of action of tricyclic antidepressants in to experimental pain . J Oral Rehabil 2007 ; 34 ( 1 ): the treatment of chronic facial pain: A review of the 9 – 14 . literature . Anesth Prog 1990 ; 37 ( 5 ): 223 – 229 . 38. Galer BS , Gammaitoni AR , Oleka N , Jensen MP , 26. Plesh O , Curtis D , Levine J , McCall WD Jr . Argoff CE . Use of the lidocaine patch 5% in Amitriptyline treatment of chronic pain in patients reducing intensity of various pain qualities reported with temporomandibular disorders. J Oral Rehabil by patients with low - back pain . Curr Med Res 2000 ; 27 ( 10 ): 834 – 841 . Opin 2004 ; 20 (Suppl 2 ): S5 – 12 . 27. Sharav Y , Singer E , Schmidt E , Dionne RA , 39. Galer BS , Sheldon E , Patel N , Codding C , Burch Dubner R . The analgesic effect of amitriptyline on F , Gammaitoni AR . Topical lidocaine patch 5% chronic facial pain . Pain 1987 ; 31 ( 2 ): 199 – 209 . may target a novel underlying pain mechanism in 28. Kreisberg MK . Tricyclic antidepressants: Analgesic osteoarthritis . Curr Med Res Opin 2004 effect and indications in orofacial pain. J Cranio- Sep; 20 ( 9 ): 1455 – 1458 . mandib Disord 1988 ; 2 ( 4 ): 171 – 177 . 40. Dreschnack PA . Transdermal Lidoderm for Acute 29. Rizzatti - Barbosa CM , Nogueira MTP , de Andrade Headache? Headache 2006 ; 46 ( 4 ): 692 – 693 . ED , Ambrosano GMB , de Albergaria Barbosa JR . 41. U.S. Food and Drug Administration . U.S. Food Clinical evaluation of amitriptyline for the control and Drug Administration website. “ http://www.fda. of chronic pain caused by temporomandibular joint gov/medwaTCH/SAFETY/2005/MAY_PI/ disorders . Cranio 2003 ; 21 ( 3 ): 221 – 225 . Lidoderm_PI.pdf . ” Accessed October 26, 2008 . 30. Mohamed SE , Christensen LV , Penchas J . A 42. Lewis MA , Sankar V , De Laat A , Benoliel R . randomized double - blind clinical trial of the effect of Management of neuropathic orofacial pain . Oral amitriptyline on nocturnal masseteric motor activity Surg Oral Med Oral Pathol Oral Radiol Endod (sleep bruxism) . Cranio 1997 ; 15 ( 4 ): 326 – 332 . 2007 ; 103 Suppl: S32.e1 – 24 . 31. Raigrodski AJ , Christensen LV , Mohamed SE , 43. Banning M . Topical diclofenac: Clinical effective- Gardiner DM . The effect of four - week ness and current uses in osteoarthritis of the knee 264 P A R T I V M U L T I D I S C I P L I N A R Y T R E A T M E N T A P P R O A C H and soft tissue injuries. E xpert Opin Pharmacother Weisman MH , Jackson CG , Lane NE , Cush JJ , 2008 ; 9 ( 16 ): 2921 – 2929 . Moreland LW , Schumacher HR Jr , Oddis CV , 44. Zacher J , Altman R , Bellamy N , Br ü hlmann P , da Wolfe F , Molitor JA , Yocum DE , Schnitzer TJ , Silva J , Huskisson E , Taylor RS . Topical diclofenac Furst DE , Sawitzke AD , Shi H , Brandt KD , and its role in pain and infl ammation: An evidence - Moskowitz RW , Williams HJ . Glucosamine, based review . Curr Med Res Opin 2008 ; 24 ( 4 ): chondroitin sulfate, and the two in combination 925 – 950 . for painful knee osteoarthritis . N Engl J Med 45. Mason L , Moore RA , Edwards JE , Derry S , 2006 ; 354 ( 8 ): 795 – 808 . McQuay HJ . Topical NSAIDs for acute pain: A 54. Sawitzke AD , Shi H , Finco MF , Dunlop DD , meta - analysis . BMC Fam Pract 2004 ; 5 : 10 . Bingham CO 3rd , Harris CL , Singer NG , Bradley 46. Mason L , Moore RA , Edwards JE , Derry S , JD , Silver D , Jackson CG , Lane NE , Oddis CV , McQuay HJ . Topical NSAIDs for chronic Wolfe F , Lisse J , Furst DE , Reda DJ , Moskowitz musculoskeletal pain: Systematic review and RW , Williams HJ , Clegg DO . The effect of meta - analysis . BMC Musculoskelet Disord glucosamine and/or chondroitin sulfate on the 2004 ; 5 : 28 . progression of knee osteoarthritis: A report from the 47. Monthly Prescribing Reference (MPR) . Monthly glucosamine/chondroitin arthritis intervention trial . Prescribing Reference (MPR) web site. “ http:// Arthritis Rheum 2008 ; 58 ( 10 ): 3183 – 3191 . formulary.prescribingreference.com/musculoskeletal_ 55. Ernst E . Complementary treatments in rheumatic disorders/arthritis_rheumatic_disorders/voltaren_ diseases . Rheum Dis Clin North Am gel . ” Accessed October 26, 2008 . 2008 ; 34 ( 2 ): 455 – 467 . 48. Rother M , Lavins BJ , Kneer W , Lehnhardt K , 56. Deal CL , Moskowitz RW . Nutraceuticals as Seidel EJ , Mazgareanu S . Effi cacy and safety of therapeutic agents in osteoarthritis: The role of epicutaneous ketoprofen in Transfersome(R) glucosamine, chondroitin sulfate, and collagen (IDEA - 033) versus oral celecoxib and placebo in hydrolysate . Rheum Dis Clin North Am osteoarthritis of the knee: Multicentre randomised 1999 ; 25 ( 2 ): 379 – 395 . controlled trial. A nn Rheum Dis 57. Gremillion HA . Multidisciplinary diagnosis and 2007 ; 66 ( 9 ); 1178 – 1183 . management of orofacial pain. G en Dent 49. Dahmer S , Schiller RM . Glucosamine . Am Fam 2002 ; 50 ( 2 ): 178 – 186 . Physician 2008 ; 78 ( 4 ): 471 – 476 . 58. Altura BM , Altura BT . Tension headaches and 50. Poolsup N , Suthisisang C , Channark P , muscle tension: Is there a role for magnesium? M ed Kittikulsuth W . Glucosamine long - term treatment Hypotheses 2001 ; 57 ( 6 ): 705 – 713 . and the progression of knee osteoarthritis: 59. Mauskop A , Altura BM . Role of magnesium in the Systematic review of randomized controlled