#genome
stringclasses 121
values | asm_name
stringclasses 120
values | assembly_accession
stringclasses 120
values | bioproject
stringclasses 45
values | biosample
stringclasses 120
values | wgs_master
float64 | seq_rel_date
stringclasses 98
values | submitter
stringclasses 76
values | ftp_path
stringclasses 120
values | img_id
float64 637M
2.51B
⌀ | gtdb_id
stringclasses 120
values | scope
stringclasses 3
values | assembly_level
stringclasses 1
value | genome_rep
stringclasses 1
value | refseq_category
stringclasses 3
values | release_type
stringclasses 2
values | taxid
float64 1.15k
681k
⌀ | species_taxid
float64 7
911k
⌀ | organism_name
stringclasses 120
values | infraspecific_name
stringclasses 112
values | isolate
stringclasses 1
value | superkingdom
stringclasses 2
values | phylum
stringclasses 18
values | class
stringclasses 30
values | order
stringclasses 56
values | family
stringclasses 75
values | genus
stringclasses 89
values | species
stringclasses 117
values | classified
bool 1
class | unique_name
stringclasses 121
values | lv1_group
stringclasses 2
values | lv2_group
stringclasses 13
values | score_faa
float64 0.93
1
⌀ | score_fna
float64 0.88
1
⌀ | score_rrna
float64 0.1
1
⌀ | score_trna
float64 0.6
1
⌀ | total_length
float64 618k
9.12M
⌀ | contigs
float64 1
22
⌀ | gc
float64 22.5
72.2
⌀ | n50
float64 616k
9.03M
⌀ | l50
float64 1
1
⌀ | proteins
float64 525
7.92k
⌀ | protein_length
float64 172k
2.68M
⌀ | coding_density
float64 74
96.9
⌀ | completeness
float64 76.3
100
⌀ | contamination
float64 0
4.4
⌀ | strain_heterogeneity
float64 0
100
⌀ | markers
float64 124
383
⌀ | 5s_rrna
stringclasses 2
values | 16s_rrna
stringclasses 1
value | 23s_rrna
stringclasses 1
value | trnas
float64 14
20
⌀ | draft_quality
stringclasses 2
values | start_position
int64 0
10M
| autotrain_text
stringlengths 150
150
| autotrain_label
class label 2
classes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Pseudomonas putida KT2440 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 6,060,080 | TGATGAAGCTGTGGGACATGCCAGAAGAGCTGTCGACTGCCTTGCGCTTCCAGCACGATCCGGCCTACGACGGCGAATATTTCGCGTTCCCCAACTTGGTGTGCCTGGCCACCCGCCTGCTGCGCTCGCGAGGTATAGGCTCAGGGCCGC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,486,250 | GTGAGTTATTGCAGTGCCCTGGTAGCGGGCCCCGGTGTGCTCATCTGAAAATGAGGCCCTGCCAGGATCTTCCCCCAATGCCGCCCGGTGGAATGAAGATGCGGCCCCCCACCCTGAGTGCTGGTGAGAGACACAGCCAGCTGCCGCCTT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,034,850 | AAATCTGAAACCCATTTGTTGCAAGAACTTTAAACTTCTTTGTGAATCTTTTGACCATACCTAAACTCACCTGCCTTTGAATCATGCATTCCTGGAAGCCCACAAAAAGGGTTTCCTATTCTGGACCATTAGTATTCAGCCAGGTCTCTC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,301,100 | ACTTTGGGAGGCCGAAATGGGCAGATCACGAGGTCAGGAGATCGAGACCATCTTGGCTAACACGGTGAAACCCCGTTTCTACTAAAAATACAAAAAATTAGCTGGGTGTGTTGGCAGGCGCCTGTAGTCCCAGGTACTCAGGAGGCTGAG | 11
|
G000009985 | ASM998v1 | GCF_000009985.1 | PRJNA224116 | SAMD00061077 | null | 2005/12/01 | Tokyo University of Agriculture and Technology, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/985/GCF_000009985.1_ASM998v1 | 637,000,155 | RS_GCF_000009985.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 342,108 | 84,159 | Magnetospirillum magneticum AMB-1 | strain=AMB-1 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhodospirillales | Rhodospirillaceae | Magnetospirillum | Magnetospirillum magneticum | true | Magnetospirillum magneticum AMB-1 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,967,148 | 1 | 65.09 | 4,967,148 | 1 | 4,628 | 1,522,305 | 90.298759 | 99 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 2,289,170 | TGAGCCCAATCTCACCGAACTGGGCATCTTCTCGGTGATGTGGTCCGAGCACTGCTCGTACAAGTCGTCGAAGAAGTGGCTTAAGACCCTGCCGACCAAGGCGCCGTGGGTGATCTGCGGCCCGGGCGAGAATGCCGGCATCATCGATAT | 0no label
|
G000007845 | ASM784v1 | GCF_000007845.1 | PRJNA57909 | SAMN02603432 | null | 2003/04/30 | J. Craig Venter Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/845/GCF_000007845.1_ASM784v1 | 637,000,014 | RS_GCF_000007845.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 198,094 | 1,392 | Bacillus anthracis str. Ames | strain=Ames | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus anthracis | true | Bacillus anthracis str. Ames | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 5,227,293 | 1 | 35.38 | 5,227,293 | 1 | 5,474 | 1,495,110 | 84.244541 | 99.23 | 0.15 | 0 | 381 | yes | yes | yes | 20 | high | 2,621,970 | TTTTTCCGCTTAAGTCAGCACCAGCTTTTAACATTTCTAAGCCGTATTTGTCAGCATCTACACCAGCGATTTCCGCTAATTCACGAGCTGCTGCTACGTCTTGCTCTGTGCAAGTTGGAGATTTGAATAGTAAAGAATCTGAAATGATTG | 0no label
|
G000006965 | ASM696v1 | GCF_000006965.1 | PRJNA57603 | SAMEA3283068 | null | 2003/05/06 | MELILO | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/965/GCF_000006965.1_ASM696v1 | 637,000,269 | RS_GCF_000006965.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 266,834 | 382 | Sinorhizobium meliloti 1021 | strain=1021 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Rhizobiaceae | Sinorhizobium | Sinorhizobium meliloti | true | Sinorhizobium meliloti 1021 | Eubacteria | Proteobacteria | 1 | 0.997 | 0.1 | 1 | 6,691,694 | 3 | 62.17 | 3,654,135 | 1 | 6,303 | 1,956,944 | 86.157242 | 99.28 | 0.31 | 0 | 373 | yes | yes | yes | 20 | high | 1,361,360 | GCGGCTACGTGAAGTATCGCAAAGGGCTGCTTGACGGCGGTGTCGAGCTCTACGAGCTCAAGGAGCGCGGTGATTTCTTCGATCGTCACCGTATGTCGCTGTTCGGAGCGCGAAACGCGAGCCTCCACACCAAGGCCTTCGTCGTCGATG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,551,100 | ATCTCAAAAAAAAAAAAAAAGCAGTAAGTAGGCTGTTGATTTTGCAAGGGTAACTTGGCATTCTACTTCGTAACACTTGAGGATCCTGCCAGGACAAGCTAACATTTTCTCCTCTCTTCATGCAGAGTTTGGTTATCTGGGACAATGACA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,505,500 | AACCATGGGGACGGGTCTTTCCCATGCTGTTCTCGTGATAGTGAATAAGTCTCACAAAATCTGATGGTTTTATAAAGGGCAGTTCCCCTGCACATGATTTCTTGCCTGCTGCCATGTAAGACATGCCTTCTCTTCTCCTTTGCCTTTCAC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,514,700 | CAAAGGCATATCGCACTTTTTCTCTGGGGTTATTCGTCCCGGCTGAGAAGCACCGCGGTATCATGTGGTGATTGAGCAGCACCCAGCACATTCATGGCTGCGAGGCTTCCCGCGTGTGAACTCATTTAATCTTCTCAGTTCCTTGTGGGC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,652,050 | TACCTCTCTTTCTGGACTTCTAACACCCCAGCCTTGCCTCAGATCTAAATTCTCTCCCTACTAGGAGGAATAAAATGTACCAAGTGTATAAAAATAGCTGCAAATACTCATGGAGCATTGTGCGCCAGATGTGGTGTCAGCTCTGTCCAT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,016,500 | CTTGAAGACGGGAGCTCGCCCATCCCGGAAGGGGGCTAGGGGGGACCAGGGCCCGCGACAGGAAGCCTCCGCGCGACAGAAAAGCCCCGGGGGACCAGGCAGAGAGACCCGCAGGCCTAGCCCGCCCCGGAATCGCCCTGAGCCAGGTTC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,216,900 | CGCGACAGACCAGGAAGGAGGCTGCAGTGGTGCCGGAGAGGTGGGCAGGGCCCGTGCTGCAGGGGGTCCCCGTTCCACTGGTGGGTGGGCTCCCCAGGTTGACAGCTCACAGCCAGCTTAATGGTGCCAGATGATGGCAGCTTCAGCCGA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 757,650 | GTGAATGCCAGCAGAATCCAAAGCAGGGCCTGGGCCACTCGTGGAAGGCTCCCTAGGGCTAGTACAAGAGCCTCGTGGCAATCTTCTGAGTGGTAAAACCCATCTGTGTGGGACATGGAGTTTCAGCAACAGGAGTGAAAACACGTGTCC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,741,650 | CTCAGTTTTGGTGGAGGTCATGGATTTAACCCTTAGAGAAACCGTGGGGCAAGACTCAAGCTCATGAAGCCATGAGACGGCGAACCCCACATGTGAAGGCACCAGCTGGTAGTGAATATTCCCTGGGGAGGCGACCTTGGTGTTAATTCA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,773,250 | CAAATAAAATGAGTTTTAAATATTGTGGTATAGGAAAAACAGGGTGGGAAGGTCAGGGACAGGGGTTCTTTTAAAAGGGCAAAAAGAAACCAGGCTTGGAAAGAGTTGGGAGCTGGCTAATACAATTAATTGAATTATTGAACTAGTGAT | 11
|
G000006965 | ASM696v1 | GCF_000006965.1 | PRJNA57603 | SAMEA3283068 | null | 2003/05/06 | MELILO | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/965/GCF_000006965.1_ASM696v1 | 637,000,269 | RS_GCF_000006965.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 266,834 | 382 | Sinorhizobium meliloti 1021 | strain=1021 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Rhizobiaceae | Sinorhizobium | Sinorhizobium meliloti | true | Sinorhizobium meliloti 1021 | Eubacteria | Proteobacteria | 1 | 0.997 | 0.1 | 1 | 6,691,694 | 3 | 62.17 | 3,654,135 | 1 | 6,303 | 1,956,944 | 86.157242 | 99.28 | 0.31 | 0 | 373 | yes | yes | yes | 20 | high | 2,984,280 | CATGAGGCGGCTGTAGCCCACGACATCGGCTGCGAGAATGGCGGTGAGACGACGTTCCAACAGAGCCTCGATCTTCATCTTGTGGCCGAGCACGGTAATTTAACCTTTTCCTGTCGTCATGTCGTGCGGAGATAGAGCGACTTGGTGACG | 0no label
|
G000008185 | ASM818v1 | GCF_000008185.1 | PRJNA57583 | SAMN02603967 | null | 2004/02/03 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/185/GCF_000008185.1_ASM818v1 | 637,000,327 | RS_GCF_000008185.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,275 | 158 | Treponema denticola ATCC 35405 | strain=ATCC 35405 | null | Bacteria | Spirochaetes | Spirochaetia | Spirochaetales | Spirochaetaceae | Treponema | Treponema denticola | true | Treponema denticola ATCC 35405 | Eubacteria | Spirochaetes | 1 | 1 | 1 | 1 | 2,843,201 | 1 | 37.87 | 2,843,201 | 1 | 2,578 | 885,778 | 91.799314 | 100 | 0 | 0 | 281 | yes | yes | yes | 20 | high | 1,316,250 | AAATTTTTCGGTCTCTTTTAGCGCCTCATTAAAATCTTTTATGTTTTCGATAAAAAAGCAGTGCAGATTGTTTTCTTCAAAATACTTGTGCGGCACGTCCTTCATAAAGTCCGAAACTTGTTCCGGCTCGGTCTTAAAAAACTCTTTTGC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,817,550 | GCCGGCCAGACTCCCCACAGGCCATGCGTGCTCAAACACCCCAAATTATCTACATGATTCTCAGTGTTACATGCACCCCAGGAGTCCCCCACTGGCCCAGGCTTCCTGGACTGTGACCCCTGGGTCCAAGGGCAGTAGGCCCAAACGTGG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,542,650 | CCAGGCCTTGCTTTCCCCGCAGGCCCTGGCCTCCTGCTCATTCCCTGAATCCCCCAGCTCTTTCCCACATGGAGCTCTCTGCACTCTCTGGTGGTTAAGGACAAGTCATTGCAGAGAGGGCAGCTTGGAAAAGAAGGAAAAGAGCAAAGA | 11
|
G000009125 | ASM912v1 | GCF_000009125.1 | PRJNA224116 | SAMEA3138192 | null | 2003/05/06 | Genoscope | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/125/GCF_000009125.1_ASM912v1 | 637,000,231 | RS_GCF_000009125.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 267,608 | 305 | Ralstonia solanacearum GMI1000 | strain=GMI1000 | null | Bacteria | Proteobacteria | Betaproteobacteria | Burkholderiales | Burkholderiaceae | Ralstonia | Ralstonia solanacearum | true | Ralstonia solanacearum GMI1000 | Eubacteria | Proteobacteria | 1 | 0.998 | 0.9 | 1 | 5,810,922 | 2 | 66.98 | 3,716,413 | 1 | 5,062 | 1,725,241 | 87.482692 | 99.94 | 0 | 0 | 373 | yes | yes | yes | 20 | high | 3,798,470 | GGCATCCCGACCGACACGCCGGTGCACCGTGCCCGCGAGCGCCATGCCGACGCCACCGTCTTCACGCTGGCCACGGTGCGCTCGCACGACCAGTACAACACGACCATCTACGGCATGGATGACCGCTACCGCGGCGTGTTCGGCCAGCGC | 0no label
|
G000007145 | ASM714v1 | GCF_000007145.1 | PRJNA57887 | SAMN02603845 | null | 2002/05/24 | Sao Paulo state (Brazil) Consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/145/GCF_000007145.1_ASM714v1 | 637,000,344 | RS_GCF_000007145.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 190,485 | 339 | Xanthomonas campestris pv. campestris str. ATCC 33913 | strain=ATCC 33913 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xanthomonas | Xanthomonas campestris | true | Xanthomonas campestris pv. campestris str. ATCC 33913 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 5,076,188 | 1 | 65.07 | 5,076,188 | 1 | 4,292 | 1,472,146 | 85.453159 | 99.64 | 0 | 0 | 358 | yes | yes | yes | 20 | high | 2,482,220 | TTGTCGATAGCACAAGAGATAGATGATGATGGGCACAAGAGTAAAATGGTCGCCGATTTTATCGAGCGCCAACTATCATGGCTTGGCCCACAAACCGCACTTGACAGCAAGTCAACGCTTGAAAGGGTTTCAGCGGTGACCATACAAGAA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,250,600 | CACCCCCAGGTGAGCATCTGACAGACTGGAACAGCACCCACATGCCCAGCTGAGCCTGTGACAGCCTCGAACAGCACCCTGCACCCCCAGGGGAGCATCTGACAGCCTGGAACAGCACGCACACACCCAGGTGAGCATCTGACCGCCTCG | 11
|
G000008865 | ASM886v1 | GCF_000008865.1 | PRJNA57781 | SAMN01911278 | null | 2004/05/11 | GIRC | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/865/GCF_000008865.1_ASM886v1 | 637,000,108 | RS_GCF_000008865.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 386,585 | 562 | Escherichia coli O157:H7 str. Sakai | strain=Sakai substr. RIMD 0509952 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Enterobacteriaceae | Escherichia | Escherichia coli | true | Escherichia coli O157:H7 str. Sakai Sakai substr. RIMD 0509952 | Eubacteria | Proteobacteria | 1 | 0.996 | 0.9 | 1 | 5,594,477 | 3 | 50.48 | 5,498,450 | 1 | 5,399 | 1,663,868 | 87.620737 | 99.97 | 0.33 | 0 | 374 | yes | yes | yes | 20 | high | 2,845,440 | AAGCTTTCAAAGCTTCCACGGTGAGCGATTAATGGCTCCAGGCTTAACTTACGTTCTGTCAGCAACCGGCTCGCCGTTTCCCACTCCTGCCCCGGCCAAGGGCTGGAGTAGTTCATCCAACTGCCGATAACCGTCAGCTCTTTACGCAAT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 136,650 | ATATATAAATATATATGTACATATTTTTAATATAAAATACTAAACAAAGTACACCAAAATATTAGCTCCTATGTTAGTGAGATAATGTTTTGTTTTTTTGTATTTTAAGTTTTACATAGTAGGTGTATTTTTCTGTTTTCATACTGCTAT | 11
|
G000010145 | ASM1014v1 | GCF_000010145.1 | PRJNA224116 | SAMD00060917 | null | 2008/04/15 | Kitasato Institute for Life Sciences | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/145/GCF_000010145.1_ASM1014v1 | 641,522,633 | RS_GCF_000010145.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 334,390 | 1,613 | Lactobacillus fermentum IFO 3956 | strain=IFO 3956 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Lactobacillaceae | Lactobacillus | Lactobacillus fermentum | true | Lactobacillus fermentum IFO 3956 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 2,098,685 | 1 | 51.47 | 2,098,685 | 1 | 2,094 | 609,422 | 85.544424 | 99.18 | 0.82 | 50 | 290 | yes | yes | yes | 20 | high | 926,250 | TAAGAATTCGGCCAGCAATATTTAAAATGAGGAGCGATTTTTTTGGATAAGCGGATTTACATTGATAACGCCGGCACCACCAAGACGGCCCCGGAGGTCATTGAAACGATGACCGAAGCGCTGGAGACGACTTGGGGGAACGCCTCGACG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,803,000 | GGGTGACAGTGAGACCTTGTCTCAAAAAAGAAAAAATCAGTTAGAAAAACAAACAAACAAACAAACAAACAAACAAAAAATATATATATATATAAAAAAAATCAGAGATGATAAAATGGAATCATAAAAAATGCCCAATTCAAAAAAGAT | 11
|
G000008645 | ASM864v1 | GCF_000008645.1 | PRJNA224116 | SAMN02603244 | null | 1999/12/22 | Genome Therapeutics Corporation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/645/GCF_000008645.1_ASM864v1 | 638,154,510 | RS_GCF_000008645.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 187,420 | 145,262 | Methanothermobacter thermautotrophicus str. Delta H | strain=Delta H | null | Archaea | Euryarchaeota | Methanobacteria | Methanobacteriales | Methanobacteriaceae | Methanothermobacter | Methanothermobacter thermautotrophicus | true | Methanothermobacter thermautotrophicus str. Delta H | Archaea | Euryarchaeota | 0.99 | 1 | 0.9 | 1 | 1,751,377 | 1 | 49.54 | 1,751,377 | 1 | 1,876 | 533,233 | 89.684117 | 100 | 0.31 | 16.67 | 182 | no | yes | yes | 19 | medium | 1,211,860 | ATTCCTCAGGGGCGGAGCAGGAAAATAAACCCCAAAATTTTTTCTTTTTGATGCTGTACAGGAGCAGAGAATGTGAAATAACTGAGGGTAGAAATTAAGAGTCTTCGAAGCTTATCTGGAGTATCTCAATAAGTTCTATGGATATACAGA | 0no label
|
G000007465 | ASM746v2 | GCF_000007465.2 | PRJNA57947 | SAMN02604090 | null | 2011/09/01 | Univ. Oklahoma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/465/GCF_000007465.2_ASM746v2 | 637,000,288 | RS_GCF_000007465.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 210,007 | 1,309 | Streptococcus mutans UA159 | strain=UA159 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Streptococcus | Streptococcus mutans | true | Streptococcus mutans UA159 | Eubacteria | Firmicutes | 1 | 1 | 0.9 | 1 | 2,032,925 | 1 | 36.83 | 2,032,925 | 1 | 1,897 | 591,301 | 85.692487 | 100 | 0 | 0 | 308 | yes | yes | yes | 20 | high | 798,460 | ACATTATTGATTTCTATTGGAAGAATGCAGTTCCGTCTGATTGGACCTACATGTTTGATCAGCCTTTTGAAACTGCTGAAGCTGTTCAAGAACGTCTCCAAGATTATGAAAAATCCGAAAACCCTTATTTTTTTGCCATTCGTGACAAAG | 0no label
|
G000010165 | ASM1016v1 | GCF_000010165.1 | PRJNA224116 | SAMD00060942 | null | 2009/04/01 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/165/GCF_000010165.1_ASM1016v1 | 643,692,011 | RS_GCF_000010165.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 358,681 | 1,393 | Brevibacillus brevis NBRC 100599 | strain=NBRC 100599 (= 47) | null | Bacteria | Firmicutes | Bacilli | Bacillales | Paenibacillaceae | Brevibacillus | Brevibacillus brevis | true | Brevibacillus brevis NBRC 100599 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 6,296,436 | 1 | 47.27 | 6,296,436 | 1 | 5,917 | 1,875,522 | 87.757979 | 99.73 | 0.27 | 0 | 381 | yes | yes | yes | 20 | high | 5,385,380 | GTACAGCTTTTCCAGTGTTCTGATCGCCGCTTGGCTTAGCTCGCTTTCTGTTATTTCTGTCGAGGAGAAGGAGCGGGGAACCAAATGCGCTTGTGATTCAACCCGAGATTGCGTGAACATCTCCGGGGTTACACCCATCATCCATACTGC | 0no label
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Pseudomonas putida KT2440 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 4,193,410 | GGCCCACCCCCACATTGTGGAGAGGTTGGAGGCGCGGCTGGCGGGTCGGGAATCCATGTCCATGCGCAGCATTCAGATTGAAGGCTGAACTCTAGGGGAGTCTCTATATGGCAAGTGGTTGGTGAACATACCCTTCCGCCAATGCGGCTA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,514,550 | CGGGGTTTCACCGTGTTAGCCAGGATGGTCTCGATCTTCTGACCTTGTGATCCGCCCGCCTCGGCCTCCCAAAGTGCCGGGATTACAGGCGTGAGCCACTGCGCCCGGCCTGAAGGTGCCTTTTTAAGGCAGAGTGCCCTGCCCTTGTGT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,236,300 | ACTGACTACATTAGTATCAGAAAAAGCAGCGGTTCCCAACAAAGAGCATTATGAGTGAGAAAGAACAGTTCATCATGAGAGCAGGGTCACAGGGTCAATTAATCACAAAGAGACAACAAATGTAAAGGCATCTACTAAAAGAGCTCAAGA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,215,500 | AATCAGACTAAGGGCTTATTTTGATCATAATCTCCTTTACTCTGAACCCTACCTACCCTGTTTTGGCTAAGTGACAGATTTTGGCCTTCCTCTACCCAGGCTTACCACCCCCAACCTGTACTGAAGCTCTGTCGTATCATGAGATGAAGT | 11
|
G000010185 | ASM1018v1 | GCF_000010185.1 | PRJNA224116 | SAMD00060918 | null | 2008/02/14 | Kitasato Institute for Life Sciences | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/185/GCF_000010185.1_ASM1018v1 | 641,522,627 | RS_GCF_000010185.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 334,413 | 1,260 | Finegoldia magna ATCC 29328 | strain=ATCC 29328 | null | Bacteria | Firmicutes | Tissierellia | Tissierellales | Peptoniphilaceae | Finegoldia | Finegoldia magna | true | Finegoldia magna ATCC 29328 | Eubacteria | Firmicutes | 1 | 0.995 | 1 | 1 | 1,986,740 | 2 | 32.07 | 1,797,577 | 1 | 1,846 | 611,719 | 90.720879 | 99.39 | 0 | 0 | 282 | yes | yes | yes | 20 | high | 1,472,250 | TTTCAAATAATCATTGTTCTTTTTTACGATGTCACTCATTTTATTCCTCGTTTAGATATCGTTCAATTTCGTCGGTGTATATTTTTATTTGATATAAATATCTGTCGTACATTTCGTGGAGTTGCTTGTATCGTTCGGCAGTTTTTTGTT | 0no label
|
G000006865 | ASM686v1 | GCF_000006865.1 | PRJNA57671 | SAMN02603339 | null | 2001/03/21 | INRA | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/865/GCF_000006865.1_ASM686v1 | 637,000,144 | RS_GCF_000006865.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,623 | 1,358 | Lactococcus lactis subsp. lactis Il1403 | strain=IL1403 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Lactococcus | Lactococcus lactis | true | Lactococcus lactis subsp. lactis Il1403 IL1403 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 2,365,589 | 1 | 35.33 | 2,365,589 | 1 | 2,383 | 693,662 | 86.378488 | 100 | 0 | 0 | 310 | yes | yes | yes | 20 | high | 2,137,460 | GCTTCTTGCCTGAAAATTATATGGTTAATTCTTTCCATCATCAAGTCATTAAAGATTTGGGCCAAGGCTTGACGGCCATTGCTCATGGAAACGATGGCTTAGTTGAAGCGATTGAAAATAAAGAAAAACATGTGCTTGCTGTCCAATGGC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,885,350 | CAGCCCCACCCCCATCCTCCAGGAAGGAGAGAGGGGCTAGAAATTGTGTTAATAATTAATTATGCCTGCATGATGAAACCTCCATAAAAACCCCTGAACAACAGGGCTTAGAGACTTCCTGGGTTGATGAACACGTCGGAATGTCTAGAG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,631,400 | TAAAAACCCAGCCCAGTTCATGGCTCCTTTGGCAGCAACCCTGACACGCTTTACAGCCCTAGACCCTAAAAGGTCAAAAGGCCGTCTTATTCTCAAAATACATTTTATTAACCAATCTGCTCCCGACATTAAATAAAACTCCAAAAATTA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,919,700 | GAGGCCCTCACGCAAGAACGAGAAGGCCAAGAGTGAGTGGGAGCCCTGGGGTGGGGACAAATCAGAGTCCCTGGGGGGACACGACGGTAGGGACCCTCCCAGGGCAGCCACTGATGGCTGAGGAGCAGCGAGACCCTAGGCCTGGACACC | 11
|
G000007465 | ASM746v2 | GCF_000007465.2 | PRJNA57947 | SAMN02604090 | null | 2011/09/01 | Univ. Oklahoma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/465/GCF_000007465.2_ASM746v2 | 637,000,288 | RS_GCF_000007465.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 210,007 | 1,309 | Streptococcus mutans UA159 | strain=UA159 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Streptococcus | Streptococcus mutans | true | Streptococcus mutans UA159 | Eubacteria | Firmicutes | 1 | 1 | 0.9 | 1 | 2,032,925 | 1 | 36.83 | 2,032,925 | 1 | 1,897 | 591,301 | 85.692487 | 100 | 0 | 0 | 308 | yes | yes | yes | 20 | high | 739,960 | GCAGTGTAAAAGTGAGCATTAAAACCGTATAACTATACGCCATACGGTTTTAATATGTTCTCCAAAGTGATTATTTTTGATAGTTTAATAATTGAAATTTAGAAAGGTTGTGATTTCCTTATCCAGATTGTTAGTCAGTCGGCGCTATCT | 0no label
|
G000006725 | ASM672v1 | GCF_000006725.1 | PRJNA224116 | SAMN02603773 | null | 2004/06/04 | Sao Paulo state (Brazil) Consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/725/GCF_000006725.1_ASM672v1 | 637,000,348 | RS_GCF_000006725.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 160,492 | 2,371 | Xylella fastidiosa 9a5c | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xylella | Xylella fastidiosa | true | Xylella fastidiosa 9a5c | Eubacteria | Proteobacteria | 0.98 | 0.993 | 0.9 | 1 | 2,731,750 | 3 | 52.62 | 2,679,306 | 1 | 2,664 | 765,931 | 82.59299 | 99.59 | 0.18 | 0 | 325 | yes | yes | yes | 20 | high | 1,500,070 | TGCTGTTATGAGGCTTATTGCTGAGTGGAGAGCGCTCATTTCATGAGTTTTCCTCCTGGGAGAGGAGTTGCCACAACGCTCTGCATTTCGGTTTTGGCCAATCTGTGCGTTCATTTTTCCTATCTCGATGGTGCTTGCCATGTGTCACCA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,552,850 | ATGGAGGTGAGGAAGATCAGGTTTCTGCCCCTGGAGAGCTCCATCCTGGGTCAACAGCAGACATGGATCAGACCTGCTTGTCAAGGTGAAACTTACCACTACACACAGCTGGGCACAAGAACAGAGATCTGGGGTCTCAGGGCAGCTCTG | 11
|
G000010605 | ASM1060v1 | GCF_000010605.1 | PRJNA224116 | SAMD00060929 | null | 2008/04/08 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/605/GCF_000010605.1_ASM1060v1 | 641,522,653 | RS_GCF_000010605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 455,632 | 1,911 | Streptomyces griseus subsp. griseus NBRC 13350 | strain=NBRC 13350 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces griseus | true | Streptomyces griseus subsp. griseus NBRC 13350 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 8,545,929 | 1 | 72.23 | 8,545,929 | 1 | 7,113 | 2,547,362 | 87.837226 | 99.84 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 7,545,070 | CGCACCGCTGCTCGCCGCGCTGCCGACCGGCGCGGACCTCGATCCGGCCGCCGCCTCCGGCGCCGCGGAGCCCAGGGTCACCGCCCCGAGGTGCGGCGCTCCCGGCGGTACCGGGACGGTCGACTCCCGGCCATGATCCAGGCAAAAGGC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,242,550 | GTCCCACTGCACTCCGCCACCCCCCTACCACGCCGACCCCAGCCTCGTCAGGTGCGTGGGCTGCCGAGGGCCTGAGCATGTGCTGTCACCCTGTCTGTTCACCTCTGTCCTTCTGGCCATGTCAGCTGCCCTGCCCCACCCTGTGTGCTC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,079,750 | CACCCAACAATTTTTTGTAGAGCTGGGGTTTCACCATACTGCCCAGGCTGGTCTCAGACTCCTGGGCTCAAGCAATCTGCCCAGCTTGGCCTCTCAAAATGTTGGGACTACAGGTGTGGGCCACCATGCCTGGACAAAAATAAATAAATA | 11
|
G000009905 | ASM990v1 | GCF_000009905.1 | PRJNA224116 | SAMD00061067 | null | 2004/09/02 | Kitasato Institute for Life Sciences, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/905/GCF_000009905.1_ASM990v1 | 637,000,306 | RS_GCF_000009905.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 292,459 | 2,734 | Symbiobacterium thermophilum IAM 14863 | strain=IAM14863 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Symbiobacteriaceae | Symbiobacterium | Symbiobacterium thermophilum | true | Symbiobacterium thermophilum IAM 14863 IAM14863 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 3,566,135 | 1 | 68.67 | 3,566,135 | 1 | 3,297 | 1,051,001 | 86.832243 | 98.02 | 0.03 | 0 | 347 | yes | yes | yes | 20 | high | 535,990 | TGGCCACCCGCCAGGGCTGCGCCAGCCAGACCGCCAGCGCGATGACGGCAATCTGGAGCAGCGCGGGCAGAGGCGGCGGCAGCGGCTCCCCCTTCCCCGGCAGCTCCAGCGGCAGCAAGAGGGCCGCGCCGGCCACCAGCGCGAGCGACA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,974,400 | GTCAGCTGGCCTAAAGGAGGCAGGAAGAGGGGGCGAGGAGGAGGCCGTGGGCACAGCCAGGCCAGTGACCCAGCAAGCACACAGGCACGGGGCCTACCGCCTTGCCACGGGTTTGCAAAACAGTTTGGGGGAAAAAATGGTTTTAAAATG | 11
|
G000007985 | ASM798v2 | GCF_000007985.2 | PRJNA57743 | SAMN02603989 | null | 2012/07/31 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/985/GCF_000007985.2_ASM798v2 | 637,000,120 | RS_GCF_000007985.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,231 | 35,554 | Geobacter sulfurreducens PCA | strain=PCA | null | Bacteria | Proteobacteria | Deltaproteobacteria | Desulfuromonadales | Geobacteraceae | Geobacter | Geobacter sulfurreducens | true | Geobacter sulfurreducens PCA | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 3,814,128 | 1 | 60.94 | 3,814,128 | 1 | 3,417 | 1,176,369 | 90.878544 | 99.35 | 0 | 0 | 363 | yes | yes | yes | 20 | high | 2,774,330 | ATCGGGACACTACCTTGCTACCGGCAGCCCCGCCTCCTTCCACTCGACGAACAGCGACTGGAATATTGAGGGATAGGCGAGGCCGATCAGCTTCTTGTAGGCCATGTAGCTGCGGCTGCCCGTATTGCAGTAGACAATGATCTTCTTTTC | 0no label
|
G000006605 | ASM660v1 | GCF_000006605.1 | PRJNA224116 | SAMEA3283089 | null | 2005/06/27 | Bielefeld Univ | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/605/GCF_000006605.1_ASM660v1 | 637,000,085 | RS_GCF_000006605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 306,537 | 38,289 | Corynebacterium jeikeium K411 | strain=K411 = NCTC 11915 | null | Bacteria | Actinobacteria | Actinobacteria | Corynebacteriales | Corynebacteriaceae | Corynebacterium | Corynebacterium jeikeium | true | Corynebacterium jeikeium K411 K411 = NCTC 11915 | Eubacteria | Actinobacteria | 1 | 0.996 | 1 | 1 | 2,476,822 | 2 | 61.35 | 2,462,499 | 1 | 2,137 | 751,284 | 89.378688 | 100 | 0.68 | 0 | 319 | yes | yes | yes | 20 | high | 1,932,710 | TCCACGTTGAAGCTCGGCTCGGCCTCGGCGACCTCATCCTTAGGTACGACGTTCCGATCGGTCTCCCGCAAAATCTTCGAGATACGATTGTGGATAGTCCGCGGTGAAAACACGTGCTGGTCGGGACGTGTGGGCGTCAATTCGCAAAGA | 0no label
|
G000009185 | ASM918v1 | GCF_000009185.1 | PRJNA224116 | SAMEA3138195 | null | 2006/06/22 | Max Planck Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/185/GCF_000009185.1_ASM918v1 | 637,000,129 | RS_GCF_000009185.1 | Monoisolate | Complete Genome | Full | na | Major | 362,976 | 293,091 | Haloquadratum walsbyi DSM 16790 | strain=DSM 16790 = HBSQ001 | null | Archaea | Euryarchaeota | Halobacteria | Haloferacales | Haloferacaceae | Haloquadratum | Haloquadratum walsbyi | true | Haloquadratum walsbyi DSM 16790 DSM 16790 = HBSQ001 | Archaea | Euryarchaeota | 1 | 0.997 | 0.9 | 1 | 3,179,361 | 2 | 47.86 | 3,132,494 | 1 | 3,071 | 845,315 | 78.317152 | 99.3 | 0 | 0 | 220 | no | yes | yes | 19 | medium | 984,750 | GGAGTCAGGAGAGTATATTGAAAAAGGCTCATTCGTGATTCGAGGCGATAGGACATACATTCGAGATGTCGCCGCGGAAATAGCAGTTGGAATTCAGTGCGCGGATGAAACACAGGTAATCGGTGGTCCCCCATCGGCAATTGCGGATCG | 0no label
|
G000010165 | ASM1016v1 | GCF_000010165.1 | PRJNA224116 | SAMD00060942 | null | 2009/04/01 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/165/GCF_000010165.1_ASM1016v1 | 643,692,011 | RS_GCF_000010165.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 358,681 | 1,393 | Brevibacillus brevis NBRC 100599 | strain=NBRC 100599 (= 47) | null | Bacteria | Firmicutes | Bacilli | Bacillales | Paenibacillaceae | Brevibacillus | Brevibacillus brevis | true | Brevibacillus brevis NBRC 100599 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 6,296,436 | 1 | 47.27 | 6,296,436 | 1 | 5,917 | 1,875,522 | 87.757979 | 99.73 | 0.27 | 0 | 381 | yes | yes | yes | 20 | high | 664,170 | GAGCGCGCTATCAATAATTGTACGATTGGATAAATCAGTTACTGTTAATTGGACTTGTGTGTTATCAAAGTCATTACTAAATTTACGCTGTTTATTGGATTGGAGTTTGAGATTACGGATTGCGATATAATATGGAATTTTATCTTTGCC | 0no label
|
G000007305 | ASM730v1 | GCF_000007305.1 | PRJNA224116 | SAMN02604284 | null | 2002/02/27 | Utah Genome Center | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/305/GCF_000007305.1_ASM730v1 | 638,154,515 | RS_GCF_000007305.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 186,497 | 2,261 | Pyrococcus furiosus DSM 3638 | strain=DSM 3638 | null | Archaea | Euryarchaeota | Thermococci | Thermococcales | Thermococcaceae | Pyrococcus | Pyrococcus furiosus | true | Pyrococcus furiosus DSM 3638 | Archaea | Euryarchaeota | 1 | 1 | 0.9 | 0.9 | 1,908,256 | 1 | 40.77 | 1,908,256 | 1 | 2,102 | 594,193 | 91.722127 | 99.5 | 0 | 0 | 195 | yes | yes | yes | 19 | high | 654,290 | GCTTTTCTAACGGTATTACGCACAACAAGAACTTTCTTCCCATTCTTTAGAATCTTCTTAATGTCATTAAGAACATCTGTAATATCCCCCTCAACTAATCTGACTTTTACATTTCCCCTTGAAGGTTTATTCTTGTCATTCTTATCCACA | 0no label
|
G000007865 | ASM786v1 | GCF_000007865.1 | PRJNA224116 | SAMN02604086 | null | 2004/01/30 | Univ. Minnesota | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/865/GCF_000007865.1_ASM786v1 | 637,000,168 | RS_GCF_000007865.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 262,316 | 1,764 | Mycobacterium avium subsp. paratuberculosis K-10 | strain=K-10 | null | Bacteria | Actinobacteria | Actinobacteria | Corynebacteriales | Mycobacteriaceae | Mycobacterium | Mycobacterium avium | true | Mycobacterium avium subsp. paratuberculosis K-10 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 4,829,781 | 1 | 69.3 | 4,829,781 | 1 | 4,544 | 1,497,326 | 91.345322 | 99.28 | 0.33 | 0 | 336 | yes | yes | yes | 20 | high | 2,787,330 | GTACTCCGCCTTCGCTGACATCCGCACCCTCAGGATTGTGCCACCCGGAGCGGCGATTTCGATGCAGCCTGGCTGACCCGGCGGGCTACCCGCGTGATTCGAGCAGGTCGATCACCCGCTGCGCCTGCTCCTCGACGGTGCCGTCCGGGA | 0no label
|
G000009745 | ASM974v1 | GCF_000009745.1 | PRJNA224116 | SAMD00061075 | null | 2003/10/03 | NHRI, Taiwan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/745/GCF_000009745.1_ASM974v1 | 637,000,337 | RS_GCF_000009745.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 196,600 | 672 | Vibrio vulnificus YJ016 | strain=YJ016 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Vibrionales | Vibrionaceae | Vibrio | Vibrio vulnificus | true | Vibrio vulnificus YJ016 | Eubacteria | Proteobacteria | 1 | 0.996 | 1 | 1 | 5,260,086 | 3 | 46.68 | 3,354,505 | 1 | 4,639 | 1,553,759 | 87.03525 | 100 | 0.14 | 0 | 369 | yes | yes | yes | 20 | high | 4,083,560 | CTTATTCATATCTTTATGGGATGAATTGGAGGTGAGTCATATCTATGACTCATTACTTATGGTATTTTTTAGCTTCTGTTGAGCCCTGATTACAAGTGGGGCTTTGCTGTTACAGGAGTTTTCTATGTCACACAAAATCGAATCACATGC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,471,450 | GAATAAAGTACTGATACATGCTATAATGTTGGTTAAACTTGAAAATATGATGATGTCCCGGTGTGGTAGCTCACACCTATAATCCCAGCACTTTGGGAGGCCGAGGCAGTTGGATCACCTGAGGTCAGCTCAGGACCAGCTGGGCCAACA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,614,000 | CCTGGGAGACAGAGGTTGCAGTGAGCTGAGATAGATCACGCCACTTCACTCCAGCCTGGGTGACAGAGTGAGACTCTGTCTTTAAATAAAAAAAAAAAAAAAAAAAAAGAGGACTAGTATGGTCCTGGCTGGAGCCGTGGCCCTGTTTGG | 11
|
G000008505 | ASM850v1 | GCF_000008505.1 | PRJNA58089 | SAMN02598265 | null | 2004/12/27 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/505/GCF_000008505.1_ASM850v1 | 637,000,023 | RS_GCF_000008505.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 281,309 | 1,428 | [Bacillus thuringiensis] serovar konkukian str. 97-27 | strain=97-27 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus thuringiensis | true | [Bacillus thuringiensis] serovar konkukian str. 97-27 | Eubacteria | Firmicutes | 1 | 0.998 | 1 | 1 | 5,314,794 | 2 | 35.37 | 5,237,682 | 1 | 5,361 | 1,516,528 | 84.049767 | 99.07 | 0.31 | 0 | 381 | yes | yes | yes | 20 | high | 4,292,210 | AATAAGTCTGCCATATCTGCTCCTTCTTCTTTAGATACATCTCCTAGGCTAAACGCATGACTGACCGCAACACGTCCGTCCCAACTAGCCTCCTCTGTATACTGAGCTAACTTTTTAATTGTATAAATACCTAAATGCCCTGCATCATGT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,360,250 | AGTCTTGAACTTCTGGGCTCAAGCAATCCTCCCACTTCGGCCTCCCAAAAGGCTGGGATTATAGACATGAGCCACCGCACCCGGCCCACTCCTGTTTTTTCACAACACAGTTCATCTCCTCTACTCCCAAGAGTTTGATCAAGGCTTTGG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,444,600 | AATCTTCTAGCTGAAACAGCGTCACTGCGGGCTCCAATCACACTTGAAGATGTCCAGGTGCACTGAGTGACCTGGCCTCCTCGCTGTGCAGGCCTTGCCTTCCTAATCAGATGCTGGATGCTGCTGCCCCGCCCCTCAGCTTGAAGGGCC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,597,000 | TGATTTCTGTCTTCTGGACTTTGGAAAATGTGATGGTTATGGGAGGCCGCTATGGTCACCTTACAGCCATGTGGGTCCAGCCCAAGGTCATAGCATGGTTGAGCCGAGAGAAGGAACCCAGCTGACATCAACCCTACCTCCAGACTTCTT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,091,700 | GCTCACCTGCGACATTTGGAAGTACAAAAGAACTTCACCGAAGAAGCGTTGTTCTAATGGAAAAATGAGGGCAAAGAAATTAAATCTCCTTTAAGAAAACCACTTACTTAAAAAATATGGCTTACATTTTTTAAGCGTTTTATCTCTGCT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,942,700 | GAGTCGTAATTTAAAGCGTGTGTGTATATGGACTTTGTCCCTTAAGGTCGATATAAAGAATCCTCGCAGAATCACAGACCTGTGCCGCCCGCCACCTTCTGCCATTGTTACATTACAGATTTGGTTTAGTTTCGTTTTGTTTTGTTTTTT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,645,400 | GCTGAGGACTTCGTCAGGTGTCAGGACTCGGGACAGCAGGACCCTCAGGCAGTAGGGCTCCAAGCACCAGCCCCTCGCCCCAGTCCCAGCAGGTGGCCTCCCCAACTTGAGCTGGGTTCATTTCCTCTCTCCACCCCTTCTTTCTTCTCA | 11
|
G000010565 | ASM1056v1 | GCA_000010565.1 | PRJDA19023 | SAMD00060921 | null | 2007/05/07 | Marine Biotechnology Institute Co., Ltd | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/010/565/GCA_000010565.1_ASM1056v1 | 640,427,128 | GB_GCA_000010565.1 | Monoisolate | Complete Genome | Full | na | Major | 370,438 | 110,500 | Pelotomaculum thermopropionicum SI | strain=SI | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Peptococcaceae | Pelotomaculum | Pelotomaculum thermopropionicum | true | Pelotomaculum thermopropionicum SI | Eubacteria | Firmicutes | 0.98 | 1 | 1 | 1 | 3,025,375 | 1 | 52.96 | 3,025,375 | 1 | 3,001 | 887,464 | 86.415667 | 100 | 0.63 | 0 | 331 | yes | yes | yes | 20 | high | 1,964,170 | TCCACAACCCTGGCCACAATCCTGTTCACCCTTTCCCGGCGGTTGCGGTAAAGGGCATCGCGTTCCTTGCCGGGCTGCACGCCGCAGCGCCTGCTTACCGCCGGGTCCCCTTCAAGAACTAAAAGGGCCTCTGCCCTGCTCAAAGGAGGG | 0no label
|
G000009825 | ASM982v1 | GCF_000009825.1 | PRJNA224116 | SAMD00061074 | null | 2004/12/30 | Kao Corporation, Biological Science Laboratories, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/825/GCF_000009825.1_ASM982v1 | 637,000,019 | RS_GCF_000009825.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 66,692 | 79,880 | Bacillus clausii KSM-K16 | strain=KSM-K16 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus clausii | true | Bacillus clausii KSM-K16 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 4,303,871 | 1 | 44.75 | 4,303,871 | 1 | 4,304 | 1,270,194 | 86.940919 | 98.67 | 0.33 | 0 | 373 | yes | yes | yes | 20 | high | 268,970 | ATCAAACGTGTGGAAGAGGCAATGGCTGGAGAGGGACGGATCCTTGTACGCCCATCTGGCACCGAACCACTTGTGCGTGTGATGGTCGAAGCCAAAACCGACGAGTTGTGCCAACAGTACGCAAACCAAATTGTTGATGTCGTAAAAGAA | 0no label
|
G000007805 | ASM780v1 | GCF_000007805.1 | PRJNA57967 | SAMN02604017 | null | 2003/03/05 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/805/GCF_000007805.1_ASM780v1 | 2,508,501,074 | RS_GCF_000007805.1 | Multiisolate | Complete Genome | Full | reference genome | Major | 223,283 | 251,701 | [Pseudomonas syringae] pv. tomato str. DC3000 | strain=DC3000 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas syringae group genomosp. 3 | true | [Pseudomonas syringae] pv. tomato str. DC3000 | Eubacteria | Proteobacteria | 1 | 0.997 | 0.9 | 1 | 6,538,260 | 3 | 58.34 | 6,397,126 | 1 | 5,862 | 1,948,843 | 87.825109 | 100 | 0.22 | 0 | 381 | yes | yes | yes | 20 | high | 5,971,810 | TGATAGGAAGCCTTGTTGGCCTTGCCCAGGTTCAATGAAGAACCCACTGCATCGCGGAACGGGCCGTAATAGGCGCTGGCGTACTTGGCCGAGTAGGCCATGATCCGCACGTTGACATGCCCGGCCAGCTCCAGAGACTCGCGGATGGCC | 0no label
|
G000009345 | ASM934v1 | GCF_000009345.1 | PRJNA57741 | SAMEA1705958 | null | 2007/01/12 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/345/GCF_000009345.1_ASM934v1 | 640,069,335 | RS_GCF_000009345.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 393,305 | 630 | Yersinia enterocolitica subsp. enterocolitica 8081 | strain=8081 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Yersiniaceae | Yersinia | Yersinia enterocolitica | true | Yersinia enterocolitica subsp. enterocolitica 8081 | Eubacteria | Proteobacteria | 1 | 0.998 | 0.9 | 1 | 4,683,620 | 2 | 47.22 | 4,615,899 | 1 | 4,253 | 1,352,606 | 85.086813 | 99.95 | 0 | 0 | 373 | yes | yes | yes | 20 | high | 2,233,270 | AACAGCTTGATAACCGCATTAATCAGGCCGAGTGTGAGTGCCACGGCCAGTGACAACAGCATCACGCACAGTGATAAGCCCGCCCCTTGTGCCAGTAACGGCAAATAGTCTGCGACCATTATCGACCTCCCAAGGCTAACCAACGGCAAC | 0no label
|
G000010605 | ASM1060v1 | GCF_000010605.1 | PRJNA224116 | SAMD00060929 | null | 2008/04/08 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/605/GCF_000010605.1_ASM1060v1 | 641,522,653 | RS_GCF_000010605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 455,632 | 1,911 | Streptomyces griseus subsp. griseus NBRC 13350 | strain=NBRC 13350 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces griseus | true | Streptomyces griseus subsp. griseus NBRC 13350 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 8,545,929 | 1 | 72.23 | 8,545,929 | 1 | 7,113 | 2,547,362 | 87.837226 | 99.84 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 168,220 | TCCTCACCCTGCGATTCCGCGATGCCTCCGCCGCCGACCAGGCCCGGGAACTACTCGCCGCCAAGGGAGAACAGCTCCACACGGCCGAAACCGCTCCACACGCGGTGAGTATCCGGCTCGCCCGCCCCGGGGCCGATGGAGAGACGCTGC | 0no label
|
G000006845 | ASM684v1 | GCF_000006845.1 | PRJNA57611 | SAMN02604088 | null | 2005/02/14 | Univ. Oklahoma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/845/GCF_000006845.1_ASM684v1 | 637,000,188 | RS_GCF_000006845.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 242,231 | 485 | Neisseria gonorrhoeae FA 1090 | strain=FA 1090 | null | Bacteria | Proteobacteria | Betaproteobacteria | Neisseriales | Neisseriaceae | Neisseria | Neisseria gonorrhoeae | true | Neisseria gonorrhoeae FA 1090 | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 2,153,922 | 1 | 52.69 | 2,153,922 | 1 | 2,142 | 609,210 | 83.31778 | 99.82 | 0.21 | 0 | 323 | yes | yes | yes | 20 | high | 1,162,460 | TAAGGATCAAGCTTGAGCATGGTAACGTTCAAGCCGCGCGATTCGAGGATGGCGGCAATAGAAGCGGCGGCGATACCTTTACCCAGTGAGGAGACAACGCCGCCGGTTACGAAAATGAATTTGGTCATGATGGAATACCCATGTTGGAAT | 0no label
|
G000007025 | ASM702v1 | GCF_000007025.1 | PRJNA224116 | SAMN02603141 | null | 2002/11/25 | CNRS | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/025/GCF_000007025.1_ASM702v1 | 637,000,243 | RS_GCF_000007025.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 272,944 | 781 | Rickettsia conorii str. Malish 7 | strain=Malish 7 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rickettsiales | Rickettsiaceae | Rickettsia | Rickettsia conorii | true | Rickettsia conorii str. Malish 7 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 1,268,755 | 1 | 32.44 | 1,268,755 | 1 | 1,435 | 347,621 | 80.686027 | 99.46 | 0.33 | 0 | 218 | yes | yes | yes | 20 | high | 241,280 | CTCTAGAGTCATTTCCACGTCTTTTATCGGCATCCTTATATGGTTCAAATGCCATGATTAAAAGCTTCGCTATAAATATCCTTAGCATGGCTCGGAAGATGATTTTTAACTGAATCAGGTAAATCGTTATTATTCTTATAAGGCATAAAA | 0no label
|
G000007785 | ASM778v1 | GCF_000007785.1 | PRJNA57669 | SAMN02603978 | null | 2003/03/28 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/785/GCF_000007785.1_ASM778v1 | 637,000,101 | RS_GCF_000007785.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,185 | 1,351 | Enterococcus faecalis V583 | strain=V583 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Enterococcaceae | Enterococcus | Enterococcus faecalis | true | Enterococcus faecalis V583 ASM778v1 | Eubacteria | Firmicutes | 0.99 | 0.991 | 1 | 1 | 3,359,974 | 4 | 37.38 | 3,218,031 | 1 | 3,271 | 1,000,353 | 87.714339 | 99.53 | 0.31 | 0 | 309 | yes | yes | yes | 20 | high | 801,710 | TCAACGTCATCCCAAATGGTTAGAGCAAGGAAGAATCGAGGGAAATGAATGAAAATTTTTGTCGATGGCGATGGTTCACCTGTGAAAGAGACGGTTATTGAAGTCGCTGTAGAGAAAGCTTTGGATGTGGTGATTGTTACTAGTGTAGAT | 0no label
|
G000010565 | ASM1056v1 | GCA_000010565.1 | PRJDA19023 | SAMD00060921 | null | 2007/05/07 | Marine Biotechnology Institute Co., Ltd | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/010/565/GCA_000010565.1_ASM1056v1 | 640,427,128 | GB_GCA_000010565.1 | Monoisolate | Complete Genome | Full | na | Major | 370,438 | 110,500 | Pelotomaculum thermopropionicum SI | strain=SI | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Peptococcaceae | Pelotomaculum | Pelotomaculum thermopropionicum | true | Pelotomaculum thermopropionicum SI | Eubacteria | Firmicutes | 0.98 | 1 | 1 | 1 | 3,025,375 | 1 | 52.96 | 3,025,375 | 1 | 3,001 | 887,464 | 86.415667 | 100 | 0.63 | 0 | 331 | yes | yes | yes | 20 | high | 2,551,770 | TTCCCTGCTTCACCATTACTACACCACCAGGCCCAACAACCCGTTGAAAGGCAAGCAGTCACTGGTGGCAATCTGCTGTAAACTGTTGCGCATCATCTTTGCTCTGAGCCAAAAGAAAATGGCCTACGATAAAAATATGGTTATTTCTCA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,240,650 | ATAGGCCTGACACCTGAATCATTTTCCCAGACTGAGAATATTGGCCAGAAGCCCACTGTCTAGGGATGTGTGTAGGTAACAGCTGTTCTCTTTCATATAATACAGCAGGATGGGCACTGGGTGTTTCAGCTCTACCATTCACTCAGTGAG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,098,900 | CTGGGTCTCAAAGGCTGGCTGGCAACAGGCTGCACCGGGCATGGGAATCCGCCAGCTGCGAGATTGGGGGTAAAGAGCTCAGACATGGTCAGAAGCCTCTGCCTAACACACGGCTCCAGTAGCCACTCCTCAGGCCTCCTGCGCCCTCGG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,190,850 | CTTTTTTTGGGTATGCACAAAGTGCCAGGCACGTAGATCGTGTTTTCTCCTGGCCAGTTCTCCAGGCAGGAACTACTATATGCCCACTTTACAAGTGAGGAAACTGAGGCTCAGAGAGGCTAAGTGACTTGCCCAAATCCACACAGCAAG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 565,650 | CCGAGAGCTGGGGGAGCCCAGGGCGGGGAGGGCGCGGCCGGAGCGAGCGCCGCCCGGGAAACCCGAGCCCCGCCAGGTGCGCGGGGACAAAGGCGGTGCCGGGAGGGCGGGTCCTGGGGGTCCCCCTGCCCCCTCTGCGGTGCGTTGGGA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,569,950 | CTCGGTTTCCTTCCAATTCATTCTCGATTCCCAGATACTCAGATGAGAAATCCGCACTCAGGCCGTCAGGCTCCTGGGCCCGGGCCACCCTGCCTGCGCTCAGCCCGGCCCCTCCGCCGCAGCGCCTCGGAGTTTGGGGGCTACAGGGGA | 11
|
G000006725 | ASM672v1 | GCF_000006725.1 | PRJNA224116 | SAMN02603773 | null | 2004/06/04 | Sao Paulo state (Brazil) Consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/725/GCF_000006725.1_ASM672v1 | 637,000,348 | RS_GCF_000006725.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 160,492 | 2,371 | Xylella fastidiosa 9a5c | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xylella | Xylella fastidiosa | true | Xylella fastidiosa 9a5c | Eubacteria | Proteobacteria | 0.98 | 0.993 | 0.9 | 1 | 2,731,750 | 3 | 52.62 | 2,679,306 | 1 | 2,664 | 765,931 | 82.59299 | 99.59 | 0.18 | 0 | 325 | yes | yes | yes | 20 | high | 324,740 | GGGAACGTGGTCGATGTGTGCCCGGTCGGTGCATTGACGAACAAGGTATTTCAGTTCCGTGCTAGACCGTGGGAATTAATGGCCTACCAGTCGTTGGGGTATCACGATGCGATGGGTTCCAACTTATTTCTGCATGTGCGTCAGGGCGAA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,348,600 | CACTTTATCTGTTCCCTCATACATATTTTTAGATTGAAAATGTAAATGTAGATAAACAGTGAGAAGTTTATTGAACCTGAGTTATGATTTGACCTAAGCCTGGACCCGAGATTTTGTAATATGATCAACAGGAAAAAGGTAAATCTGGGC | 11
|
G000009765 | ASM976v2 | GCF_000009765.2 | PRJNA224116 | SAMD00061088 | null | 2016/03/24 | NITE | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/765/GCF_000009765.2_ASM976v2 | 637,000,304 | RS_GCF_000009765.2 | Monoisolate | Complete Genome | Full | representative genome | Minor | 227,882 | 33,903 | Streptomyces avermitilis MA-4680 = NBRC 14893 | strain=MA-4680 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces avermitilis | true | Streptomyces avermitilis MA-4680 = NBRC 14893 MA-4680 ASM976v2 | Eubacteria | Actinobacteria | 1 | 0.999 | 1 | 1 | 9,119,895 | 2 | 70.7 | 9,025,608 | 1 | 7,915 | 2,675,970 | 86.456522 | 99.89 | 0.79 | 0 | 356 | yes | yes | yes | 20 | high | 722,930 | GGCGAGTCGGCGCTTCCACATCGCCCGCGAGCACGCGCGCACCTACCCTGCCTTCGACCAGCAGAACTTCGACCTCACCGCTTGATCACGAGCCTGCTTGCGGACAGACTGCGGCCCATGAAGTTCACGGGCGTGCCCGCCTGCGCGCAG | 0no label
|
G000008545 | ASM854v1 | GCF_000008545.1 | PRJNA57723 | SAMN02603986 | null | 2001/01/09 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/545/GCF_000008545.1_ASM854v1 | 637,000,321 | RS_GCF_000008545.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,274 | 2,336 | Thermotoga maritima MSB8 | strain=MSB8 | null | Bacteria | Thermotogae | Thermotogae | Thermotogales | Thermotogaceae | Thermotoga | Thermotoga maritima | true | Thermotoga maritima MSB8 ASM854v1 | Eubacteria | Bacteria | 1 | 1 | 0.9 | 1 | 1,860,725 | 1 | 46.25 | 1,860,725 | 1 | 1,866 | 602,696 | 95.430706 | 100 | 1.79 | 100 | 312 | yes | yes | yes | 20 | high | 1,022,190 | GATCGTCTTTTGGAAGAGAGAACATGCTGGAGGCGAGTAAACTCAAAGCTTCCGCATCTTTGAGTATCTGTTTGTTCTCTTCGTAGAGCGTTCTCAACGGGTGCCCATTCGGGAGCTTCTCTATTTCTCTTCCGGCTTCTGATACGGCTC | 0no label
|
G000010425 | ASM1042v1 | GCF_000010425.1 | PRJNA224116 | SAMD00061080 | null | 2006/12/05 | Gifu University, Life Science Research Center, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/425/GCF_000010425.1_ASM1042v1 | 639,633,010 | RS_GCF_000010425.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 367,928 | 1,680 | Bifidobacterium adolescentis ATCC 15703 | strain=ATCC 15703 | null | Bacteria | Actinobacteria | Actinobacteria | Bifidobacteriales | Bifidobacteriaceae | Bifidobacterium | Bifidobacterium adolescentis | true | Bifidobacterium adolescentis ATCC 15703 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 2,089,645 | 1 | 59.18 | 2,089,645 | 1 | 1,683 | 614,966 | 86.722338 | 100 | 0 | 0 | 284 | yes | yes | yes | 20 | high | 546,780 | TCGGCTCCGCACTGAATCTGGTCGATGTCGATACCGTGCTGCTGGGCGGTTGGTGGACCGATTTCGGGCCGTTCTTCTACGAAACGCTCGAAAACCGTTTGGAATCGCAGGTCTTGGGGGCGTCGGACATGCAGGTGAGCGTGTCCATCC | 0no label
|
G000009205 | ASM920v1 | GCF_000009205.1 | PRJNA57679 | SAMEA1705932 | null | 2006/09/20 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/205/GCF_000009205.1_ASM920v1 | 640,069,308 | RS_GCF_000009205.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,563 | 1,496 | Clostridioides difficile 630 | strain=630 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Peptostreptococcaceae | Clostridioides | Clostridioides difficile | true | Clostridioides difficile 630 ASM920v1 | Eubacteria | Firmicutes | 1 | 0.998 | 0.9 | 1 | 4,298,133 | 2 | 29.06 | 4,290,252 | 1 | 3,829 | 1,209,268 | 82.891874 | 99.51 | 0.37 | 0 | 340 | yes | yes | yes | 20 | high | 3,569,150 | ATGATAAATGTATATATTTTTTTAGGAGGTATTATAATTGGATACTAAAAAAGTCACATTTTCTTCAATGTGCATAGTTATTAATATTGTCTTAGGTATGGTTATATCTATGATAAATATACCATTATTATTTTTAGATACAGTTGGTAC | 0no label
|
G000010605 | ASM1060v1 | GCF_000010605.1 | PRJNA224116 | SAMD00060929 | null | 2008/04/08 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/605/GCF_000010605.1_ASM1060v1 | 641,522,653 | RS_GCF_000010605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 455,632 | 1,911 | Streptomyces griseus subsp. griseus NBRC 13350 | strain=NBRC 13350 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces griseus | true | Streptomyces griseus subsp. griseus NBRC 13350 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 8,545,929 | 1 | 72.23 | 8,545,929 | 1 | 7,113 | 2,547,362 | 87.837226 | 99.84 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 3,001,960 | CGGCGGCGGCCACCGGCCCCGGGTGCGGCGGCAGGAACGCGTGGGTCATCGACAGGCCCGCCAGCAGCGGCATCGCGTAGAGCAGGATCGATTTGCCGGAGCGCTTGGCGGCGGCGTACACGATCGGCGCGAGGACGAAGATGCCGACGT | 0no label
|
G000009205 | ASM920v1 | GCF_000009205.1 | PRJNA57679 | SAMEA1705932 | null | 2006/09/20 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/205/GCF_000009205.1_ASM920v1 | 640,069,308 | RS_GCF_000009205.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,563 | 1,496 | Clostridioides difficile 630 | strain=630 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Peptostreptococcaceae | Clostridioides | Clostridioides difficile | true | Clostridioides difficile 630 ASM920v1 | Eubacteria | Firmicutes | 1 | 0.998 | 0.9 | 1 | 4,298,133 | 2 | 29.06 | 4,290,252 | 1 | 3,829 | 1,209,268 | 82.891874 | 99.51 | 0.37 | 0 | 340 | yes | yes | yes | 20 | high | 199,680 | GTATGAGTGATTTAAGTATAAAAGATATGGATTTATTAGCTGTATGTATAGGTCCAGGTTCGTTTACAGGACTTAGAATAGGTATGGCTACAGTAAAAGCTATGGCCCATGTAAATAATATACCAATAATAGCAGTAAATTCTTTGGAAT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,823,150 | GAGGCCGTTGATCCTCTGGCTGGGGACAGGGGCATCCTGAGATGAGGATGGAGCAGAGAAGCTGGACCTGTCGGTTTGGACTCTTTGTCAGGGTGTTGACCAAACACAGCAAGCCCTGTGGTGGGGAACAGGAGGGTGAGATGTATCCCT | 11
|
G000008925 | ASM892v1 | GCF_000008925.1 | PRJNA58233 | SAMN02604111 | null | 2006/03/30 | University College Cork | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/925/GCF_000008925.1_ASM892v1 | 637,000,143 | RS_GCF_000008925.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 362,948 | 1,624 | Lactobacillus salivarius UCC118 | strain=UCC118 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Lactobacillaceae | Lactobacillus | Lactobacillus salivarius | true | Lactobacillus salivarius UCC118 | Eubacteria | Firmicutes | 1 | 0.986 | 1 | 1 | 2,133,977 | 4 | 33.04 | 1,827,111 | 1 | 2,106 | 630,045 | 86.976336 | 99.48 | 0.52 | 0 | 292 | yes | yes | yes | 20 | high | 1,949,870 | ATTAACATAAAAGGATACTTAGTCTTATTATAGGTCTGCTGGGCTAACAATTTTTATCTTAGCTTTCCTGTAATCTTTAATATTCCTTGTTAAGATAAAATCTACTTCATTAGAGATAGCTGTTTCAACCATAACGGCATCTTCATAATC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,250,250 | CAGCGGTAATCTCTTCCTTCCTCAAATGTTCATGCTGCCTTCCTGGTTGTATTTATATGTATAAATAACTGCAAAATAGGATTAAAAGTGAGGCCCTGACTCCCCAGTGAACCTGCAAGCTCCTTCAGGCCCGAGCCTTGATGTGCTTTT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,928,000 | CCGCCTCTACTAAAAATACAAAAAAAAAAAAAAAATTAGCCGGGCGTGGTGGCGGGCACCTGTAGTCCTAGCTACTCGGGAGGCTGAGGCTAGAGAATGGCATGAACCAGGGAGGCAGAGCTTGCAGTGAGCCGAGATCACACCATTGCA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,199,400 | GACCCAAGACCAAGACCCTGCCCCAGGCGAAGGAGAGGCAAGCTCCACAAAGAAGGCTCCTTGGCGCCATGTTAGGGTGCACCGTTGGGGGGTCCATGGGGGACCTTCTTTCCAGGAGCTGTTTCTCACCACTTCTTAGACATTCTGAAG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,882,450 | GATGAATGGTGGTGATGGTGATGTGATGATGATGGTGATGGGATGGTGATGGTGATAAAGATGACAATAACGGTGATGAAGATGATAATGGTGATGTCAGTGATGATGGTGATGGAAGTGATGGTGACTATGATGATGATAAGGACGGTC | 11
|
G000010605 | ASM1060v1 | GCF_000010605.1 | PRJNA224116 | SAMD00060929 | null | 2008/04/08 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/605/GCF_000010605.1_ASM1060v1 | 641,522,653 | RS_GCF_000010605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 455,632 | 1,911 | Streptomyces griseus subsp. griseus NBRC 13350 | strain=NBRC 13350 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces griseus | true | Streptomyces griseus subsp. griseus NBRC 13350 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 8,545,929 | 1 | 72.23 | 8,545,929 | 1 | 7,113 | 2,547,362 | 87.837226 | 99.84 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 3,273,790 | TGACCCCATGAAGCTGCTGACCGTGAACATCGGGCAACCTCGCCCCTCCGACCGGACCGACGGCCCGGGGGGCGTCACCGGGATCGACAAGCGACCGGTGGAGGGCCCGGTCGAGGTCCTCGACCCCGGGCCCAGGGGCAGCGGCGGCAG | 0no label
|
G000006865 | ASM686v1 | GCF_000006865.1 | PRJNA57671 | SAMN02603339 | null | 2001/03/21 | INRA | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/865/GCF_000006865.1_ASM686v1 | 637,000,144 | RS_GCF_000006865.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,623 | 1,358 | Lactococcus lactis subsp. lactis Il1403 | strain=IL1403 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Lactococcus | Lactococcus lactis | true | Lactococcus lactis subsp. lactis Il1403 IL1403 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 2,365,589 | 1 | 35.33 | 2,365,589 | 1 | 2,383 | 693,662 | 86.378488 | 100 | 0 | 0 | 310 | yes | yes | yes | 20 | high | 1,596,140 | CATTGGTTGGTTCGTCAAGCAAAAGCACATTGGGTTGTAATAATAAAATTTTAAGTAAATAGAGTCGTTTTTTCTCACCACCTGAAAGTTTAGAAATCAGTGTTCCATGACTACTTCTTGGGAAGAGAAACTGCTCTAATAAATTAACAA | 0no label
|
G000009985 | ASM998v1 | GCF_000009985.1 | PRJNA224116 | SAMD00061077 | null | 2005/12/01 | Tokyo University of Agriculture and Technology, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/985/GCF_000009985.1_ASM998v1 | 637,000,155 | RS_GCF_000009985.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 342,108 | 84,159 | Magnetospirillum magneticum AMB-1 | strain=AMB-1 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhodospirillales | Rhodospirillaceae | Magnetospirillum | Magnetospirillum magneticum | true | Magnetospirillum magneticum AMB-1 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,967,148 | 1 | 65.09 | 4,967,148 | 1 | 4,628 | 1,522,305 | 90.298759 | 99 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 3,419,390 | GGGTGGCTACGCCCCCATGGTCGCGGCCGATTATGCCCGTTTCTCGCTGCCGGACTCCTTGCGGATGGACTACGACGAGCTTATCGAACTCATCGCCAACTCGGTGCGCATCCGCGTGGGAGGCGCGGCCGAACTGATCCTCCCCATCGA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,834,500 | GAAATAGGAGCAGATACGTTACCTCCGCTTGCCAGATAAGAAACTGGGACGCAGATGGATGGACTACCTGAGAGTTGTAGATAACATTTTCCTGTTCATGGGGTGGAGGACCTGGCCCTGAGAGGACAGGATCCCTCCTGCTCCTGCCAG | 11
|
G000008865 | ASM886v1 | GCF_000008865.1 | PRJNA57781 | SAMN01911278 | null | 2004/05/11 | GIRC | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/865/GCF_000008865.1_ASM886v1 | 637,000,108 | RS_GCF_000008865.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 386,585 | 562 | Escherichia coli O157:H7 str. Sakai | strain=Sakai substr. RIMD 0509952 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Enterobacteriaceae | Escherichia | Escherichia coli | true | Escherichia coli O157:H7 str. Sakai Sakai substr. RIMD 0509952 | Eubacteria | Proteobacteria | 1 | 0.996 | 0.9 | 1 | 5,594,477 | 3 | 50.48 | 5,498,450 | 1 | 5,399 | 1,663,868 | 87.620737 | 99.97 | 0.33 | 0 | 374 | yes | yes | yes | 20 | high | 5,222,750 | CTTCTTCGATACGAATGTTGTTTGACATGTGAACCTTCTTTTTCAAGCTGCCAATGATTTGCTTTAAACACACAGAATATATGTGGTTTCGAATGTTTTTCGACCGACGATTATCCCCTGCATCGACCGAATATCCGAGATCATATGCTG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 730,200 | CTTTGGACTCATCGTAGGAGAAGTCCTGGGGGGATGGAACCCGCCCCCTCAGTGCCCACCCCAGGGGCCCTGCTACCCTCCGTGCTTTCCCGGAGCACAGGTGGGGGTGAGGTCCTTGTCTGAGGCTGCCACACGGCCCACGGACCACAC | 11
|
G000008645 | ASM864v1 | GCF_000008645.1 | PRJNA224116 | SAMN02603244 | null | 1999/12/22 | Genome Therapeutics Corporation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/645/GCF_000008645.1_ASM864v1 | 638,154,510 | RS_GCF_000008645.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 187,420 | 145,262 | Methanothermobacter thermautotrophicus str. Delta H | strain=Delta H | null | Archaea | Euryarchaeota | Methanobacteria | Methanobacteriales | Methanobacteriaceae | Methanothermobacter | Methanothermobacter thermautotrophicus | true | Methanothermobacter thermautotrophicus str. Delta H | Archaea | Euryarchaeota | 0.99 | 1 | 0.9 | 1 | 1,751,377 | 1 | 49.54 | 1,751,377 | 1 | 1,876 | 533,233 | 89.684117 | 100 | 0.31 | 16.67 | 182 | no | yes | yes | 19 | medium | 314,080 | GATTATGCGGGGAGACTTCAGAAGCCCTGCAATTTCCCTCGCATATCTGGTGCTGGCACCCACTGTTATCCCGGACGTCATGCCCCTTATGAGTTCGTCGGCGAAGTTGGGACCGGATATGCTGAATACTGTCCTGGACCCTGTTTCCTC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,373,100 | ATTCAGTCACATGCTCACACATACATGCACTCACAGTCACATGCTCACACATACAAGCACTCACACTCAACCTTACACACCCACATACATGCACTCACACTCAACCTTACACACCCACATACATGCACTCACACACAAGGCACTCTCACA | 11
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Pseudomonas putida KT2440 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 5,911,880 | ACGGCACGAGGAACACAGCGTTCTCGTCAGGGCGGCAGATCATGTCGATGTCTGCCGGGTCGAGCAGTTCGTAATAGATGTCGTCGTCGACGTAGTCGCCGGTCACGGTCTGCAGCAGCACGCTCTCGGGCAGCCGCATGCCTTTTTCAG | 0no label
|
Subsets and Splits