text
stringlengths 8
16.8M
|
---|
Q:
Is it possible to use animate.css with already translated elements?
I'm using Daniel Eden's animate.css on a website. It works great but I'm having problems with elements that already have a transform:translate() applied to them.
The problem I'm having:
I have a div that's fixed at the bottom of the page, transformed by -50% in the x-direction and a little over -100% in the y-direction to center it:
#resend_activation_div {
position:fixed;
top:100%;
left:50%;
transform:translate(-50%, calc(-100% - 10px));
}
which looks like this:
I add animated fadeOutDown to the classList of the div when the X is clicked. I want the element to fade out directly downwards from its position on the page. The problem is, the animation works in the following way ...
@-webkit-keyframes fadeOutDown {
from {
opacity: 1;
}
to {
opacity: 0;
-webkit-transform: translate3d(0, 100%, 0);
transform: translate3d(0, 100%, 0);
}
}
... so my original transform rule is overwritten and the element fades out in the direction of the blue arrow in the image above.
My workaround:
The only way I've found to overcome this so far is to define a new class which has the translation I want in it and using that in the classList instead ...
@-webkit-keyframes fadeOutDownWithCentering {
from {
opacity:1
}
to {
opacity:0;
-webkit-transform:translate3d(-50%, 100%, 0);
transform:translate3d(-50%, 100%, 0)
}
}
... which works, but it means writing a new rule for every animation for every different transformation I have on my elements!
So my question is: Is there a smarter way to do this? Can I make css respect my original transformation whilst performing the transformation in the animation rule?
A:
Explanation
Unfortunately, CSS doesn't have the ability to know what transform values the elements have previously without being told explicitly. That being said, there is a workaround to your problem: just tell the CSS explicitly the initial transform values.
To achieve what you want using pure CSS, we can use the calc function to perform calculations. Along with calc, we will also be using CSS custom properties to declare the initial transform value explicitly. Then, also tell CSS the value of translateY (e.g. 30px) required to do the fade-out animation. As calc can be used to operate on the CSS custom properties, we can now calculate the end translate value we want (e.g. translate: 0px calc(var(--initial-transformY) + var(--added-transformY))). Putting all these operations in a class (e.g. .fadeOutDown), we can now simply add this class to any elements you want to fade out.
Solution #1
Here's an example showing how to use the CSS custom properties and calc together to achieve what you want. In this example, you can simply add fadeOutDown class (without using the animation attribute) to the elements you want to fade out. The class will add the translateY value by a fixed value of 30px (you can also use a CSS custom property if you want).
const foo = document.querySelector('.foo')
const bar = document.querySelector('.bar')
bar.addEventListener('click', e => {
foo.classList.toggle('fadeOutDown')
})
* {
box-sizing: border-box;
font-family: Helvetica;
}
html,
body {
width: 100%;
height: 100%;
margin: 0;
overflow: hidden;
}
.foo {
--initial-transformY: -10px;
position: absolute;
bottom: 0;
left: 50%;
width: 40%;
background: #121212;
color: white;
border-radius: 5px;
padding: 16px;
text-align: center;
transform: translate(-50%, var(--initial-transformY));
/* or for Firefox, you can also use this -> translate: -50% var(--initial-transformY);*/
transition:
transform .5s ease,
opacity .5s ease;
}
.fadeOutDown {
opacity: 0;
transform: translate(-50%, calc(var(--initial-transformY) + 30px));
/* or for Firefox, you can also use this -> translate: -50% calc(var(--initial-transformY) + 30px) */
/* Or you can use a CSS custom property like this (Firefox)
--fadeOutDown-value: 30px;
translate: -50% calc(var(--initial-transformY) + var(--fadeOutDown-value)); */
}
.bar {
position: absolute;
top: 50%;
left: 50%;
transform: translate(-50%, -50%);
padding: 16px;
background: #ad17fd;
color: white;
border: none;
cursor: pointer;
border-radius: 5px;
transition: all .2s ease;
text-transform: uppercase;
}
<div class="foo">Hello there, I am foo</div>
<button class="bar">Click me to move foo</button>
Here's an example using the animation property. I discourage using this one because the reversed animation is instant (you can make it so that it appears gradually, but it's extra work). Easier to use transition and transform together (the above approach).
const foo = document.querySelector('.foo')
const bar = document.querySelector('.bar')
bar.addEventListener('click', e => {
foo.classList.toggle('fadeOutDown')
})
@keyframes fadeOutDown {
from {}
to {
opacity: 0;
translate: var(--initial-transformX) calc(var(--initial-transformY) + 30px);
}
}
* {
box-sizing: border-box;
font-family: Helvetica;
}
html,
body {
width: 100%;
height: 100%;
margin: 0;
overflow: hidden;
}
.foo {
--initial-transformX: -50%;
--initial-transformY: -10px;
position: absolute;
bottom: 0;
left: 50%;
width: 40%;
background: #121212;
color: white;
border-radius: 5px;
padding: 16px;
text-align: center;
translate: var(--initial-transformX) var(--initial-transformY);
}
.fadeOutDown {
animation: .5s ease 0s fadeOutDown forwards;
}
.bar {
position: absolute;
top: 50%;
left: 50%;
translate: -50% -50%;
padding: 16px;
background: #ad17fd;
color: white;
border: none;
cursor: pointer;
border-radius: 5px;
transition: all .2s ease;
text-transform: uppercase;
}
<div class="foo">Hello there, I am foo</div>
<button class="bar">Click me to move foo</button>
Solution #2
Or, as suggested by the comments in your question, you can add another wrapper so that you can apply the two transform values.
const foo = document.querySelector('.foo')
const bar = document.querySelector('.bar')
bar.addEventListener('click', e => {
foo.classList.toggle('fadeOutDown')
})
* {
box-sizing: border-box;
font-family: Helvetica;
}
html,
body {
width: 100%;
height: 100%;
margin: 0;
overflow: hidden;
}
.wrapper {
--initial-transformY: -10px;
position: absolute;
bottom: 0;
left: 50%;
width: 40%;
color: white;
text-align: center;
translate: -50% -10px;
}
.foo {
width: 100%;
background: #121212;
padding: 16px;
border-radius: 5px;
transition: translate .5s ease, opacity .5s ease;
}
.fadeOutDown {
opacity: 0;
translate: 0px 30px;
}
.bar {
position: absolute;
top: 50%;
left: 50%;
translate: -50% -50%;
padding: 16px;
background: #ad17fd;
color: white;
border: none;
cursor: pointer;
border-radius: 5px;
transition: all .2s ease;
text-transform: uppercase;
}
<div class="wrapper">
<div class="foo">Hello there, I am foo</div>
</div>
<button class="bar">Click me to move foo</button>
|
West Chester Borough Council
Overview
West Chester is governed by the Borough Council which consists of 7 members representing each of the voting wards in the borough.
Council directs the activities of the borough through the appointed Borough Manager, who in turn supervises all departments except the Police Department (the Mayor directs the activities of the Police Department through the Chief of Police). In order to provide continuity, the representatives from the even-numbered wards are elected at the same time, and representatives from the odd-numbered wards, plus the Mayor, are elected 2 years later. All serve 4-year terms, and are eligible for reelection once.
Mission Statement West Chester Borough Council resolves to retain a strong commitment to democratic principles and always demonstrate integrity, fairness, and honesty while fostering the values and integrity of representative government through action and example. Borough Council will continually advocate for active citizen involvement in local governance and recognize the right of citizens to influence local decisions. Borough Council will work effectively with the Borough Administration, in accordance with transparent and open government practices, to develop and implement policy always in the best interest of the residents of The Borough of West Chester.
Meetings
On the first Monday of January in each even numbered year, the Borough Council conducts a reorganization meeting where they elect a President and Vice President of Council.
meeting management
Agendas, Minutes, Attachments and Audio Recordings are available here. |
Getty
The news: Come 2017, the contraception landscape might look very, very different.
Vasalgel, an up-and-coming non-hormonal form of birth control for men, announced in a press release last week that its preclinical trials on primates had been successful. "If all goes well, [we] will be planning for clinical trials with humans to start next year," said the release.
The procedure is simple. As the name suggests, it works by blocking the vas deferens, the part of the male anatomy that carries sperm. It's similar to a vasectomy, but because it blocks the vas deferens instead of cutting it, the idea is to make the procedure easily reversible, with no lasting sperm damage. According to Vasalgel's developer, the Parsemus Foundation, a second injection would flush out the gel when the man no longer wanted it.
Trials involving male baboons have yielded (or not) promising results. Six months ago, three male baboons were injected with Vasalgel, and a month ago were moved to separate enclosures with 10 to 15 females each. Despite regular copulation, no pregnancies have been reported, though researchers will keep them together for a few more weeks to be sure.
Getty Images
The Parsemus Foundation says large-scale human trials are on the table for 2015-2016, and if everything goes according to plan, the gel will be on the market in 2017. The price? "It is likely that the cost for the doctor visit will be more than for the product," the organization says.
A brief history of male birth control: Unlike female birth control, which is extremely common, birth control for men is more elusive, excluding condoms. "The push for male hormonal contraceptive goes way back, more than a half-century ... starting in the 1950s, researchers were saying it was just around the corner, within the next five years," Elaine Tyler May, author of America and the Pill: A History of Promise, Peril and Liberation, told Gizmodo.
Yet a product still hasn't emerged, likely for a few reasons. May told Gizmodo that one of the side effects of potential male birth control pills has been impotence, and nobody wants that. A second hurdle is physiology; men make 1,000 sperm per second, whereas women make one egg per month.
Getty
Another reason is pharmaceutical companies. They would much rather provide (and charge) a woman every month for birth control, rather charge for a one-time procedure like Vasalgel. As the Daily Beast puts it, "Why sell a flat-screen television to a man, after all, when you can rent one to a woman for a decade?"
Save for a vasectomy, Vasalgel may be the next best option. It doesn't protect against HIV or STIs, but then again, neither does the pill.
This may change the conversation. If Vasalgel does become as widespread as researchers hope, it may lead to some interesting changes in the debate over reproductive health. Women's bodies have always been social and cultural battlegrounds, and nowhere has this been more evident than with access to birth control. What happens when it's men's bodies in question and not women's?
No one knows — at least not yet. But if Vasalgel does make it in 2017, we might have an answer sooner rather than later.
h/t The Daily Beast |
Tuesday, July 07, 2009
Tom Ripley (Matt Damon) is a young man struggling to make a living in NYC in the 1950s. While working at a party playing the piano, he is approached by wealthy Herbert Greenleaf (James Rebhorn), who believes him to be a school friend of his son, Dickie. Greenleaf asks Ripley to travel to Italy to persuade Dickie to return to the US. Dickie is a wayward son, throwing his life away on Jazz and a girlfriend. Ripley accepts the assignment, even though he did not go to Princeton and has never met Dickie. He is given $1,000 to carry out this job. In Italy Ripley meets Dickie Greenleaf (Jude Law) and his girlfriend Marge Sherwood (Gwyneth Paltrow), and quickly ingratiates himself into their lives. Over time Dickie begins to resent Ripley's presence and growing dependence, especially after he learns that Ripley has been lying about their days together at Princeton. Ripley's feelings are complicated by his desire to maintain the wealthy lifestyle Greenleaf has afforded him, and by his growing sexual obsession with his new friend.
Dickie Greenleaf: You know, without the glasses you're not even ugly.Tom Ripley: I really feel happy. As if I had been granted a new lease in life. (imitating Dickie's father) "To me, jazz is noise. Insolent noise."Dickie Greenleaf: Wow! Cut it out! It's so spooky, my hair's on end!Tom Ripley: You're the brother I never had. I'm the brother you never had. I would do anything for you, Dickie.Tom Ripley: First of all I know there's something. That evening when we played chess for instance it was obvious.Dickie Greenleaf: What evening?Tom Ripley: Oh sure, no, no, it's too dangerous for you to take on. Oh, no, no, we're brothers. Hey. And then you do this sordid thing with Marge. F**king her on the boat so we all have to listen. Which was excruciating! And you follow your c**k around and now you're getting married! I'm bewildered, forgive me. You're lying to Marge and then you're getting married to her. You're knocking up Silvana. You're ruining everybody. You wanna play the sax, you wanna play the drums. What is it, Dickie? What do you actually want?Dickie Greenleaf: Who are you? Huh? Some third class loser? Who are you? Who are you to say anything to me? Who are you to tell me anything? Actually I really, really don't want to be on this boat with you. I can't move without you moving. Gives me the creeps. You give me the creeps!
As a gesture to Ripley, Greenleaf agrees to travel with him on a short holiday to Sanremo. The two hire a small boat and go sailing. They begin arguing while on board, with Dickie rejecting and mocking Ripley. Enraged, Ripley attacks Dickie, smashing him with an oar that kills him. Ripley then sinks the boat with Dickie's body on board to conceal his crime. When the hotel concierge mistakes Ripley for Greenleaf, Ripley realizes he can assume Greenleaf's identity. He takes on Dickie's signature and passport, and begins living off his allowance, while at the same time carefully providing communications to Marge to make her believe that Dickie has deserted her. "I feel like I've been handed a new life," he says. Greenleaf's old friend Freddie Miles (Philip Seymour Hoffman) visits Ripley at what he supposes to be Greenleaf's apartment in Rome. He is immediately suspicious of Ripley. When Miles discovers Ripley's scam, Ripley murders him and dumps the body.
Freddie Miles: In fact the only thing that looks like Dickie is you.Tom Ripley: Hardly.Freddie Miles: Have you done something to your hair?Tom Ripley: Freddie, do you have something you'd like to say?Freddie Miles: What? I think I'm saying it. Something's going on. He's either converted to Christianity... or to something else.Tom Ripley: I suggest you ask Dickie that yourself. Otello's is on delle Croce, just off the Corso.Freddie Miles: Is it on "delle Croce, just off the Corso?" You're a quick study, aren't you? Last time you didn't know your ass from your elbow, now you're giving me directions. That's not fair, you probably do know your ass from your elbow. I'll see you.
Ripley's life becomes a cat and mouse game with the Italian police and Greenleaf's friends. He must alternate between Dickie Greenleaf and Tom Ripley. His predicament is complicated by Meredith Logue (Cate Blanchett), a wealthy heiress he met while traveling to Italy, who believes Ripley to be Dickie. Ripley eventually resumes his own identity, forges a suicide note in Greenleaf's name, and moves to Venice. Soon Marge, Herbert Greenleaf, and private detective Alvin MacCarron (Philip Baker Hall) confront Ripley. Marge suspects Ripley of involvement in Dickie's death, and Ripley plans to murder her. He is interrupted when Marge's friend, Peter Smith-Kingsley (Jack Davenport), enters the apartment.
Peter: Sorry, I'm completely lost.Tom Ripley: I know. I'm lost, too. I'm going to be stuck in the basement, aren't I, that's my, that's my... terrible, and alone, and dark, and I've lied about who I am, and where I am, and now no-one will ever find me.Peter: What do you mean... lied about who you are?Tom Ripley: I always thought it'd be better to be a fake somebody than a real nobody.Peter: What are you talking about? You're not a nobody. That's the last thing you are.
Near the end of the film, private detective MacCarron reveals that Mr. Greenleaf has decided to give Ripley a portion of Dickie's income with the understanding that certain details about his son's past not be revealed to the Italian police. Ripley goes on a cruise with Smith-Kingsley, his new gay lover, only to discover that Meredith Logue is also on board. Logue knows Ripley only as Dickie Greenleaf, and Ripley realizes it will be impossible to keep Smith-Kingsley from discovering that he has been passing himself off as Greenleaf, since Peter and Meredith know each other. He cannot solve this dilemma by murdering Logue, because she is traveling with a large family who will notice her disappearance. The movie concludes with a sobbing Ripley killing Smith-Kingsley to protect his secret, and returning to his cabin alone. Everything indicates that Ripley has successfully gotten away with murders, but the ending is somewhat ambiguous so that viewers can draw their own conclusions about what happens.
(last lines)Peter Smith-Kingsley: Good things about Mr. Ripley? Could take some time. Tom is talented. Tom is tender... Tom is beautiful... Tom is a mystery. Tom is not a nobody. Tom has secrets he doesn't want to tell me, and I wish he would. Tom has nightmares. That's not a good thing. Tom has someone to love him. That is a good thing. Tom is crushing me. Tom is crushing me... Tom, you're crushing me!
This stylish psychological thriller features outstanding acting by the entire cast. THE TALENTED MR. RIPLEY is writer-director Anthony Minghella's impressive follow-up to his Oscar-winning triumph THE ENGLISH PATIENT (1996). Re-creating late-1950s Italy in detail, the film captures la dolce vita while suspensefully developing the fracturing of Ripley's mind as his crimes grow increasingly desperate. And while Alfred Hitchcock was necessarily discreet with the homosexual subtext in STRANGERS ON A TRAIN (1951), Minghella brings it out of the closet, increasing the dramatic tension and complexity of Ripley's psychological breakdown. Matt Damon plays Tom Ripley, the murderous hero, although he is outshone by the dazzling Jude Law, whose violent disappearance halfway through the picture is a great loss. Law is the draw, a sunny, slippery, and pansexual character who would have made a better Ripley himself. However, Matt Damon appears in almost every frame and is mesmerizing. This film feels warm but unsettling, as if hinting at approaching storms. The musical score is evocative and moving, flitting from lugubrious to manic.
THE TALENTED MR. RIPLEY was filmed mainly in Italy with famous landmarks in the cities of Rome and Venice being used as a backdrop for the narrative. The beautiful Italian scenery more than compensates for any deficiencies in the movie. It's a very complex yet compelling story that requires strict attention to comprehend. This Hitchcockian character drama was previously filmed as PURPLE NOON (1960).
The DVD from Paramount is a high quality anamorphic transfer from a recent release. There is some noticeable film grain and a picture that tends towards softness. Colors are bright but not strongly saturated, there are no distracting digital artifacts, and only a small bit of dirt flecks or flaws. THE TALENTED MR. RIPLEY does have a dark cast to it, even in the brightest outdoor shots, which may or may not be an intentional decision of cinematography. The audio is excellent. Rear surrounds are used sparingly for atmospheric support, as is the subwoofer. Action is primarily in the front, with a nicely wide and deep soundstage. The instrumental score and jazz tunes are reproduced with clarity and zest, particularly in the smoky club scenes. Dialogue is clearly understood.
Extras are plentiful, especially considering some of Paramount's past bare-bones releases. The 20 minute featurette is a decent mix of interviews, behind the scenes looks, and promotional material. A short (8 minutes) soundtrack featurette is a notch higher, as it looks at a sometimes overlooked facet of filmmaking and is less afflicted by PR fluff. The two music videos, "My Funny Valentine" and "Tu Vuo' Fa L'Americano", are a bit underwhelming, as they are entirely made from edited sequences from the movie itself. Two trailers for the film are oddly matted to a more narrow aspect ratio than the movie itself. Finally, the feature length commentary by writer/director Anthony Minghella is solid and packed with insight into the writing, acting, and production of THE TALENTED MR. RIPLEY. |
Q:
How to handle database logic from model
I created a enterprise system model from a class diagram and converted it php object oriented code.
What I have now is just an empty model, it's able to relate and the connections are handled. Now the next step is ahead. I have a database and have to put the object into the database.
Now there is a lack of experience on my side. I have the model and since php renders a view and makes one time requests to render the view I'm a bit confused. It can't be possible to load all my entities out of the database and fill my model in memory and then use it because it would be way to large.
Does anybody know any ways to load just the needed data in my model and then use it? Maybe suggestions of a book or article?
Thanks!
A:
It sounds like you are running a "MV" (which doesn't exist) rather than "MVC" design pattern.
What's happened to your controller? Your controller should route the request to the model entity which is required for this particular view and then you can use the response as you require.
If your model represents information which is too large, then you are doing something wrong. You should consider lazy-loading your data, and only loading what is strictly neccessary. Naturally your controller will decide this and route everything to your model.
Edit in response to comments
You have several methods. If you are using Zend_Db_Table_Abstract then you subclass this class and use it as your model. This is probably the easiest.
Then you just use it as your model. Set the $_name = "myComments" and then just create a method called getComments.
In your method on in your subclass of Zend_Db_Table_Abstract, you can then create your $select.
Then you just return the response from your model.
So
$rows = $table->fetchAll($select);
And then just return $rows;
You will then get your $rows back in your controller.
You have loaded your model in your controller by $model = new Comments(); and then do the fetch using $result = $model->getComments();
Its a bit of a mismatch ,but that should show you how you should do it. You just need to create your model now.
|
Serum neopterin after lung transplantation.
Neopterin (N), a marker for activated cell-mediated immunity, was assayed in the sera of 44 lung recipients early and late after transplantation. The study was a prospective, blind clinical trial designed to evaluate the following: (1) the daily dynamics of the serum neopterin/creatinine (N/C) ratio during the first 3 weeks after transplantation; (2) the correlation between changes in the serum N/C ratio and episodes of rejection or infection; (3) the correlation between the serum N/C ratio and the concentration of serum soluble interleukin 2 receptor (sIL-2R), a marker of T-cell activation; and (4) the potential value of monitoring the serum N/C ratio during noninvasive long-term follow-up of lung recipients. Sera from lung recipients were collected every day or every 2 days for the first 3 weeks after transplantation (22 patients) and before fiberoptic bronchoscopy and routine consultation (44 patients). The N concentrations were determined by radioimmunoassay and sIL-2R levels were measured using a sandwich enzyme immunoassay. Serum N/C is an early and sensitive marker of immune activation in the 21 days following transplantation. The N/C ratios during early rejections (815 +/- 182 mumol/mol) and infections (677 +/- 75 mumol/mol) were higher than those in patients with no complications (160 +/- 32 mumol/mol). In contrast, the N/C ratio did not increase during rejection later after transplantation. More than 3 weeks after transplantation, an increase in the N/C ratio was specifically correlated with infections, mainly those due to cytomegalovirus (CMV) (control subjects, 132 +/- 12 mumol/mol; rejections, 163 +/- 25 mumol/mol; CMV pneumonia, 786 +/- 103 mumol/mol, p < 0.001). The N/C ratio correlated with sIL-2R serum levels (r = 0.625, p < 0.001). Our results indicate that more than 3 weeks after transplantation, the serum N/C ratio increases only in cases of infection, mostly CMV pneumonia. In contrast, both rejection and infectious complications are associated with an increased N production in the early postoperative period. |
Gustav Wilhelm Körber
Gustav Wilhelm Körber (10 January 1817, Hirschberg – 27 January 1885, Breslau) was a German lichenologist.
He studied natural sciences in Breslau and Berlin, obtaining his PhD in 1839 with the thesis De gonidiis lichenum. After graduation, he served as an instructor at the "Elisabethanum" in Breslau, and from 1862, worked as a private teacher. In 1873 he became an associate professor at the University of Breslau.
Best known for his investigations of lichen species native to Silesia, he also examined specimens found in central and southeastern Europe as well as lichen collected from Mediterranean and Arctic regions. The genera Koerberia and Koerberiella are named after him.
Selected works
Grundriss der kryptogamen-kunde, 1848 – Outline of cryptogamic species.
Systema lichenum Germaniae: Die Flechten Deutschlands, 1855 – "Systema lichenum Germaniae": German lichens.
Parerga lichenologica: Ergänzungen zum Systema lichenum, 1865 – "Parerga lichenologica": Supplement to "Systema lichenum".
Lichenen aus Istrien, Dalmatien u. Albanien: (with Emanuel Weiss), 1867 – Lichens of Istria, Dalmatia and Albania.
Lichenen Spitzbergens und Novaja-Semlja's, auf der graf Wilczek'schen expedition, 1872 – Lichens of Spitzbergen and Novaya Zemlya, from the Wilczek expedition.
References
Category:1817 births
Category:1885 deaths
Category:Lichenologists
Category:People from Jelenia Góra
Category:People from the Province of Silesia
Category:University of Breslau faculty
Category:German botanists |
Influence of solvent on the energetics of hole transfer in DNA.
We have investigated the contribution of molecular environment to the exchange reactions in the DNA molecule taking into account different geometries of the reaction centers in oxidized and reduced states. We have observed the influence of the ionization potential of the donor and the acceptor on the free energy of the hole transfer reaction in the solvated DNA molecule: A decrease of the free energy occurs if IPA > or = IPD and an increase if IPA < or = IPD. The corresponding decrease of the potential barrier by 0.244 eV for hole migration from (G-C) to (A-T) and increase for migration from (G-C) to (G-C)n in solvent have been determined. The prevalence of oxidation of the redox states in the molecule center in comparison to the molecule sides due to the nonuniform charge distribution along the phosphate backbone was found to be stronger for the non-neutralized backbone than for the neutralized case. The influence of the single counterion on the electrostatic interactions within the solute DNA molecule has been found to be smoothly spread over a long distance approximately 7-8 base pairs. Therefore, each counterion contributes to the oxidation potential of the 7-8 nearest nucleosides and any irregularity due to phosphate neutralization would not significantly modify the potential profile for the hole migration through the DNA molecule. |
Guillermo McGill
DETAILS
Author
Guillermo McGill Quintet
Genre
Jazz
Year
2008
This is Guillermo McGills fourth album. It is full of flamenco jazz, but in his own way, which is not the most orthodox. If in his previous projects he was submerged in more intimate proposals, and even philosophical, as in his debut album Los sueños y el Tiempo a tribute to Maria Zambrano, in this, even within the restraint so typical of this musician, he appears as an artist more attached to the earth, in the sense of showing his daily life, with his hopes and concerns. |
Early voting off to rocky start in Bahamas
Confusion reigned at the Kendal G L Isaacs National Gymnasium on Wednesday as Bahamaians began casting ballots in the advanced poll ahead of the May 10 general election..
National Security Minister Dr Bernard Nottage, who has responsibility for elections, told reporters that while the process was not going as freely as he would have hoped, he was nonetheless confident that polling will be conducted smoothly next week Wednesday.
“We are working as efficiently and effectively as we can to get it done,” he said, adding “the Parliamentary Registration Department is responsible for the conduct of elections”.
Hundreds of supporters of the three main political parties – the ruling Progressive Liberal Party (PLP), the main opposition Free National Movement and the smaller opposition Democratic National Alliance (DNA)- had gathered under a tent close to the venue in a bid to cast ballots from as early as 7.am local time.
Some party officials complained that there were several irregularities while some voters complained that the voter cards were being stamped with wrong dates.
An opposition candidate told reporters that the names of several of his poll workers who registered for the advanced poll were not available.
But despite the confusion, electoral officials say they anticipate that electoral workers, members of the security forces and the diplomatic service had taken advantage of the early poll on Wednesday.
There are an estimated 180,000 people registered to vote in the May 10 general election with the PLP seeking to hold on to power in the 41-member Parliament.
Meanwhile, the Guyana-based Caribbean Community (CARICOM) Secretariat said that CARICOM will send an Electoral Observer Mission to the Bahamas following a request from the Governor General of the Bahamas, Dame Marguerite Pindling.
The team will be led by Josephine Tamai, Chief Elections Officer of the Department of Elections and Boundaries of Belize and will include Orrette Fisher, Director of Elections of the Electoral Commission of Jamaica.
“Other members of the CEOM are nationals of Antigua and Barbuda, Grenada, Guyana, Saint Lucia, St. Vincent and the Grenadines, and Trinidad and Tobago, all of whom have election management and election observation experience. The CEOM will be supported by two members of staff from the Secretariat,” the Secretariat noted.
“Observation of the electoral process and electoral procedures in the various member states of the Community is a regular practice in keeping with the importance the Caribbean Community places on good governance,” it added. |
Q:
Low-cost centimeter accurate satellite positioning (GNSS/GPS)
I am looking for a cheapest possible GPS setup with a centimeter precision without much HW hacking. I am not able to produce my PCB or do any soldering (though I would do that if there is no other way) so a kind of a easy-to-assemble setup would be welcome. I know about the $900 Piksi thing but that is still too expensive for me. It seems like cm precision should be possible for much less - like employing a 50 USD raw GPS sensor with an antenna and ordinary PC with RTKLIB software.
I am not sure if it is better to use two GPS sensor setup for RTK (one base station and one for rover) or whether I can get the corrective DGPS data elsewhere (my region is Czech Republic - there seems to be national grid here allowing to stream correction data for reasonable cost).
My application will be in a passenger car so I will not be limited with power source - no low power needed although that would be nice. I will be using the position readings within OpenCV - so I need to get the data into C/C++ code. The application is data collection so I can use raw GPS post-processing.
A:
The NS-HP is a $50 RTK-capable GPS receiver providing centimeter-level accuracy:
NS-HP is a high performance GPS receiver capable of 2 / 4 / 5 / 8 / 10 / 20 / 25 / 40 / 50 Hz update rate. At 1Hz update rate, NS-HP can accept RTCM 3.x message type 1002, 1004, 1005, and 1006, or SkyTraq raw measurement data from a base station to perform carrier phase RTK processing, achieving centimeter-level accuracy relative positioning.
One NS-HP is needed if wishing to use with other RTCM 3.x RTK base station within 10Km operating range. Two NS-HP is needed if wishing to setup a local NS-HP RTK base station to work with another NS-HP rover.
|
You are here
Scuffles at West Bank Bedouin village slated for demolition/node/1372056/middle-east
Scuffles at West Bank Bedouin village slated for demolition
1 / 10
Palestinian protesters chant slogans and confront Israeli forces on September 14, 2018, as they demonstrate against the blocking of the road leading to the Palestinian Bedouin village of Khan Al-Ahmar in the occupied West Bank. (AFP)
2 / 10
Palestinians and foreign activists are trying to open the road closed by the Israeli army near his village of Khan Al-Ahmar, in the occupied West Bank on September 14, 2018. (AFP)
3 / 10
A Palestinian protester confronts Israeli forces on September 14, 2018, as he demonstrates against the blocking of the road leading to the Palestinian Bedouin village of Khan Al-Ahmar in the occupied West Bank. (AFP)
4 / 10
Israeli forces are confronted by Palestinian protesters on September 14, 2018, as they demonstrate against the blocking of the road leading to the Palestinian Bedouin village of Khan Al-Ahmar in the occupied West Bank. (AFP)
Israeli forces are confronted by a Palestinian protester on September 14, 2018, as he demonstrates against the blocking of the road leading to the Palestinian Bedouin village of Khan Al-Ahmar in the occupied West Bank. (AFP)
7 / 10
A Palestinian protester confronts Israeli forces on September 14, 2018, as he demonstrates against the blocking of the road leading to the Palestinian Bedouin village of Khan Al-Ahmar in the occupied West Bank. (AFP)
8 / 10
A Palestinian protester confronts Israeli forces on September 14, 2018, as he demonstrates against the blocking of the road leading to the Palestinian Bedouin village of Khan Al-Ahmar in the occupied West Bank. (AFP)
9 / 10
Israeli forces are confronted by a Palestinian protester on September 14, 2018, as he demonstrates against the blocking of the road leading to the Palestinian Bedouin village of Khan Al-Ahmar in the occupied West Bank. (AFP)
10 / 10
Protesters and activists block an Israeli army bulldozer at the West Bank Bedouin community of Khan Al-Ahmar, Friday, Sept. 14, 2018. (AP)
Scuffles at West Bank Bedouin village slated for demolition
Updated 14 September 2018
AFP
September 14, 2018 13:43
0
KHAN AL-AHMAR, Palestinian Territories: Scuffles broke out between Israeli forces and dozens of pro-Palestinian activists Friday at a village slated for demolition in the occupied West Bank.
An Israeli bulldozer sought to close off a route to the Bedouin village of Khan Al-Ahmar by dumping rocks and earth on it, sparking a protest that led to small clashes.
Three people were arrested, a police spokesman said.
Activists said among them was a French law professor, Frank Romano, but the police did not confirm his arrest.
The village of roughly 200 people is at risk of being demolished at any time, despite fierce criticism from key European nations.
On September 5, Israel’s supreme court upheld an order to raze the village on grounds that it was built without the proper permits.
It is extremely rare for Palestinians to be given Israeli permits to build in Area C of the West Bank, where Khan Al-Ahmar is situated.
The village is located in a strategic spot near Israeli settlements and along a road leading to the Dead Sea.
There have been warnings that continued settlement construction in the area could eventually divide the West Bank in two and cut it off from Jerusalem, dealing a death blow to any remaining hopes of a two-state solution.
Ethnic Tubus fear southern Libya offensive
OUBARI: In the southern Libyan city of Oubari, shops are shuttered and tension is palpable, as residents fear an imminent incursion by forces loyal to strongman Khalifa Haftar.
We “dread the repercussions of military operations that are unfolding on the edge of town,” said 22-year-old hospital administrator Ali Senoussi, speaking on behalf of his Tubu community.
Many residents in Oubari — some 900 kilometers (560 miles) south of Tripoli — are Tubu.
The ethnic group fears vengeance by Arab communities that have joined an offensive by Haftar’s self-styled Libyan National Army (LNA), which is on the outskirts of the city.
Long marginalized, Tubus live in the Tibesti region, which straddles Libya, Chad and Niger, an area long at the mercy of roaming rebel groups, traffickers and extremists.
“We are residents of this region. Our support and love for it is immense,” said 22-year-old Senoussi, clothed in a traditional head robe to screen desert sun and wind.
“We cannot accept being involved in wars with Arab tribes that fight alongside Haftar,” he insisted, sipping tea in the courtyard of a hospital where he works as an administrator.
The LNA says it is seeking to purge “terrorist and criminal groups,” and some accuse the Tubus of supporting Chadian rebels.
But Senoussi dismisses the offensive as “a threat to the social peace of the whole region.”
Tubu lawmakers even allege that ethnic cleansing is under way.
The community was among the first to join the 2011 uprising that ousted and killed Muammar Qaddafi.
But the former dictator’s downfall by no means improved Tubus’ standing in Libya.
Despite being home to some of the country’s biggest oilfields, the region is regularly hit by shortages of all kinds — petrol, electricity, gas cylinders and even bread.
Prices have rocketed on the black market.
Senoussi said the lack of fuel had forced him to leave his car at home and walk to work.
“Most public sector workers prefer to walk” to avoid long queues that have become a fixture of daily life at gas stations, he said.
The intensified chaos of recent years means that the southern border areas are more than ever a haven for extremists, traffickers and rebels.
These groups exploit a security vacuum that is exacerbated by an ongoing power struggle between a UN-backed Government of National Accord in Tripoli and a rival administration loyal to Haftar in northeastern Libya.
Tribal and ethnic quarrels between the Tubus, Tuaregs and Arab groups over trafficking have added fuel to the fire.
“We are Muslims, but we have a culture and language that we share with our cousins from Chad, Niger and Sudan,” explained Ali Yahyia, a Tubu expert on his community.
But this does not undermine “our support for the Libyan homeland,” he insisted.
The LNA launched its ongoing military campaign in mid-January and on Wednesday night entered Murzuk, another southern Libyan city home to many Tubus.
Renowned for a fortress that dates back more than seven centuries, much of the historic settlement now resembles a ghost town.
Murzuk’s windswept streets are littered with garbage.
Like Oubari, shops are closed and people are scared to circulate.
Even bakers — hit by a lack of flour — cannot raise their blinds.
“The city faces numerous problems at the service level, particularly at the hospital where we have only one doctor,” deplored municipal councillor Ibrahim Omar.
“With the military operations that are ongoing, the doctors refuse to come, fearing for their lives,” he said.
If the situation persists, “food stocks will in the end be exhausted.” |
По указу президента непризнанной республики сборы объявлены якобы в миротворческий контингент на один месяц
Президент непризнанного Приднестровья Евгений Шевчук объявил о призыве всех военнообязанных граждан региона, пребывающих в запасе и являющихся сотрудниками органов государственной власти региона, сообщает Укринформ.
"Министерству обороны осуществить призыв военнообязанных граждан Приднестровской Молдавской Республики, пребывающих в запасе и являющихся сотрудниками органов государственной власти, на специальные сборы в военный контингент миротворческих сил сроком на один месяц", - говорится в указе лидера Приднестровья.
По официальной информации, целью сборов является якобы совершенствование боевой подготовки воинских частей и комплектование военного контингента миротворческих сил.
Напомним, на протяжении последних нескольких месяцев на территории Приднестровья проводились многочисленные военные учения.
Сегодня стало известно, что в России начались военные учения, которые проходят по сценарию ядерной войны.
Если Вы заметили орфографическую ошибку, выделите её мышью и нажмите Ctrl+Enter. |
use core::pin::Pin;
use core::future::Future;
use crate::stream::Stream;
/// Trait to represent types that can be created by multiplying the elements of a stream.
///
/// This trait is used to implement the [`product`] method on streams. Types which
/// implement the trait can be generated by the [`product`] method. Like
/// [`FromStream`] this trait should rarely be called directly and instead
/// interacted with through [`Stream::product`].
///
/// [`product`]: trait.Product.html#tymethod.product
/// [`FromStream`]: trait.FromStream.html
/// [`Stream::product`]: trait.Stream.html#method.product
#[cfg(feature = "unstable")]
#[cfg_attr(feature = "docs", doc(cfg(unstable)))]
pub trait Product<A = Self>: Sized {
/// Method which takes a stream and generates `Self` from the elements by
/// multiplying the items.
fn product<'a, S>(stream: S) -> Pin<Box<dyn Future<Output = Self> + 'a>>
where
S: Stream<Item = A> + 'a;
}
use core::ops::Mul;
use core::num::Wrapping;
use crate::stream::stream::StreamExt;
macro_rules! integer_product {
(@impls $one: expr, $($a:ty)*) => ($(
impl Product for $a {
fn product<'a, S>(stream: S) -> Pin<Box<dyn Future<Output = Self>+ 'a>>
where
S: Stream<Item = $a> + 'a,
{
Box::pin(async move { stream.fold($one, Mul::mul).await } )
}
}
impl<'a> Product<&'a $a> for $a {
fn product<'b, S>(stream: S) -> Pin<Box<dyn Future<Output = Self> + 'b>>
where
S: Stream<Item = &'a $a> + 'b,
{
Box::pin(async move { stream.fold($one, Mul::mul).await } )
}
}
)*);
($($a:ty)*) => (
integer_product!(@impls 1, $($a)*);
integer_product!(@impls Wrapping(1), $(Wrapping<$a>)*);
);
}
macro_rules! float_product {
($($a:ty)*) => ($(
impl Product for $a {
fn product<'a, S>(stream: S) -> Pin<Box<dyn Future<Output = Self>+ 'a>>
where S: Stream<Item = $a> + 'a,
{
Box::pin(async move { stream.fold(1.0, |a, b| a * b).await } )
}
}
impl<'a> Product<&'a $a> for $a {
fn product<'b, S>(stream: S) -> Pin<Box<dyn Future<Output = Self>+ 'b>>
where S: Stream<Item = &'a $a> + 'b,
{
Box::pin(async move { stream.fold(1.0, |a, b| a * b).await } )
}
}
)*);
($($a:ty)*) => (
float_product!($($a)*);
float_product!($(Wrapping<$a>)*);
);
}
integer_product!{ i8 i16 i32 i64 i128 isize u8 u16 u32 u64 u128 usize }
float_product!{ f32 f64 }
|
Investigating the pros and cons of browns gas and varying EGR on combustion, performance, and emission characteristics of diesel engine.
The significance of mileage to the fruitful operation of a trucking organization cannot be downplayed. Fuel is one of the biggest variable expenses in a trucking wander. An attempt is made in this research to improve the combustion efficiency of a diesel engine for better fuel economy by introducing hydroxy gas which is also called browns gas or HHO gas in the suction line, without compromising performance and emission. Brown's gas facilitates the air-fuel mixture to ignite faster and efficient combustion. By considering safety and handling issues in automobiles, HHO gas generation by electrolysis of water in the presence of sodium bicarbonate electrolytes (NaHCO3) and usage was explored in this research work over compressed pure hydrogen, due to generation and capacity of immaculate hydrogen as of now confines the application in diesel engine operation. Brown's gas was utilized as a supplementary fuel in a single-cylinder, four-stroke compression ignition (CI) engine. Experiments were carried out on a constant speed engine at 1500 rpm, result shows at constant HHO flow rate of 0.73 liter per minute (LPM), brake specific fuel consumption (BSFC) decreases by 7% at idle load to 16% at full load, and increases brake thermal efficiency (BTE) by 8.9% at minimum load to 19.7% at full load. In the dual fuel (diesel +HHO) operation, CO emissions decreases by 19.4, 64.3, and 34.6% at 25, 50, and 75% load, respectively, and unburned hydrocarbon (UHC) emissions decreased by 11.3% at minimum load to 33.5% at maximum load at the expense of NOx emission increases by 1.79% at 75% load and 1.76% at full load than neat diesel operation. The negative impact of an increase in NOx is reduced by adding EGR. It was evidenced in this experimental work that the use of Brown's gas with EGR in the dual fuel mode in a diesel engine improves the fuel efficiency, performance, and reduces the exhaust emissions. |
Monday, December 24, 2012
Here is wishing you all a very Merry Christmas and a happy and prosperous New Year in 2013 !!
It's been a long time since I posted on my blog and it has been sadly neglected. The gap has been caused by major re-furbishments to my home which caused havoc. I still can't find most of my craft stuff .......... it is all there but in a mish-mash of boxes etc. I will get this sorted in the New Year and I very much need my craft fix again as I have really missed it.
This little 6 x 3 inch shadow box and stand is made from chipboard and contains no stamping at all.
Papers used are from Prima (North Country 6 x 6 stack), trimmed and applied in the compartments as shown. The box was given a couple of coats of bronze acrylic paint beforehand.
Various embellishmnets were added to give a bit of dimension, some stickers, a brad and metal charms.
Some maroon gingham ribbon was added around the box and some ice Stickles added around the front edges.
Sunday, July 08, 2012
Here is a little card I made using some digi papers from Cosmo Cricket, some diecuts and a bit of stamping and spraying.
The background was printed, trimmed and stuck in place. I used dies to cut the two oval mats. One in Brown and one with a pear design. These were layered directly onto the card.
The pear stamp (A Stamp In The Hand) was stamped in Archival sepia ink and trimmed out, then coloured with a lime green alcohol ink pen. This was mounted on foam pads. The flower was made from printed cardstock which was die-cut using my Cricut and once assembled was sprayed with Green Dylusions spray. This was stuck in place at the top of the card.
The mini tag was diecut and stamped with Papertrey Inc stamps and dies. This was also mounted on foam pads after applying a brad. before colouring with the lime green alcohol ink pen.
The two flourishes were also die cut with a Sizzix die and stuck in place as shown. Because of the dimension of the flower the card will be packed into a box. I have entered this into the Simon Says Challenge too !
Monday, July 02, 2012
She does look a little hot and is being fanned to cool her down ............... hence the title !
Here is an sandwich board card I made where the inside picture hangs and swings freely between the front and back of the card. The base is Kraft and the inside has been trimmed down with the top die-cut with a sizzix border die. This has been passed through an aperture cut with a craft knife at the top of the card.
The front and inside is decorated with papers from Pion and the front panel was trimmed and the paper applied before passing through the sizzix with a Nestie die to make the aperture.
The 'adore' stamp is from Papertrey and the pink velvet ribbon has been threaded through some rose pink eyelets and tied in a bow. The HOT is rub-ons. The butterfly has been held in place with a rose brad. Some pink Stickles glitter glue has been added to finish the card.
Sunday, July 01, 2012
Seeing as we seem to already have had our Summer in the UK, here is a card I have made to remind us of what it can be like.
The card base was made from white textured cardstock and when scored and folded measures 17 x 17 cm.
The central frame and corners are die-cuts out of a printed paper by Kaisercraft.
The central panel and text sentiment are from a set of seasons stamps by Beth Hughes. Once stamped on cream card in Memento tuxedo black, the frame was coloured with Marvey alcohol brushmarkers and all elements were stuck in place with a glue pen.
Sunday, June 24, 2012
Here is a little gift bag I have made to house a little gift for a friend. It's not often that I do anything without stamping but this one definately does not have any.
I have used my Cricut Expression to cut a box from some pretty printed card using the Bags, Tags, Boxes & More cartridge. The cutout was then assembled into the bag with sticky glue. The edges were gone over with yellow ochre chalk ink.
I have then cut out a few layers of several of the same flowers from a piece of matching printed paper and edged these with Copic marker before applying over the bag and securing with small yellow brads.
The little gift was surrounded by pale pink crumpled tissue and placed in the bag and a piece of pink stitched grosgrain ribbon tied round the handle.
Monday, June 18, 2012
A short while ago I bought a bead loom as I had been meaning to have a go at bead weaving. This one uses four colours and is 13 beads across in a traditional American indian design. The beads used in this piece are a bit large but for a first attempt I liked the design and the colours. I think I will incorporate this into a card design as an embellishment going forward.
I intend using some smaller more even seed beads to do a more complex design next.
Sunday, June 17, 2012
Hasn't the weather in the UK been horrible lately ........... hardly Summer in my opinion ! This creation hopefully will bring a little colour into these dull and wet days we are experiencing at this time.
This is a postcard (6 inches x 4 inches) made from mountboard as part of a monthly swap at UK Stampers Forum. This months theme is 'In The Air' so I have loosely interpreted the theme in my creation. The card was trimmed to size and coloured with Ranger Dylusions sprays in vibrant turquoise, pure sunshine and cut grass. These were dried with a heat gun.
Next the pennant stamp (Lynne Perrella - PaperArtsy) was stamped top left with Archival black ink. The background was also grunged with spot and fleck stamps in Ultramarine Impress ink.
A Marriane diecut was used to cut a garland from white paper and this was trimmed and was added in a couple of places as shown. A Cuttlebug cut'n'emboss folder was used to diecut the hand from dark green paper. This was sprayed with black spray ink, blotted and rubbed over with the black Archival ink to highlight the relief.
The words were half printed and half hand-written in Posca and the same pens were used to edge and highlight the images on the card. The card has to travel to its recipient 'naked' in the post. I have sealed it with a light spray of cheap hair lacquer.
Saturday, June 02, 2012
Here is a card I have made recently incorporating the colours of turquoise and orange. The card measure 15 x 15cm and is made from stout white card. The card has been covered on the front with a piece of digital backing paper with an abstract orange/blue colourway. It is available in my Etsy store.
The mat has been made from turquoise linen effect card and has been punched with Martha Stewart around the page punches. A piece of narrow orange grosgrain ribbon has then been threaded through the edging and tied in a bow at one corner before mounting onto the card.
The girls face has been stamped with Memento black ink, cut out with a circular die and then coloured with alcohol ink brush markers. The orange dots have been added using a Sakura Aqualip pen. The image has been added in the centre with foam pads to add relief.
Sunday, May 27, 2012
Gorgeous sunny day here in Manchester UK so to bring a little sunshine into your life if you are not getting any sun here is another 15 x 15 cm cute card handcrafted from me featuring 'Warren' the bunny. This time he is offering the birthday present of 'Carrots' ....... well I suppose for a rabbit that's appropriate. He has been coloured with Copic markers. The card is available HERE in my Etsy store if you would like to own it.
He is layered onto an embossed die-cut frame over some candy striped card with a sparkle.
The card is embellished with a lime green grosgrain ribbon and bow.
Some lime green pearls have been added along the bottom of the card to finish.
Sunday, May 06, 2012
These two unique, hand-made collaged ATC's are now available in a framed version in my Etsy store. There will be a series of framed ATC's in the store going forward and I am happy to make you a custom version if you wish, just click the link to Etsy on the right of my blog or on this post to view what is in offer. Thanks so much for looking ......... and hope you like what you see.
Saturday, May 05, 2012
Here is a 3D postcard measuring 6 x 4 inches. This one would be very challenged going through the post without losing some of its components in transit so this was done as part of a swap over on UK Stampers where we could send our dimensional postcards in an envelope or padded bag to preserve their art through the post.
The background is of teal stained wood and is a digital print I have applied some Viva gold paint in splodges to the background also on the left. This has been embellished with some black chipboard frames with inchies behind. I have also done some flourish stamping in Memento tuxedo black.
The flourishes are die-cut using a Sizzix die and these have been edged with a black fineliner pen. I have also used some moss green floral Washi tape, gold Posca pen and some gorgeous green flat backed cabochons. Finishing touches were to add some Versamagic chalk ink in touch of pesto around the edge and some faux stitches.
About Me
I'm a crafty fella living in Manchester U.K.
I love nothing better than to escape into my very untidy craftroom and mess around with stamps, inks , paint, fabric & anything else that's crafty for that matter!
My Blog
A big warm welcome to 'Harpies Crafty Corner' which is a space to show and share my crafty creations and techniques. Hope your visit has been worthwhile and that you may have been inspired ! Please leave a comment, join my blog and most of all ....... enjoy !! Some of my creations can be bought in my Etsy Store. I look forward to seeing you again soon. |
Tuesday, 21 February 2012
Red Rose Tea
Share the Warmth is back! http://www.redrosetea.ca/sharethewarmth/
By clicking “Share The Warmth” below, you’ll be donating a pot of tea+ to a registered Canadian charity (limit 1 donation per computer). Plus, you’ll receive a Buy One, Get One Free coupon, redeemable for any Red Rose tea product! |
Planning Committee
Accreditation Review
Dr. Pamela Snow
The Office of Professional Development (OPD), Faculty of Medicine, Memorial University, is fully accredited by the Committee on Accreditation of Continuing Medical Education (CACME), a subcommittee of the Committee on Accreditation of Canadian Medical Schools (CACMS). This standard allows OPD to assign credits for educational activities based on the criteria established by The College of Family Physicians of Canada, and the Royal College of Physicians and Surgeons of Canada. |
Q:
How to position a div with equal margins for left, right, and top
I would like to achieve a layout that looks like this:
I am interested in a css/html only solution, so no javascript required.
The widths of both divs are dynamic, so I cannot use any static margins.
The spacing between the sides of the divs, and the top, should be the same.
I tried using margin: auto auto 0 auto on the inner div, as you can see in this jsfiddle, but it only works for left and right.
A:
Note, the following attempt doesn't answer the question fully, since the width of the child cannot be dynamic.
The idea is to use a percentage width + percentage margin-top values on the child. It's a responsive layout, see the comments in the code, and try it out on different window sizes.
JSFiddle: http://jsfiddle.net/jkoycs6e/
body {
margin: 0;
}
.outer {
height: 100vh; /*for demo only*/
background: teal;
overflow: auto;
}
.inner {
width: 80%;
background: gold;
margin: auto;
margin-top: 10%; /* 100%-80%/2 */
}
<div class="outer">
<div class="inner">
hello<br/>hello<br/>hello
</div>
</div>
A:
This is not possible. At least not without using javascript. There is no css-only solution.
|
Methicillin-resistant Staphylococcus aureus in food and the prevalence in Brazil: a review.
Foodborne diseases (FBD) occur worldwide and affect a large part of the population, being a cause of international concern among health authorities. Staphylococcus aureus can be transmitted by contaminated food, and it is one of the pathogens that most cause foodborne outbreaks in Brazil. Currently, this organism's ability in developing resistance to antibiotics is notorious; methicillin-resistant Staphylococcus aureus-MRSA-is known for its resistance to methicillin, oxacillin, and others. MRSA is one of the leading causes of infections, becoming a major threat to human health worldwide due to the numerous toxins that can produce. At first, the transmission of MRSA occurred in clinical environments; but in recent decades, its presence has been reported in the community, outside the hospital environment, including food and food-producing animals around the world. In this review, information about MRSA was gathered to verify MRSA incidence in the world but especially in Brazil in food samples, food handlers, food-producing animals, and food processing environments. The studies show that MRSA is easily found and in certain cases with high frequency, thus representing a potential risk to public health. |
Computerized decision support: beyond expert systems.
While expert systems hold great promise for decision support, currently available software packages, called decision-modelling programs, provide clinicians with analytical assistance for resolving difficult decisions. This paper describes the two general classes of computerized decision-modelling programs (decision tree analysis and multiple criteria models), and illustrates the descriptions with examples of commercially available packages. Decision tree analysis is useful when the selection of a present action (for example, a treatment) depends on some outcome in the future (i.e. the occurrence of side effects). Multiple criteria models help clinicians when the choice of action depends on satisfying many criteria simultaneously. |
Q:
Reuse anonymous variable within select statement
db.opt.Select(z => new {
z.QuestionTitle,
Count = z.Responces.Where(x => x.Responseval == Constants.options.Agree).Count(),
Perc = (totresponcecount/Count)*100
}).ToList();
In the above lambda, while calculating percentage for eg I want to write (totresponcecount/Count)*100 where Count is already calculated in above statement.
So how can I access Count value to write Perc = (totresponcecount/Count)*100?
A:
I think in this case query syntax is nicer using the let keyword:
var result = from z in db.opt
let count = z.Responces.Count(x => x.Responseval == Constants.options.Agree)
select new { z.QuestionTitle, count , Perc = (totresponcecount/count) * 100 };
Also notice that you can pass a predicate to the Count method so no need for Where(...).Count().
A:
I would advise to use one more select statement to save this variable:
db
.opt
.Select(z => new
{
z.QuestionTitle,
Count = z.Responces.Where(x => x.Responseval == Constants.options.Agree).Count()
})
.Select(z => new
{
z.QuestionTitle,
z.Count,
Perc = (totresponcecount / z.Count) * 100
})
.ToList();
|
The origins of the European Union lie in an attempt to solve the age-old problem of destructive German-French rivalry, which had drawn the old continent in numerous wars over the past hundred years or so, including the Franco-Prussian War, World War I and World War II. But time has marched on, and a much greater threat today is recrudescent Islam, now assaulting Europe in the guise of the “migrant” crisis.
So what if the EU falls apart?
The European Union is in danger of breaking apart unless France and Germany, in particular, work harder to stimulate growth and employment and heed citizens’ concerns, French Prime Minister Manuel Valls said in the German capital on Thursday. Valls said the two countries, for decades the axis around which the EU revolved, had to help refocus the bloc to tackle an immigration crisis, a lack of solidarity between member states, Britain’s looming exit, and terrorism. “Europe is in danger of falling apart,” Valls said at an event organized by the Sueddeutsche Zeitung newspaper. “So Germany and France have a huge responsibility.” He said France must continue to open up its economy, not least by cutting corporate taxation, while Germany and the EU as a whole must increase investment that would stimulate growth and job creation, as well as boosting defense.
Valls is one of the many reasons Marine Le Pen is likely to be the next president of la belle France: economic issues are not in the forefront of anyone’s mind at the moment, not with continued Muslim “immigration” — invasion is the proper term — and its attendant rape epidemics, crime, filth, disease, inbreeding and cultural hostility.
Further, Europe cannot solve its economic problems without factoring in just how much Mutti Merkel’s folly is going to cost in the long run.
Immigration was one of the main drivers of Britons’ vote to leave the EU, and Valls said the bloc, which more than a million migrants entered last year, had to regain control of its borders. He said the Brexit vote and Donald Trump’s election victory showed how important it was to listen to angry citizens, and that politicians scared of making decisions were opening the door to populists and demagogues. In France, opinion polls suggest that the far-right, anti-EU, anti-immigration National Front leader Marine Le Pen will win the first round of the presidential election next April, before losing the runoff. But Valls said Trump’s victory had boosted the chance of an outright Le Pen victory: “What has changed in the world and Europe since Nov. 8 is that it’s possible.”
Excellent. |
Seventh Generation Products
Committed to natural cleaning
One of the country's first self-declared "socially responsible" companies, Seventh Generation is 20-year-old business whose name is derived from the Great Law of the Iroquois, which states, "In our every deliberation, we must consider the impact of our decisions on the next seven generations." Every time you use Seventh Generation products, you're making a difference by saving natural resources, reducing pollution, keeping toxic chemicals out of the environment and making the world a safer place for this and the next seven generations.
Top-to-bottom product offering
Seventh Generation offers a complete line of non-toxic household products for natural cleaning, including chlorine-free recycled paper towels, toilet paper and napkins, non-toxic dish and laundry detergents, recycled plastic bags and chlorine-free diapers. Seventh Generation has the products you need to keep your house clean from top to bottom.
Seventh Generation is aware that your home is your world. It's their mission to help you protect your world with safe and effective household products. Seventh Generation hopes to inspire a more conscious and sustainable world by being an authentic force for positive change.
Join the Seventh Generation nation by choosing environmentally responsible, non-toxic and natural cleaning products to care for your home and body.
The products and the claims made about specific products on or through this site have not been evaluated by Vitacost.com or the United States Food and Drug Administration and are not approved to diagnose, treat, cure or prevent disease. The information provided on this site is for informational purposes only and is not intended as a substitute for advice from your physician or other health care professional or any information contained on or in any product label or packaging. You should not use the information on this site for diagnosis or treatment of any health problem or for prescription of any medication or other treatment. You should consult with a healthcare professional before starting any diet, exercise or supplementation program, before taking any medication, or if you have or suspect you might have a health problem.
Not responsible for typographical errors or misprints. Product availability, pricing, and promotions are subject to change without notice. |
[Imaging of chronic and intermittent adult upper urinary tract obstruction].
State-of-the-art analysis of non invasive diagnostic imaging techniques to demonstrate upper urinary tract obstruction. Advances in imaging techniques are illustrated (sonography, CT scan, MRI). The imaging features of different presentations of chronic and intermittent obstruction are described with reference to current imaging modalities. New strategies for evaluation of chronic and intermittent upper urinary tract obstruction are proposed using ultrasonography as the first line examination. The role of MRI is illustrated. Causes of obstruction are classified based from the intraluminal, parietal or extrinsic location of the lesion. |
2006 Accord Length
Posted by Janell A. Bueno in 2006
2006 Accord Length. welcome to my blog here I will show you a little more what you are looking for 2006 Accord Length below there are some photos and a little about 2006 Accord Length that you can see and read, hopefully in accordance with what you are looking for. |
The impact of pharyngeal fat tissue on the pathogenesis of obstructive sleep apnea.
Obesity is the most important risk factor for obstructive sleep apnea (OSA); however, the exact underlying mechanisms are still not fully understood. The aim of this study was to examine the morphology of upper airways in overweight habitual snorers and in mild OSA patients. Furthermore, the associations between weight loss, parapharyngeal fat pad area and OSA were assessed in a 1-year randomised, controlled follow-up study originally conducted to determine the effects of lifestyle changes with weight reduction as a treatment of OSA. Thirty-six overweight adult patients with mild OSA [apnea-hypopnea index (AHI) 5-15 events/h] and 24 weight-matched habitual snorers (AHI < 5 events/h) were included in the study. All patients underwent nocturnal cardiorespiratory recordings and multislice computed tomography (CT) of parapharyngeal fat pad area, the smallest diameter and area in naso-, oro- and hypopharynx, the smallest diameter and area of the whole pharyngeal airway, the distance from the hyoid bone to the mandibular plane and to cervical tangent as well as the distance between mandibular symphysis and cervical spine. In addition, OSA patients were further randomised to receive either an active 1-year lifestyle intervention with an early weight loss programme or routine lifestyle counselling. After 1 year, the cardiorespiratory recordings and CT scans were repeated. The pharyngeal fat pad area was significantly larger, and the distance from the hyoid bone to cervical spine was longer in patients with OSA than in habitual snorers (p = 0.002 and p = 0.018, respectively). The multiple regression analysis showed that besides a large pharyngeal fat pad area and a long distance from the cervical spine to hyoid bone, also a short distance from the mandibular symphysis to cervical tangent increased a risk to OSA. During the 1-year follow-up in OSA patients, the pharyngeal fat pad area and AHI decreased significantly in the intervention group (p = 0.003 and p < 0.001, respectively). In the early stages of OSA, the pharyngeal fat pad seems to play an important role in the development of disease in overweight patients. Furthermore, weight reduction by lifestyle intervention-based programme reduces both central obesity and pharyngeal fat pads, resulting in an improvement of OSA. |
The Dissertation
The Dissertation for an MA TESL is a substantial (15 – 20,000 word) piece of academic writing in which you:
• Identify a clearly-focused topic and develop it in a coherent and rational way.
• Show a deep awareness and appreciation of other academic work done in the area, and have a point of view on it.
• Demonstrate the ability to reflect critically on the area you explore.
• Show you are able to collect, analyse and interpret data (although a theoretical study is also possible)
• Show you are aware of the implications of your findings, often but not necessarily for professional contexts.
• Say something new.
It normally involves a small-scale study but can be literature-based, written predominantly as a result of reading and thinking. Universities prefer dissertations in MA TESLs to have an applied perspective, wherever possible. Dissertations should show in-depth acquaintance with the literature of the subject area, but should also be a vehicle for the expression of personal views. The study should relate to a particular context and should draw on your professional experience; the application may be to the classroom, but this is not compulsory. For instance, a sociolinguistic investigation may have a wider application for a group of learners in a particular society. An SLA investigation could relate to a naturalistic setting, for example, a study of early child bilingualism. In each case, there may be implications for ELT. You are expected to link theory to practical implications in a manner that is appropriate to your study.
Presentation
The dissertation should be written in clear, accurate language; give appropriate references to sources used whenever relevant; and contain a full Reference Section of publications cited. All universities expect that you will make every effort to submit a work that has undergone thorough proof-reading. A dissertation with a significant number of surface errors would not be accepted and would be referred back to you for re-submission.
General features of presentation
Here are the general requirements for an MA Deissertation:
• Word-length: 15-20,000 words (not including appendices and bibliography). You must stay within this word range, not less, not more.
• There must be double spacing between lines.
• Margins: each page should have a left-hand margin of at least 35mm and margins at head, foot and right-hand side, of at least 15mm.
• Pages must be numbered.
• The title page should state: The University; the name of the degree;; the title of the assignment; the date of submission; your name.
• Abstract: not more than 500 words, after the title page.
• A Table of Contents with page numbers at the beginning. It should include Chapter headings and numbered sections and sub-sections.
• References should follow the Harvard System and start on a fresh page following the end of the main text and precede any appendices.
• Each Appendix should begin on a new page.
Shape of the dissertation
Chapter 1: Introduction (there is no ‘Introduction’ before Chapter 1. Chapter 1 is the introduction!).
Length: 1,000 to 1,500 words.
This will say what the topic is, why you became interested in researching it, and discuss the nature of the issue or problem that the dissertation deals with. A brief description of the context of the study is usually appropriate. The research questions should also be introduced at this point. Finally, you outline the structure of the dissertation.
Chapter 2: Review of literature and theoretical framework.
Length: 5,000 to 6,000 Words
• Present, interpret and synthesise what has been published in the area of interest. Present the state of the art with regard to the topic.
• Review relevant material that already exists, identifying key work, key issues and key findings. This may involve an element of historical survey to show where we came from in the development of ideas and research.
• Show what areas of disagreement exist, and what we don’t know.
• Don’t write it in a way that suggests you are just listing things you have read about the topic: write it from your own point of view.
• It should lead up to your own study, such that it seems almost inevitable that your study needs to be done – because there is a gap in the literature, a problem that is still unresolved, or you suspect that previous research may not necessarily apply to the context of your study.
• So, at the end you will present a clear statement of the issues that your study needs to address. This is usually in the form of a research question or questions. In an experimental study this will take the form of one or more hypotheses and the null hypotheses.
Chapter 3: Research design, methods of data collection.
Length: up to 2,000 words.
Here you describe what data you will collect, what research tools you will use and how it will enable you to address the research question(s). There must be a match between the theory, problem or issue, research question and research design. This means you have to say why you chosen the research design you use, how it will allow you to get the data you need, how you analyse that data in order to answer the research questions, what steps you take to make sure the data is valid and reliable, or authentic and trustworthy, and how you have met ethical concerns.
Chapter 4: Presentation of findings and interpretation.
Length: 7 to 9,000 words.
In the scientific tradition associated with experimental designs it is common to simply present results first, and then interpret (discuss) them in the next chapter or section.
In qualitative research it is often preferable not to present results in a list form (for example, what the answers were to question 1,2,3.. of a questionnaire, or to questions 1,2,3.. of interviews), but to synthesise the results in your own mind first, so that what you write is a presentation of themes or patterns that have emerged from the data.
Discussion of the ‘meaning’ of the results can be done at the same time. This is essentially a ‘truth claim’: “this is what I know to be true”
Chapter 5: Implications, applications, limitations and conclusion
Length: 1,000 to 1,500 words.
Here you present the implications of the findings.
• Revisit the research question(s) you presented in chapter 1 or 2, and say how well you have been able to answer it/them. Evaluate the achievement of the dissertation.
• Say what the implications of the study outcomes are for the world outside the study, but also what you cannot claim. Say what both the personal and professional outcomes were.
• Say what you were not able to establish, and state the limits of generalisability of the findings. Say what you did wrong – or could have done better – or what went wrong, and what you wouldn’t do that way again if you had the chance. It is better to be honest and show you know what the shortcomings are, than to pretend everything is wonderful.
• Identify what work could be or needs to be done next.
Chapter 6: Conclusion.
For information about citations and references:
1. See the “Organising an MA paper” in the Articles section of this website.
2. See also the suggestions in the Links Section. The Purdue OWL website is highly recommended.
For information on the Literature Review:
1. See the 3 articles in the Articles section.
2. See the video “Writing a Literature Review” in the Video section.
For information about doing a study and research methods:
1. See the Articles sections for a number of articles in the first group.
A literature review is an examination of the research that has been conducted in a particular field of study. It should include a selection of articles and extracts from books which contain information, ideas, data and evidence relevant to your study. Your selection should be informed by the topic of your dissertation. The Review should include an evaluation of the work selected as it applies to the study that your dissertation includes.
The aim of the Literature Review is to demonstrate your knowledge of the field and to identify either the ‘gap’ in the research that your study is attempting to address, or your atempt to replicate an existing study, because you either doubt its findings or want to suppport them. The literature review should also attempt to synthesise the work discussed and to give a justification for your study.
The kicker here is to focus. While you might read very widely, when it comes to the lit. review, you need to concentrate very carefully on relevant sources and narrow down the scope of your reading.
And here’s the most important thing of all: You can’t write the lit. review until you’ve articulated your research questions. Don’t even start it until you have your research questions clearly written and approved by your tutor.
Once you’ve got your research questions, start reading articles and (parts of) books which seem relevant. Do NOT chase down blind tracks: focus! When I was doing my dissertation, I thought at one point that I’d have to go back and read Hegel. If you’ve ever picked up Hegel’s Phenomology of Spirit and read the opening page, you’ll know that it’s not just daunting, it’s baffling. So don’t go there! Avoid distractions – you can always go back and read something you discounted if it’s really necessary. Drive on: keep focused.
There are millions of ways of taking notes, but the important thing is, one way or another, to keep careful track of the articles and books you think you might use. There’s software that will help you do this like EndNote (http://www.endnote.com), or you may prefer to use a notebook, stick-its, whatever.
After a while, you have to establish which literature is most pertinent to your review and start planning the review. Get some sense of the overall organisation of your literature review, maybe drawing diagrams of how the literature fits together.
Now here’s another kicker: your literature review can only be finished when your thesis is almost finished, because new research and publications might appear and anyway, your study will probably have changed. So, once you’ve got a rough draft of the lit. review, leave it and get on with othner bits of the dissertation. You will, I promise, have to come back to the review many times in order to add to and subtract from it and rewrite it a number of times.
Read the literature reviews in other theses and in published articles: see how they’re structured, see how they refer to sources and how they relate these sources to their own topic.
And then, of course there’s the structure of the lit. review where, once again, coherence and cohesion are the keys. Some models have been proposed:
* Chronological organisation: the discussion is ordered according to a historical or developmental context.
* The ‘Classic’ studies organisation: a discussion of the major writings regarded as significant in your area of study.
* Topical or thematic organisation: the discuusion is divided into sections representing the categories or conceptual subjects for your topic.
* Inverted pyramid organisation: the literature review begins with a discussion of the related literature from a broad perspective. It then deals with more and more specific or localised studies which focus increasingly on the specific question at hand.
None of these has any greater worth than any other. Do what you like, but make sure that your lit. review follows a clear, well-signalled path, that it tells a coherent and cohesive story which leads the reader easily through, and which never looses sight of the study your dissertation has at its heart.
And now, the most important bit of advice of them all: your lit. review must critically examine the articles and books that it refers to: it must not be just a summary or list of the sources you cite. One of the biggest faults that markers draw attention to in a poor paper is that the literature review is “too descriptive”. You are expected to comment on much of what youi cite, pointing out its strengths, weaknesses and omissions. Furthermore, everything you refer to must have a connection to your research topic and show how it relates to that topic. I’m being pretty fierce here; you can dally along the way a bit if it’s interesting enough, but the rules are strict! If you read anything by Kevin Gregg (just Google him) you’ll see that he often flouts all the rules, but he’s as near to a genius as we’ve got in AL, and he can do what he likes. Even so, you won’t find a more eloquent, coherent, cohesive, scholarly writer in the field. Every article he’s written is a jewel, including the one where he makes mincemeat of me (Gregg, K. (2005) A Response to Jordan…. Applied Linguistics, 26, 1, pp 121-124*).
Finally, tell the reader where you’re coming from. Make your own theoretical position clear from the start, and make your critical evaluations of the literature you discuss an integral part of this.
* Actually, while Kevin is right about my failure to deal properly with “explanation”, he’s wrong about theory construction. I’m trying to correct what I’ve said to date about explanation: see Jordan, G. Re-visiting Inference to the Best Explanation, in press. Well, in my head still, but I’ve signed a contract with Benjamins. 😦
For information on the Literature Review:
1. See the 3 articles in the Articles section.
2. See the video “Writing a Literature Review” in the Video section.
.
Doing a study for an MA in Applied Linguistics
1. Look at examples of good dissertations. All universities offer these, and don’t just stick to your own university’s examples. Look also at aticles published in the area you’re interested in and note how they are organised. Read the articles on research methods in the uni. course materials and those in the Articles sections here.
2. Choose a topic you’re really interested in, and good at. Look back at all you’ve done in previous modules and see if you can find a good topic. You can’t use material you’ve already used, but you can develop an area you’ve already covered.
3. Articulate 2 or 3 research questions that will inform your study. These research questions are vital and will inform your whole study. Do this as fast as you can. You can always go back and modify them, but they’re a necessary starting point. Make the research questions as focused and specific as possible.
Bad: How do different cultural norms affect the success of business meetings?
Good: How do German export managers feel about being asked personal questions in business meetings?
Bad: How does motivation affect language learning?
Good: How does Dörnyei’s construct of the “Ideal Self” contribute to an undertanding of L2 learners’ success rate in compulsory in-company language training programmes in the Santander bank?
3. Decide on your research tools. The most popular are questionnaires and interviews. Other good tools are templates for classroom observation, and personal journals.
4. Design your tools. If you’re doing a questionnaire see Dörnyei’s great talk in the Video section. Also see the articles on Likert scale questionnaires in the Articles section. If you do interviews, record them. See the article on Recording Interviews for ethnographic Research in the Articles section. If you keep a journal, make sure to write down all quotes and references.
7. Pilot your tools. This doesn’t have to be a big deal, but especially if you’re doing a questionnnaire, you need to weed out the “bad” bits – those that either invite a certain answer or aren’t clear.
8. Do it!
.
General Comments
In a study I commented on in a post about marking, the authors came to the “overwhelming conclusion” that what counted most were examiners’ first impressions. The initial impressions of the quality of the thesis are usually formed by the end of the second or third chapter of the thesis—often by the end of the literature review.
Characteristics of a poor thesis were:
• sloppiness;
• lack of coherence and cohesion;
• lack of understanding of the theory;
• mixed or confused theoretical and methodological perspectives;
• work that is not original;
• not being able to explain at the end of the thesis what had actually been argued in the thesis.
When asked to comment on what they thought set apart a ‘good’ thesis from the rest, a unifying responses was the use of the artistic metaphor. The use of the artistic metaphor extended to such terms as ‘elan’, ‘passion’, ‘excitement’ and ‘sparkle’. Clearly, these experienced examiners believed there was a level of ‘art’ involved in producing a particularly good thesis. For example, words and phrases such as the following were used to describe a good thesis:
• an artistic endeavour where the student is designing the work and there is elegance of design, of the synthesis, and executions;
• creativity;
• design—where it all fts together;
• elegant;
• a well-sculpted piece of work.
So, in brief, the authors’ research suggests the following:
Positive indicators:
• ‘sparkle, elan and sense of confidence with the material;
• cohesiveness and clarity;
• a student who makes the ideas his/her own, with some originality of presentation;
• professionalism—as demonstrated by mature comments, and the accuracy of the logic;
• style and sophistication;
• scholarship;
• the development of a well-structured argument.
Negative indicators
• sloppiness. Irritating things in the thesis such as typos and other careless textual mistakes that indicate a lack of attention to detail. Sloppiness in the text indicates sloppy research.
• poor references (“This is usually a sign of a poor thesis—the two go hand in hand”).
The final, substantive judgement is determined by:
• the student’s confidence and independence;
• a creative view of the topic;
• the structure of the argument;
• the coherence of theoretical and methodological perspectives; and
• evidence of critical self-assessment by the student.
Some tips for students:
* Check the guidebook or handbook to your course and find the section that deals with evaluation. Read it carefully and ask your tutor for clarification if necessary. The question is: What do the markers see as the difference between an “A” and a “C”?
* Markers of postgrad. papers are particularly fussed about citations and reference lists. Make sure your papers use the system expected in your university. Make the OWL site a Favorite and constantly check. http://owl.english.purdue.edu/owl/
* Pay special attention to coherence and cohesion. Make use of numbered sections and sub-sections and of cohesive advices which tell the reader where you’re going. Always include an overview in the Introduction. Tell a story. I know this is all very postmodern talk, but try to see your paper as a narrative which leads the reader through a tell-me-more beginning, a really meaty main argument, and a good resolution. If you like music, see your paper as a sonata: statement; development; recapitulation.
* Demonstrate enthusiasm.
* Avoid generalisations and make limited use of anecdotes. Support any claims you make with references. Don’t use too many secondary references.
* Focus. Don’t take on too much in one paper. A single main argument, supported by a lit. review and 4 main points is ideal for a normal MA paper. And focus is even more important in dissertations: it’s just so easy to wander down tempting blind alleys.
* Don’t limit your paper to description – there must be evidence of a critical evaluation of the matters you describe.
* Proofread your paper carefully and ask a friend or expert colleague to read it before you submit it.
Share this:
Like this:
10 thoughts on “The Dissertation”
Thanks for this! We have just submitted our last assignments and are now starting our dissertations, so I’ve shared this page with our entire cohort. Might leave a more detailed comment once I’ve consulted it a few times 🙂
All studies are theoretical to some extent – unless you make absolutely no attempts to explain or interpret any of the data you collect. Do you mean a dissertation where you discuss the theory or work of others and don’t actually do a study yourself? That’s an option in most masters, although over 90% of students do a study.
Lots of studies have been done in the field of applied linguistics on children – how they learn languages is obviously a huge field, including all sorts of theories and hypotheses about the putative critical period.
For your dissertation you need to begin with a research question or 2, and that will probably help you to decide what tools to use. You could observe them in an ethnographic embedded sort of way, doing things with them and keeping a diary, or you could record them with video or audio equipment and then look closely at the data collected that way, You can ask the children to do things, and also, of course you can ask them questions unless they’re VERY young – you could develop a questionnaire and then read the.questions to them, for example.
But start with a problem, something you’re curious to find out the answer to.
What information about triangulation do you need? Essentially, triangulation just means using more than 1 tool for doing a study (doing 1 questionnaire,with teachers, another one with their students, then doing follow-up interviews, for example) so as not to rely only on one set of data. If you Google the term, you’ll get thousands of hits, and there should be stuff on it in your course materials.
This entry made for good reading but I am going to be doing an MA dissertation (in March) on a topic that goes something like this: Alternative Womanhood in the writings of Simmoms-McDonald (and someone else which I have not narrowed it down too)… I do not see myself being able to use the format that you write about above….any ideas?
While most students base their dissertation on a study, some decide to do a critique (like the one you mention), create a programme or IT application, or put forward a new theory or hypothesis.
If no study is involved, then the outline of the paper will obviously be different. The diss. will begin with an Introduction: why you’re interested, how it fits modern concerns about blah blah blah, and an overview. Chapter 2 should put forward a summary of your main arguments: What is the central thesis of your paper? Maybe you will have a couple of research questions, or hypotheses, and, if not, you must have some very clear, interesting, well-focused argument that informs your discussion of these writers. The diss. cannot be “merely” an extended book review. Chapter 3 should be the literature review, and the rest of the dissertation will consist, in your case, of a description of the writing of Simmoms-McDonald and A.N. Other, followed by a critical evaluation of the writing. All of this (including Chapter 2) must be clearly linked to your main thesis. You finish with the usual chapters, Reference Section and Appendices. |
Motility and chemotaxis of Pseudomonas sp. B4 towards polychlorobiphenyls and chlorobenzoates.
The polychlorinated biphenyl (PCB)-degrading Pseudomonas sp. B4 was tested for its motility and ability to sense and respond to biphenyl, its chloroderivatives and chlorobenzoates in chemotaxis assays. Pseudomonas sp. B4 was attracted to biphenyl, PCBs and benzoate in swarm plate and capillary assays. Chemotaxis towards these compounds correlated with their use as carbon and energy sources. No chemotactic effect was observed in the presence of 2- and 3-chlorobenzoates. Furthermore, a toxic effect was observed when the microorganism was exposed to 3-chlorobenzoate. A nonmotile Pseudomonas sp. B4 transformant and Burkholderia xenovorans LB400, the laboratory model strain for PCB degradation, were both capable of growing in biphenyl as the sole carbon source, but showed a clear disadvantage to access the pollutants to be degraded, compared with the highly motile Pseudomonas sp. B4, stressing the importance of motility and chemotaxis in this environmental biodegradation. |
Q:
How to find a player's redstone clock (or other aggressive circuitry)?
I'm an admin for a minecraft server where I suspect one of the players has set up a fast cycle redstone circuit. The reason is the server uses what seems to me to be too high of cpu for only one or two players logged in, and lately there always seems to be a bit of lag.
I've found where he had built one before and he said that he wouldn't build one again, but knowing him, it's likely that he build one similar and not "exactly" like before.
So, are there any good ways to find where there is a redstone circuit like that, or better, is there a bukkit plugin that I can use to globally disable such circuits?
edit
Just to be clear, I'm not an op, I'm the full blown server admin (I pay for the VPS) lol. It's a windows server 2008 rc2 server so I have access to all files. It's currently running bukkit so that's why I would like to know about bukkit plugins that would make my life easier.
I did search for bukkit plugins but I couldn't find any "official" ones, which is why I asked for other unreleased or beta plugins. =)
A:
If you have access to the world file you can use a map editor/viewer to get a view of the map, and then do a filter just for redstone, overlay the second image and you will know where all the redstone is, it shouldn't take long to find the clock.
A:
There is now a Bukkit mod for detecting and teleporting to redstone clocks: the sensibly-named Redstone Clock Detector.
A:
If you don't have access to the world files or the server configuration, use a custom texture pack that makes all blocks except for the ones likely to be in the mechanism (e.g. redstone) semi-transparent. Then, it's a matter of walking around until you see it: even if it's underground.
You could do it fairly quickly by editing terrain.png in your own custom texture pack, but there are several texture packs that do the same thing (like, for example, Strongestcraft).
|
Q:
How to publish (or export) x86 and x64 C++ version of RDPWrap?
I am using RDP Wrapper Library by Stas'M to enable Remote Desktop Host support and concurrent RDP sessions on reduced functionality systems for home usage. But I'm having a hard time on creating x86 and x64 versions of it.
I am sure that it can be built on x86 and x64 version because it says so in the documentation.
Building the binaries:
• x86 Delphi version can be built with Embarcadero RAD Studio 2010
• x86/x64 C++ version can be built with Microsoft Visual Studio 2013
This is an open source application and it can be found here, I am using VS 2013.
By the way, I am familiar in VB.NET but not in Visual C++.
In VB.NET it is pretty easy to publish an application with the desired version (x86 or x64), I just need to
Creating the desired version to be publish
Click Build
Click Configuration Manager
Choose the desired version to be Publish
Then the publishing of the application
Click Build
Click Publish xxxx (<- name of my app.)
Follow the wizard
In Visual C++ it seems different? So my question is
How do I choose the version? Because it you take a look at the screnshot it doesn't have x64 and x86 version. Does Win32 correspond to 32 bit and x64 to 64 bit?
I can't find the Publish xxxx (<- wherein xxxx means app name), I'm not sure but maybe because this is visual c++ and it is different in vb.net?
A:
In the toolbar, clock on the little arrow and add the 2 entries Solution Configurations and Solution Platforms:
Now you can select the select the prefered platform (x86 or x64) via a combobox:
Now you can build it in the correct platform. You can also do a rightclick on the solution and select batch build to build several configurations the same time:
|
Live streaming will advance because of a growing demand for 'real-time' information
Email a friend
To
From
Thank you
Your message has been sent.
Sorry
There was an error emailing this page.
Diamond Reynolds, at a Black Lives Matter demonstration in front of the Minnesota Governor's Mansion in St. Paul, weeps after she recounts the incident that led to the fatal shooting of her boyfriend, Philando Castile, by Minneapolis-area police during a traffic stop on July 7, 2016. Reynold live-streamed the afternath of the shooting on Facebook Live.
Live streaming, a technology that has been around for years, became white hot this week after it was used to capture the aftermath of the fatal shooting of a black man by a police officer in Minnesota.
"Live streaming is quite different ... than what we've seen before," said Dan Olds, an analyst at Gabriel Consulting Group. "Skype and Facetime are most often used as one-to-one communication vehicles. But live-casting is different in that it gives users a one-to-many live broadcasting capability -- something that had only been available to broadcasting companies up until now."
Facebook Live automatically records live streams. That capability enabled Reynolds' video to be watched, shared and posted across the internet, across news outlets and around the world.
By showing more than photos or a delayed video, the live stream enabled viewers to experience the incident along with the people actually in the car. It was more frightening and more intimate.
Not including all the times it has been seen on YouTube and aired by various news services, the video has been shared 5.2 million times from Reynolds' Facebook page alone.
Live-streamed events seem to be a phenomenon that people can't turn away from, said Jeff Kagan, an independent industry analyst.
"Live streaming is powerful, and I don't really believe we are ready for it yet," he said. "This is the next step into tomorrow. I believe this area will have lots of competition and it will be interesting to watch it mature as we all try it, use it, and get embarrassed by it."
Thomas Husson, an analyst at Forrester Research, said live streaming will be pushed ahead by the growing need for "real-time" information.
"Live-streaming technologies enable people to simply live and communicate simultaneously," he told Computerworld. "They no longer live and then post content online. It is a shift in how we communicate.… With mobile, anyone can broadcast oneself with no limit."
As a technology, live streaming isn't new. It's the way it's being used and how frequently it's being used that is changing.
Apps like Periscope, Meerkat, Facebook Live and Stringwire have made broadcasting and watching live streams easy, compelling and fun.
In a 2016 survey by AYTM Market Research, 7% of those polled said they regularly use live-streaming services to broadcast, while 10% said they watch live streams regularly. Twenty-eight percent said they have watched a live stream at least once.
Including the crushing amount of attention that this week's Facebook Live broadcast received, live streaming and other social media have been in the news a lot recently.
Last month, a group of Democrats in the U.S. House of Representatives held a sit-in to push for a vote on gun control measures. However, when the Republican leadership ordered C-SPAN's cameras shut off, the group turned to their smartphones and live-streamed their protest using apps like Periscope and Facebook Live.
Later this summer, NBC, which will be airing the 2016 Rio Olympic Games, announced that it will live-stream 4,500 hours of the games.
There are many challenges -- such as concerns about privacy and security, and the need for sufficient network bandwidth -- that will arise as live streaming gains more traction. Such issues may come to a head relatively soon as people realize the power of a live feed.
Pushing the technology ahead is the fact that apps now are able to offer high-quality live streaming via almost any device. Users are discovering these abilities and are quickly jumping on board.
"Despite the tragic circumstances of this week's [shooting aftermath] broadcast, it really showcases Facebook Live's capabilities and potential," Olds said. "The thought that someone was able to get into the tool so quickly and was able to broadcast high-quality video from the side of a street is something that most people will find surprising."
As people become increasingly comfortable with sharing and receiving information via live streams, the technology will be further incorporated into enterprise operations.
Live streaming already is being used in healthcare. Patients in remote areas can share images of injuries, for instance, with doctors or specialists in other locations.
"I think that live-casting will be used increasingly in business in a variety of ways," said Olds. "Chief executives can live-stream meetings to all hands, regardless of where they are in the world. Companies can also communicate live to large groups of customers, perhaps introducing new products or offering timely information about existing products."
This story, "With Minnesota shooting, power of live streaming takes center stage" was originally published by
Computerworld. |
1. Technical Field
The present invention is an optical component, and in particular, is an optical component applicable in an image capturing device of a barcode reading apparatus.
2. Related Art
With the improvement of optical encoding technologies, a barcode system, which has already taken the place of a complicated manual input manner, is widely applied in various fields and has advantages such as convenient control and management of products and materials, document processing and filing, and quick determination of commodity prices. A barcode reader is required to read information included in barcodes. The barcode reader mainly uses an image capturing device to capture a barcode image, and then analyzes and obtains data in a barcode by using an image processing program for subsequent application. In both a one-dimensional reading apparatus and a two-dimensional barcode reading apparatus, an image capturing device is arranged to scan and read a barcode to obtain data in the barcode.
A light-emitting diode is usually arranged inside an image capturing device used for reading and compiling a barcode system to produce a light ray, and required optical elements such as a lens and a diffusion sheet are arranged outside the light-emitting diode. Under the guidance of an optical member located on a light ray casting path, a barcode symbol is scanned, and widths and spaces in a code area of the barcode symbol are reflected into a barcode reader, so as to identify the scanned barcode symbol.
In addition, to enable a user to place a barcode within a range readable by a barcode reader, a collimated light source and a corresponding optical element are further arranged in an image capturing device, so as to cast a scanning area to enable the user to place a barcode at the center of an angle of view of image capturing.
For an existing image capturing device, optical elements are separately fabricated and then separately secured in front of light sources or at other positions as required. To cast a large range for quick reading of barcode information within the range, or to obtain a light source with high brightness to facilitate outdoor use, multiple light-emitting elements are usually arranged. A corresponding optical element is further arranged in front of each light-emitting element, which increases the number of optical elements and makes an assembly procedure more complicated.
In addition, to miniaturize an image capturing device in a barcode reader as much as possible to adapt to various electronic apparatuses such as a mobile phone and a personal digital assistant (PDA), an optical element also needs to be miniaturized. Therefore, the difficulty in arranging and positioning optical elements is also increased, and a yield may also be decreased. |
Synthesis and extreme rate capability of Si-Al-C-N functionalized carbon nanotube spray-on coatings as Li-ion battery electrode.
Silicon-based precursor derived glass-ceramics or PDCs have proven to be an attractive alternative anode material for Li ion batteries. Main challenges associated with PDC anodes are their low electrical conductivity, first cycle loss, and meager C-rate performance. Here, we show that thermal conversion of single source aluminum-modified polysilazane on the surfaces of carbon nanotubes (CNTs) results in a robust Si-Al-C-N/CNT shell/core composite that offers extreme C-rate capability as battery electrode. Addition of Al to the molecular network of Si-C-N improved electrical conductivity of Si-C-N by 4 orders of magnitude, while interfacing with CNTs showed 7-fold enhancement. Further, we present a convenient spray-coating technique for PDC composite electrode preparation that eliminates polymeric binder and conductive agent there-by reducing processing steps and eradicating foreign material in the electrode. The Si-Al-C-N/CNT electrode showed stable charge capacity of 577 mAh g(-1) at 100 mA g(-1) and a remarkable 400 mAh g(-1) at 10,000 mA g(-1), which is the highest reported value for a silazane derived glass-ceramic or nanocomposite electrode. Under symmetric cycling conditions, a high charge capacity of ∼350 mA g(-1) at 1600 mA g(-1) was continuously observed for over 1000 cycles. |
[FREE IRAN Project] In The Spirit Of Cyrus The GreatViews expressed here are not necessarily the views & opinions of ActivistChat.com. Comments are unmoderated. Abusive remarks may be deleted. ActivistChat.com retains the rights to all content/IP info in in this forum and may re-post content elsewhere.
This week in the magazine, Laura Secor writes about Iran’s new generation of dissidents and the collapse of the nation’s reformist movement. Here, with Matt Dellinger, she discusses the situation and her travels in Iran.
MATT DELLINGER: In your article, you write about how young Iranians are dealing with the collapse of the reformist movement in Iran. What brought it to an end?
LAURA SECOR: President Mohammad Khatami and the reformists accomplished a lot by working to change the system from within. The social codes loosened; the price for political dissidence is still high, but not as high as it used to be; and, perhaps most important, Iranians were emboldened to demand a more transparent and accountable government. But, ultimately, the reformists weren’t able to deliver all they had promised. They were blocked by the upper clerical establishment, which controlled the most important levers of state, and which acted to crush a lot of reformist legislation, to close about a hundred reformist newspapers, and to violently suppress student activism. So a lot of people concluded either that the elected leadership was powerless or that the reformists were weak and unreliable. That’s why very few people who’d voted for Khatami in the past voted for Mustafa Moin, his heir apparent, in June. The question that a lot of activists are now debating is whether they should focus on electoral politics, as they’ve done in the past, or whether they should withdraw from that area and concentrate instead on building networks and civic organizations outside government. The movement for democratic change in Iran is far from dead, but it has undergone a crushing setback, and it is now casting about for new methods and strategies.
You spent a lot of time with a journalist named Roozbeh Mirebrahimi. What did you learn from him?
Mirebrahimi is a young reformist blogger. Because he dared to cross a particularly dangerous and powerful figure in the judiciary, he was recently imprisoned in solitary confinement, tortured, and, after he was released, subjected to threats and harassment by the authorities. His story told me a lot about the complexity of the Iranian system, parts of which have acted to persecute him, and parts of which have acted to protect him. That’s the gritty and complicated backstory of the reform movement: it may not have produced the sweeping changes that many Iranians desired, but it created pressure points within the regime, a sort of variegation that allowed for the possibility that, when things were blackest, there was some responsible person to whom you might turn. Mirebrahimi turned to Khatami. In the short term, this brought him some peace, but Mirebrahimi’s court file is still open and he remains extremely vulnerable. Many times, I saw him defend Khatami to anyone who dared to say that the reformists had accomplished nothing. But in his own musings, both to me and on his blog, he also seemed deeply ambivalent about the outgoing President and his legacy.
How important is the Internet to political life in Iran? And is it an open medium, or is it censored?
It’s really important. There are tens of thousands of blogs in Iran. Most of them aren’t political in the conventional sense; but writing frankly about private life in Iran is necessarily political, and many of the bloggers do that. The regime is scrambling to censor the Internet, but it can’t quite keep up. The authorities do block a lot of Web sites by using filtering technology—they seem to be most successful in blocking pornography, though they filter political sites, too—but many Iranian bloggers have found ways to keep their sites up.
You also spoke with Mirebrahimi’s wife. She is a journalist in her own right and openly defies tradition—she proposed to him, for instance. She certainly doesn’t fit the stereotype of draped, suppressed Iranian women that many Americans still have. Did you meet many women like her?
I met a lot of women who defied tradition in Iran, though they didn’t all do it in the same ways. Interestingly, by the way, Iranian universities graduate more women than men, and there are women in nearly all the professions. Iranian laws may be discriminatory, but the country has a large population of educated, sophisticated women who are far from passive or compliant.
The security forces in Iran are controlled by religious authorities rather than by elected officials. Where does the balance of power lie? With the politicians or with the mullahs?
Well, to be fair, some politicians are mullahs and some mullahs are politicians, so that’s not a real distinction. But there are two governments—one elected, the other appointed by a clerical overseer. The elected government, as one reformist cleric put it to me, probably holds about ten per cent of the government’s power. The rest belongs to the Supreme Leader, Ayatollah Ali Khamenei, and the bodies that answer to him.
What do the dissidents want? To overthrow the government? Or are there specific, more modest reforms that they seek?
Iran had a revolution pretty recently, followed by the traumas of war and dictatorship. As badly as many people want change, very few are inclined to put their lives and their country’s fundamental stability on the line for it. That said, there are dissidents who flatly say that the system has to go, and that it should be replaced by a constitution based not on Islamic law but on the United Nations’ Universal Declaration of Human Rights. A lot of people would probably agree with that as a long-term goal. The question is how to get there, in a country where even taking that position openly is exceedingly dangerous. There is a real distinction to be made between democracy activists and reformists. The reformists are dissidents who reject radical postures. They do not seek to overthrow the government. They are a loyal opposition that uses legal means, and the instruments of the constitution that is already in place, to improve the government bit by bit. They are attempting to move the country incrementally toward a more tolerant vision of Islamic law, more responsive government, and greater respect for rights and freedoms. Most of the country’s activists are proceeding in this way, even though now many are shifting their emphasis from the political sphere to nongovernmental organizations that support human rights and social justice. If the reformist project were eventually to succeed, Iran would become a real pathbreaker in the Islamic world.
When Arash, the young man you met at the Jaam-e Jam food court, in Tehran, heard that Mahmoud Ahmadinejad had won the election, he told you, “Everything is finished.” Why was it such a blow to him?
Many Iranians have powerful memories of the era before Khatami’s Presidency. They remember being harassed on the streets by the Basij, the Islamic militia, which would stop cars and search for illegal music or pictures of uncovered women, or just for unrelated men and women fraternizing with one another. People were whipped or beaten for these and other “moral” crimes. Many Iranians, including Arash, really fear that under Ahmadinejad, who has roots in the Basij, these bad old days will return. So far, there has not been much sign of that. But Ahmadinejad’s victory has led many to worry that what little breathing room Iranians had under Khatami could now disappear at any moment. Arash also feared that the new President would further isolate Iran and make it even more uncomfortable for people like him either to travel abroad or to have contact with foreigners within Iran.
Who is more threatening to the government: the apolitical, culturally rebellious young person, like Arash, who rejects the entire political system, or someone like Mirebrahimi, who is more willing to engage it?
The regime has answered that question for us. Mirebrahimi dared to speak the truth when others around him were too intimidated to do so. His deepest commitment is to his country and its future. And the regime has gone to terrible lengths to silence him. The Islamic Republic does not hold that many political prisoners; instead it makes examples of a few people, like Mirebrahimi, in order to convince others that the price of courage is just too high. This is a regime that seems threatened by engagement, not by apathy.
You write that while you were interviewing one student activist in a café, the two of you were watched by men who made little effort to hide their purpose. What was it like to travel and report in Iran? How conscious were you of incidents like that?
I had only one other incident like that one, and that was at a cultural center in the south of Tehran, where I was interviewing conservative young women about the election. Someone tried to confiscate my notes. Iran is a difficult place to work. It’s hard for American journalists to get visas—the one I got expired every few days, and constantly renewing it became a real distraction. To supply the visa, translator, and accreditation, many journalists rely on agencies, and these agencies are required to file reports on our movements with the intelligence ministry. American passport-holders are of particular interest. I decided it was best, under those circumstances, to do everything openly. I met with a lot of former political prisoners and people who were under surveillance. The agency knew I was doing this—I sent them a list of interview subjects before I arrived in Tehran. Nobody stopped me. In Iran you can go for long stretches forgetting that you’re not in a free country. Many people spoke strongly and openly with me, even on the streets. And then every once in a while something unpleasant happens to remind you that people are being controlled and that the stakes are high. As a foreigner, the concern is not for one’s own safety—the terrible story of Zahra Kazemi notwithstanding, foreign journalists are not at particular risk in Iran—but for the privacy and safety of those you work with and speak with. I’m still worried about that.
In Iran today, there are elections, and protesters gather openly—the oppression there is real, but not total. One Iranian told you, “We have freedom of expression. We just don’t have freedom after expression.” Do you think that this contradiction can persist?
It has persisted for a long time already. And, in some respects, that contradiction has provided a sort of uncomfortable but durable equilibrium. The question now is whether Ahmadinejad’s government will upset that equilibrium, and, if so, how the people will react. If the few open spaces now close, the country could be greatly destabilized. That’s why a lot of analysts suspect that one of three things will happen. Perhaps Ahmadinejad won’t roll back the reformists’ gains in social and political freedom—he’ll just freeze the situation as it is. Or maybe he’ll clamp down on political freedoms, which affect activists far more than they do ordinary people, but either leave social freedoms alone or tighten the screws on them very slowly. The final possibility, which isn’t incompatible with the first two, is that even if Ahmadinejad tries to roll back the reforms, Khamenei, who is more pragmatic than he is, will stop him. |
MS Access Code to Place SQL Values Into Report - 26/10/2011
MS Access reports are quite useful and powerful, but there are times where you may wish to set a certain field (field 4 in this case) with the results of a database query (in this case field1 and field2). This is mostly for my notes and my memory! |
13 Ill. App.2d 510 (1957)
142 N.E.2d 705
Guy Coffey, and Rebecca Coffey, Plaintiffs,
v.
ABC Liquor Stores, Inc., John Oglesby et al., Defendants. ABC Liquor Stores, Inc., John Oglesby, and Marie Wolfinbarger, Third Party Plaintiffs-Appellants,
v.
Troy Calvert, Jr., Third Party Defendant-Appellee.
Term No. 57-F-9.
Illinois Appellate Court Fourth District.
May 15, 1957.
Released for publication June 4, 1957.
*511 Frank G. Schubert, of Springfield, and DeWitt Twente, of Harrisburg, for third-party plaintiffs-appellants.
Charles J. Smith, and Graham, Califf & Harper, all of Moline (David A. Warford, of Marion, of counsel) for third-party appellee.
JUDGE CULBERTSON delivered the opinion of the court.
*512 This action arises from an original complaint filed by plaintiffs, Guy Coffey and Rebecca Coffey, against ABC Liquor Stores, Inc., a corporation, John Oglesby, Marie Wolfinbarger and William Jr. Hatchett, four defendant tavern operators, under the provisions of the Illinois Dramshop Act. The complaint is in two counts, one on behalf of Guy Coffey, and the other on behalf of his wife, Rebecca. The complaint alleges that the defendants sold or gave alcoholic liquors which in whole or in part caused intoxication of Troy Calvert, Jr., and that while in that condition he assaulted and beat Guy Coffey and injured him. The action of Guy Coffey is for personal injuries, and that of his wife seeks damages for injury to her means of support.
This case took an unusual turn when within the time for filing their answer, three of the defendants, ABC Liquor Stores, Inc., a corporation, John Oglesby, and Marie Wolfinbarger, brought Troy Calvert, Jr., in as a third-party defendant, by filing a third-party complaint against him. In this complaint they allege that if they are held liable to the plaintiffs that it would be only for damages caused by the tortious action of Calvert, and that they themselves were not guilty of any wrongful conduct; and since their liability is entirely statutory, they would have a right to recover against Calvert by way of indemnification.
Calvert filed a motion to dismiss or strike the third-party complaint and this motion was granted by the Trial Court on the grounds that the third-party complaint failed to state a cause of action for indemnification or contribution against Calvert, and that the inclusion of a third-party complaint in the proceeding would have been an imposition on the plaintiffs in the original Dramshop action. The third-party plaintiffs stood by their complaint and the Court entered judgment against such plaintiffs and in favor of the third-party defendant as to such complaint.
*513 On appeal in this Court the third-party plaintiffs contend that the complaint states a cause of action showing that they would have a right to indemnification against Calvert in the event they are held liable, and that the rule which in some situations bars a right of indemnification as between tort-feasors does not apply in this case because the complaint against the tavern operators is not based upon their being tort-feasors, but is purely statutory, without any reference to wrong doing or tortious conduct; and secondly, that the damages would have been caused by the active misconduct of Calvert rather than the tavern operators and that, therefore, under the Illinois law they should have a right to recover against this individual for damages.
[1, 2] Under the Illinois Civil Practice Act, within the time for filing an answer, a defendant may, without leave of Court, file a third-party complaint against one who is liable to such parties by reason of the institution of the original action (1955 Illinois Revised Statutes, Illinois Civil Practice Act, Chapter 110, Section 25, Paragraph 2), and if the Court feels that the consolidation of a third-party action with the original action may inconvenience the original plaintiff or prejudice his rights, the Court may order severance of the actions for trial (Illinois Civil Practice Act, supra).
[3] Our concern at this time is whether this third-party procedure as undertaken is justifiable in an action instituted under the provisions of the Dramshop Act referred to. Regulation of intoxicating liquors and the liability imposed upon a tavern operator under the provisions of this Act for damages are sustained on the ground that the regulations are established for the purpose of protecting the health, morals, and safety of the people; that the tavern operators do not have an inherent right to sell intoxicating liquors and that the liability under the Dramshop Act is penal in nature. It has also been determined that selling or *514 giving of intoxicating liquor which causes or contributes in whole or in part to intoxication of a person who causes injury while so intoxicated is a tort (Buckworth v. Crawford, 24 Ill. App. 603).
[4, 5] While the liability imposed upon liquor sellers by the Dramshop Act is purely of statutory origin, it is nonetheless a liability which the liquor dealers agree to accept and be bound by upon entering the liquor business. In all the cases which were directed to our attention on appeal, permitting indemnification as against a tortious third party as an exception to the joint tort-feasor rule, the parties were all innocent parties who established the right of indemnification as against contractors, or servants, or others. It is difficult to reconcile the position of a tavern operator who is found guilty under the provisions of the Illinois Dramshop Act with the innocent party position established by such precedents, since by the terms of the Act the tavern operator must necessarily be a tort-feasor and so penalized by statute. As a consequence, since the Illinois Dramshop Act does not grant any rights of indemnity or subrogation or contribution and is penal in nature (Wanack v. Michels, 215 Ill. 87. 94-96), and since on principle, indemnity or contribution or subrogation is allowed only to innocent parties (Wanack v. Michels, supra; Geneva Const. Co. v. Martin Transfer & Storage Co., 4 Ill.2d 273, 282-283), we do not believe that it would be consistent with the general equitable principles which sanction the third-party action, nor consistent with the objectives of the Dramshop Act to allow the third-party procedure attempted in the case before us (Economy Auto Ins. Co. v. Brown, 334 Ill. App. 579, 586-589; People v. Metropolitan Casualty Ins. Co. of New York, 339 Ill. App. 514, 518-519). By the Dramshop Act the Legislature has expressed the public policy of our State. In our opinion the allowance of the claim for indemnification *515 sought herein would violate the policy so expressed.
We must, therefore, conclude that the action of the Circuit Court of Williamson County in allowing the motion to dismiss and in entering judgment against the third-party plaintiffs in favor of the third-party defendant was proper and should be affirmed.
Judgment affirmed.
SCHEINEMAN, P.J. and BARDENS, J., concur.
|
#Terremoto: numeri utili della Protezione Civile nazionale e della sala operativa della Regione Lazio da usare in caso di necessità pic.twitter.com/uYYFVPbpGn — Regione Lazio (@RegioneLazio) 26 ottobre 2016
Ultimo aggiornamento: Giovedì 27 Ottobre 2016, 08:51
© RIPRODUZIONE RISERVATA
Notte di paura per centinaia di sfollati nelle zone, tra Marche e Umbria, colpite nuovamente dal sisma. Molti hanno trascorso la notte in auto, altri hanno trovato riparo in locali messi a disposizione dagli enti locali. Nessuno ha chiuso occhio mentre lo sciame sismico ha proseguito con varie scosse per tutta la notte. «La notte è trascorsa in un silenzio assordante - racconta il sindaco di Castelsantangelo sul Nera Mauro Falcucci - lo sguardo perso nel vuoto, mentre lo sciame sismico continua».Dopo le due scosse forti di ieri sera, nella notte l'Istituto nazionale di geofisica e vulcanologia ha registrato oltre 60 movimenti tellurici. Questa mattina poi, poco prima delle 6 si sono verificate due scosse di magnitudo superiore a 4.0 nella provincia di Macerata. Una scossa di 4.1 è stata registrata alle 5.19 e un'altra di 4.4 alle 5.50.Grossi danni aCrollataparte della facciata del Palazzo dei Governatori, costruito nel 1100, che ospita il Cineteatro Comunale. Danni ha subito anche il Palazzo dei Priori, edificio del 1482, in cui ha sede del Municipio. La chiesa di Sant'Antonio, crollata nell' omonimo borgo, risale al XIV secolo. Aveva già subito danni nel terremoto del settembre 1997 ed era stata sottoposta a lavori di consolidamento e restauro. Il centro storico è inagibile. Le forti scosse di ieri hanno provocato altri danni anche al centro storico di Amatrice già fortemente danneggiato dal terremoto del 24 agosto. Secondo quanto si apprende è crollato il palazzo del comune e un palazzo in cemento armato di quattro piani in piena zona rossa.Loche sta interessando ilha avuto il culmine mercoledì sera. La prima scossa è stata registrata alle 19.10 con magnitudo 5.4, a seguire una forte replica alle ore 21.18 e l'ultima alle 23.42 con magnitudo 4.6 secondo quanto registrato dai sismografi dell'Ingv. «Sono 980 i vigili del fuoco al lavoro nelle zone colpite dal sisma, con 450 mezzi e 4 elicotteri che da un'ora sono in volo per una ricognizione dei danni». Lo ha detto il ministro dell'Interno Angelino Alfano al programma Le voci del mattino su Radio 1 Rai. «Ci sono stati - ha spiegato- danni nelle province di Macerata, Perugia e Ascoli Piceno, crolli a Visso con un ferito grave, ad Acquasanta ci sono cinque persone isolate. Il sistema dei soccorsi - ha sottolineato- ha funzionato anche questa volta in modo efficientissimo consentendo di portare unità sul posto».Un uomo di 73 anni è morto per un infarto a Tolentino, presumibilmente per lo choc provocato dal terremoto. È la prima vittima 'indirettà del sisma. Per il momento, secondo il comandante provinciale dei carabinieri di Macerata, Stefano Di Iulio, non si sarebbero vittime per conseguenza di crolli. Sempre a Tolentino un operaio, dipendente di una ditta di surgelati, è rimasto ferito dal crollo di un controsoffitto, riportando ferite lacero contuse alla testa e a una spalla, ma le sue condizioni non sono gravi.Un terremoto, secondo gli esperti, collegato a quello di 24 agosto, con epicentro localizzato tra Castelsantangelo sul Nera, Visso, Ussita, nelle Marche, e Preci, in Umbria. Ma le scosse sono state avvertite anche a Roma e in molte località del centro nord . Un primo bilancio parlava di due feriti, poi il capo della Protezione civile, Fabrizio Curcio ha chiarito che «c'è un solo ferito lieve, comunicato dal 118 delle Marche». Due donne anziane sono state portate in salvo a Ussita. Curcio ha anche riferito che crolli ci sono stati nelle zone rosse dei paesi già colpiti dal sisma di agosto.Problemi anche alla viabilità, con la Salaria che è stata chiusa nella zona di Arquata del Tronto , mentre «la viabilità alternativa è stata riaperta ai mezzi di soccorso». La macchina degli aiuti si è messa subito in moto, ha detto Curcio e «i mezzi di soccorso sono arrivati in tutte le zone». A lavoro anche i vigili del fuoco, con 41 squadre operative. Ma la situazione è complicata dal buio e dalle condizioni meteo, per i forti temporali e solo nelle prossime ore si potrà avere un quadro più chiaro. In alcuni paesi stanotte si farà ricorso alle tende e, in alcuni casi, si sono ripopolate quelle mai ancora in piedi e predisposte per il sisma del 24 agosto.«Sono crollate parecchie case. Il nostro paese è finito», ha raccontato il sindaco di Ussita, Giuliano Rinaldi. «È crollata anche la facciata della chiesa», «tratti delle mura di conta» e si è «spaccato il terreno». Il sindaco di Castelsantangelo, Mauro Falcucci, ha raccontato di un paese al buio sotto la pioggia e immerso nella paura. «È finito ko - ha detto - il nostro unico albergo e stiamo organizzando il trasferimento di una decina di anziani a Camerino». A Visso la popolazione si è riversata in strada e nella piazza principale dove si sono avute scene di panico, mentre intorno i cornicioni crollavano e si alzava la polvere. «Le pareti mi sono venute addosso», ha raccontato una donna appena fuggita dal suo studio di geometra nel centro di Visso. «Ho sentito venire giù tutti gli oggetti e i libri dagli scaffali. Sono fuggita per le scale e fuori tutto era polvere. La gente gridava».In Umbria la scossa è stata molto forte e a Preci è stato riaperto il centro di prima accoglienza per raccogliere gli anziani che vivono soli. Danni anche a patrimonio artistico: a Norcia semi distrutta la chiesetta di San Salvatore a Campi di Norcia distante pochi chilometri in linea d'aria da Castelsantangelo sul Nera epicentro del terremoto e danneggiato la Chiesa di Santa Maria delle Grazie. A Camerino il campanile della chiesa di Santa Maria in Via , già danneggiata dal sisma del 24 agosto, è crollato su una palazzina.Il terremoto è stato sentito distintamente anche a Roma dove in molti si sono riversati in strada e in mezz'ora alla protezione civile sono arrivate oltre cento chiamate. Verifiche per crepe provocate dal sisma sono state fatte in edifici di alcuni quartieri. E domani in moltissime città e comuni del centro Italia, le scuole resteranno chiuse per precauzione.Domani, al solo fine di consentire le verifiche sugli edifici, le attività didattiche di tutte le scuole di ogni ordine e grado del Comune di Teramo saranno sospese. A renderlo noto è il Comune di Teramo. A causa della scossa anche il Sindaco di Perugia Andrea Romano insieme ai responsabili della Protezione Civile Comune di Perugia sta predisponendo l'ordinanza di chiusura delle scuole per la giornata di domani, 27 ottobre, al fine di poter effettuare tutti i controlli del caso. Così annunciato anche dal sindaco di Ascoli Piceno e di Rieti. |
Tuscany Travel guide
Tuscany : Michelin's recommendations
Tuscany witnessed the birth of a key moment in the history of Western art: the Renaissance! From the 13C to the 16C, rival Tuscan cities engaged in endless wars, but that didn’t keep them from turning into ‘‘laboratories’’ where inventors, painters and architects excelled, financed by wealthy families whose political prestige involved ostentatious displays of their luxurious lifestyle. Visiting Florence, Lucca, Pisa and Sienna is always an unparalleled delight.Tuscany is equally captivating for its well-preserved landscapes, gently rolling hills, woodlands, vineyards, and olive and cypress trees, composing a harmonious and inspirational natural environment. If you get the urge to explore Tuscany’s gorgeous light and beautiful panoramas, take a drive or a bike ride down the road from Florence to Fiesole, where age-old farms with fine architecture keep watch over this land where the living is easy. And there’s surely a wine cellar waiting there for you to sample one of the famous Tuscan wines while munching on a bruschetta drizzled with olive oil. There is also an arid and more mysterious side of Tuscany known as Garfagnana, a mountainous region, protected by its status as a park, which runs along the Alpi Apuane and Apennine massif north of Lucca. Tuscany has its own Riviera in Versilia, which stretches from the Mediterranean to the Alpi Apuane and is known for its mild climate. The coastline is dotted with seaside resorts graced with sandy beaches, the most famous of which is Viareggio. The hinterland around Pietrasanta and Upper Versilia, above Carrara, is a less well-known area that is also worth exploring.
Tuscany : Must-see towns and regions
The home of Dante (father of the Italian language), the city of the Medici (patrons of the arts and literature) and a melting pot of humanist art, Florence occupies a magnificent setting best viewed f...
St Francis’s message completely changed the destiny of Assisi. Nowadays, the saint’s ideals of poverty and simplicity are more evident in his rural hermitage retreat than in the San Francesco basilica...
Sheltering behind its brick ramparts planted with trees, Lucca has managed to retain its medieval character and remains largely unspoilt. The harmonious pink and ochre shades of its buildings, its bea...
Many visitors to Pisa do not venture beyond the exceptional architectural complex of the Piazza dei Miracoli (Square of Miracles) with its famous Leaning Tower. However, this attractive city on the Ri...
The town’s main monuments are its walls, which still encircle it, and the famous casa torre (tower houses) which have earned it the nickname ""San Gimignano dalle belle torri"". Of the 72 tower houses...
Built on three reddish clay hills, the city’s streets wend their way inside surprisingly large ramparts. It is a secretive and timeless city which enchants visitors, particularly at sunset, when the c...
Known since Antiquity for its Arezzo vases, this was the birthplace of the renowned patron of the arts, Maecenas. The town’s famous citizens include artists such as the monk Guido d'Arezzo, inventor o...
Montecatini’s spring water has been famous for its medicinal properties for centuries. It is used for the treatment of liver, intestinal and stomach ailments, either through mud baths or simply by dri... |
Justice is served by video cameras in police cars
December 11, 2006|By Steve Chapman
CHICAGO -- One afternoon in November, Houston Texans lineman Fred Weary was pulled over by Houston police for a traffic violation. The cops say he was belligerent and uncooperative. Mr. Weary's lawyer says he did as he was told. What no one disputes is that the story had an unhappy ending. The officer shot him with a Taser before handcuffing and arresting him.
At times like this, wouldn't it be nice to know exactly what happened? Of course it would. It would also be easy - had the incident been captured by a video camera. But it wasn't, because the police car involved didn't have one. Video recording is one of the most extraordinary law enforcement tools ever invented, but despite years of availability, it is still grossly underused.
In the end, a judge dismissed the charges of resisting arrest. You could take that as proof that Mr. Weary was an innocent man who was unjustly mistreated - or you could take it as a symptom of how hard it is to prosecute a well-represented public figure based on nothing but a cop's testimony.
All this uncertainty might have been avoided had the patrol car been equipped with an in-dash camera, as some Houston police cruisers are. These devices can provide an invaluable record of what happens before and after a police officer makes a stop or arrest. But cost and inertia have deterred departments from the obvious step of putting them in every vehicle.
The advantages of video gadgets are many. They can document crimes and traffic offenses. They can refute claims of police misconduct or brutality. They can encourage restraint by officers and citizens.
Where they have been used, they have proved their worth. In a three-month experiment with 74 Oakland police officers, complaints were filed against 15 of the cops when they patrolled without video cameras. But when they were driving cars with cameras, there wasn't a single complaint filed against any of the 74.
Maybe that's because offenders don't make up tales of police abuse when they know the video record will expose the lie. Or maybe it's because police behave themselves when they know they're being watched. In any case, everyone ends up better off:
Yet many departments have to be dragged kicking and screaming into the 21st century. Even though the infamous Rodney King affair put two cops in jail and cost the city a $3.8 million legal settlement, the Los Angeles Police Department couldn't bring itself to embrace modern technology until last month, when it announced it would install cameras in some 300 cars.
Chicago didn't get around to it until two months ago, and only 30 police cars - out of about 2,900 - will get the video gear. "A couple of hundred" of Houston's 1,400-plus cruisers are equipped with cameras, according to a spokesman. As of 2003, the federal Bureau of Justice Statistics says, only about one of every five police cars in the United States had them.
Why so few? The easy explanation is that cameras don't come cheap. They cost $2,500 to $10,000 apiece, plus expenses for training, storage and archiving, according to Jim Kuboviak, director of the Law Enforcement Mobile Video Institute.
But in this day and age, cameras ought to be considered standard equipment. It doesn't take too many lost convictions or damage payments to make the cost of video look like a bargain. Cities also save money because charges that might have been contested before are likely to produce quick guilty pleas when the incriminating facts are preserved in living color.
The payoff can be counted in more than dollars. In 1991, a county law enforcement officer stopped a car on a deserted road outside Garrison, Texas, only to be overpowered, beaten and stabbed to death by the three occupants. Thanks to the videotape in his patrol car, the killers were caught and convicted of murder.
Steve Chapman is a columnist for the Chicago Tribune. His column appears Mondays and Wednesdays. His e-mail is [email protected]. |
National Romanian Fascio
The National Romanian Fascio () was a small fascist group that was active in Romania for a short time during the 1920s.
Led by Titus Panaitescu Vifor, the group emerged from the short-lived National Fascist Party in 1921 and, at its peak, had around 1,500 members. It defined itself as national socialist, although generally it pursued a policy of corporatism, land reform and support for the creation of agricultural cooperatives. It was critical of capitalism and also espoused antisemitism. The movement's main areas of influence were Western Moldavia, Bukovina, and Banat.
The party merged with the National Italo-Romanian Cultural and Economical Movement in 1923 to form the National Fascist Movement, although a small rump movement carried on, with little significance. Both groups shared a close affinity to Italian fascism which facilitated their merger.
External links
Category:Defunct political parties in Romania
Category:Fascist parties in Romania
Category:Political parties established in 1921
Category:1923 disestablishments in Romania
Category:1921 establishments in Romania
Category:Romanian nationalist parties |
Fastest Electric Car
The electric car is a vehicle powered by one or more electric motors, and it uses batteries or some other some other storage device to store electrical energy. The electric motor endows the car with instant torque, which gives it a powerful and smooth acceleration. Electric cars are the environmentally-friendly alternative to normal cars with an internal combustion engine. They used to be more popular in the 19th and 20th centuries, but when gasoline became more available and cheap, they were mostly forgotten. After the 2000s though, with the invention of better batteries and power management technologies, the electric car has regained people’s attentions.
There are already plenty of electric car models to choose from, offered by companies such as Nissan, Ford, BMW, Honda, Mitsubishi, Renault, and many others. The fastest electric car sellers this year were Nissan and Mitsubishi, selling together more than 50,000 cars all over the world. The advantages of buying an electric car are not to be dismissed, the most important being its eco-friendly attitude. Electric cars have no tailpipe and thus very few polluting emissions and allow their users to stop depending on foreign oil. Starting of 2010 though, they are more expensive than internal combustion engine vehicles and hybrids because of the additional costs brought by the lithium-ion battery. This will not last forever though, as mass production and other developments in technology will probably bring forth some discounts in price. The fastest electric car may not be faster than most gasoline-based vehicles, but it can turn out to be a better long-term investment.
Many drivers avoid buying electric cars because they are afraid they will run out of batteries, as very few towns are equipped with battery charging infrastructure. This is termed range anxiety, and some governments around the world have decided to support the purchase of electric cars by installing battery charging stations and offering incentives.
In a recent race, it has been discovered that the fastest electric car in the world is a ’72 Datsun. Its owner, John Wayland built the motor himself and entered a racing competition. It turns out this little, two-door car can reach 60 mph in just 1.8 seconds, its top average speed being 129 mph. The Datsun uses a 192-cell lithium-polymer battery which accounts for 355 Volts and costs about $ 100,000. It’s extremely expensive, but Wayland got sponsors to help and so managed to fit his Datsun with what is said to be a prototype battery the Navy uses for helicopters. This definitely explains the extraordinary result the Datsun got, but it still should impress those that avoided the electric car just because they thought it’s not speedy enough. |
Q:
Cloud Functions for Firebase interrupted before finishing execution
Function is observing proposals/{jobid}/{propid}. When a new proposals is added, and child("isinvitation") is null, the function successfully writes new node to proposals/sent, then adds an increment to proposals child of jobs jobs/${jobid}.
The function is failing when a proposal is removed. userRef.child(jobid).remove() is not triggered also, decrease to proposal child of jobs jobs/${jobid} doesn't happen.
exports.CountProposals = functions.database.ref("/proposals/{jobid}/{propid}").onWrite((event) => {
const jobid = event.params.jobid;
const userId = event.params.propid;
const isinvitation = event.data.child("isinvitation").val();
if (!isinvitation) {
const userRef = admin.database().ref(`users/${userId}/proposals/sent`);
if (event.data.exists() && !event.data.previous.exists()) {
userRef.child(jobid).set({
timestamp: admin.database.ServerValue.TIMESTAMP
});
} else if (!event.data.exists() && event.data.previous.exists()) {
userRef.child(jobid).remove();
}
}
const collectionRef = admin.database().ref(`/jobs/${jobid}`);
return collectionRef.once('value').then(snapshot => {
if (snapshot.val() !== null) {
const countRef = collectionRef.child("proposals");
countRef.transaction(current => {
if (event.data.exists() && !event.data.previous.exists()) {
return (current || 0) + 1;
} else if (!event.data.exists() && event.data.previous.exists()) {
return (current || 0) - 1;
}
});
}
});
});
Console log don't show any errors.
A:
Your function is trying to do several writes in several places. Each one of those writes is going to generate a different promise that tracks its completion. You should return a single promise that resolves when all of the work is done. As it stand right now, you are only returning a single promise from collectionRef.once('value').then(), which isn't itself returning another promise that tracks the completion of the transaction.
Basically, you need to be careful with tracking all writes with promises, and typically you use Promise.all() to wait for all outstanding work.
|
To understand why Quebec Premier Philippe Couillard chose to defy his own beliefs and risk his province's international reputation by pressing ahead with a ban on religious face coverings, you must begin with the premise that doing nothing was not an option.
For more than a decade now, Quebec has been in the throes of a relentless debate about the challenges posed to its secularist society by the arrival of thousands of new immigrants belonging to religious minorities in general and one religious minority in particular. Without action to establish the primacy of secularism, this unfinished business risked monopolizing Quebec politics ad nauseam. Mr. Couillard sees the niqab ban as the least invasive way of bookending this debate.
As one former senior provincial cabinet minister explained it to me, a majority of francophone Quebeckers has felt extremely unsettled by the renewed incursion of religion into the public domain. Quebeckers fought to rid their polity of the insidious influence of the Catholic Church. This has instilled in them a zero-tolerance attitude toward the state's condoning of any religion. The government's failure to act remained an itch Quebeckers could not resist scratching.
Story continues below advertisement
Appreciating this context is not to absolve Mr. Couillard of the charges he now faces of giving in to xenophobia. But from the Premier's perspective, last week's adoption of Bill 62 establishing the religious neutrality of the state is a compromise aimed at pre-empting calls for an even wider ban on religious symbols in the public domain. While the new law made international headlines for banning all face coverings when receiving or granting public services, Bill 62 also sets out a legal framework for religious accommodation. It is this latter aspect that Mr. Couillard hopes will quell Quebeckers' anxiety about a religious free-for-all.
It's anyone's guess whether it will work. The opposition Coalition Avenir Québec and Parti Québécois, whose MNAs all voted against Bill 62, continue to depict the new law as a cowardly act of abdication that will institutionalize religious accommodation. A woman who wears the niqab or burka, the opposition says, will need to only apply once for an exemption from the requirement to show one's face to be permanently free from having to lift her veil.
"Apart from Batman and Spider-Man, all those who have religious reasons will be able to have their face covered," PQ Leader Jean-François Lisée charged. "So, [the law] is a farce."
The opposition is united in calling for a ban on the wearing of religious symbols by all state employees in a position of authority, including police officers and teachers. The question now is whether calls for further action will resonate with voters or whether Quebeckers will feel Mr. Couillard has gone far enough. With an election less than a year away, Mr. Couillard is dearly hoping it's the latter.
The rest of Canada must understand that the debate about religious accommodation in Quebec is informed by developments in Europe, where bans on wearing religious symbols in public institutions are widespread. Hence, the suggestion that this is an open-and-shut case of religious freedom does not carry as much weight in Quebec as elsewhere in Canada. European courts have consistently upheld bans on religious symbols – including the hijab and kippa – in public institutions.
France – where the veil has been banned in schools since 2004 and where the niqab and burka were banned in all public spaces in 2011 – remains the primary reference for Quebec. And the European Court of Human Rights upheld the French niqab/burka ban in 2014 on the grounds that the requirement to show one's face in public fell under "the respect for the minimum requirements of life in society."
This is Canada, however, and Mr. Couillard seems to have doubts himself about Bill 62's constitutionality, saying he expects the law's fate to be decided by the courts. That is unlikely before the next election, since many of the law's regulations won't be enacted until July 1.
Story continues below advertisement
If the courts do strike down Bill 62 as a violation of the Canadian Charter of Rights and Freedoms, it could either bury the issue once and for all or create a nasty backlash. While the courts could deem the law inconsistent with both the Quebec and Canadian rights charters, Quebec could always amend its own human-rights code. But opposition politicians would depict the Canadian constitution as an impediment to Quebec's desire to protect its secular identity.
Mr. Couillard might not be the last premier, then, to inherit this career-killing file. |
Clinical measures in transthyretin familial amyloid polyneuropathy.
This observational, cross-sectional, single-center study aimed to identify instruments capable of measuring disease progression in transthyretin familial amyloid polyneuropathy (TTR-FAP). The relationship between disease stage and Neuropathy Impairment Score-Lower Limbs (NIS-LL) and Norfolk Quality of Life-Diabetic Neuropathy (Norfolk QOL-DN) total score was assessed in 61 (stages 1-3) patients with TTR-FAP (V30M variant) and 16 healthy controls. Composite measures of large- and small-nerve fiber function, and modified body mass index (mBMI) were also assessed. Ordinal-based NIS-LL and Norfolk QOL-DN scores discriminated between disease stages (P < 0.0001 for NIS-LL and Norfolk QOL-DN). Longer disease duration correlated with worse NIS-LL and Norfolk QOL-DN. Karnofsky performance score declined progressively by disease stage. Composite measures of nerve fiber function differentiated stage 1 from stage 2 disease. The mBMI declined with advancing disease. NIS-LL, Norfolk QOL-DN score, composite endpoints of nerve fiber function, and mBMI are valid, reliable measures of TTR-FAP severity. Muscle Nerve 55: 323-332, 2017. |
NH₃ treatment of TiO₂ nanotubes: from N-doping to semimetallic conductivity.
In the present work we show that a suitable high temperature ammonia treatment allows for the conversion of single-walled TiO2 nanotube arrays not only to a N-doped photoactive anatase material (which is already well established), but even further into fully functional titanium nitride (TiN) tubular structures that exhibit semimetallic conductivity. |
Distinction of amino Acid enantiomers based on the basicity of their dimers.
Mixtures of several amino acid pairs, in all four chiral combinations, were studied. The protonated trimers (A(2)BH(+)) fragment, forming ABH(+) and A(2)H(+) dimers. Abundance ratios of these fragments were measured in the mass-analyzed ion kinetic energy spectra of the trimers. These were found to depend on the stereochemistry (homo- or heterochiral form) of the ABH(+) dimer. The results were evaluated using the kinetic method, and the chiral discrimination was related to a difference in gas-phase basicity (GB) between the homo- and the heterochiral dimers. Four amino acid pairs (proline-tryptophan, phenylalanine-alanine, phenylalanine-proline, and phenylalanine-valine) were studied. Chiral discriminations were observed in all cases, relating to 0.4-4 kJ/mol differences in GB. The technique described here can generally be used to study enantiomers by mass spectrometry and is capable of reliably distinguishing energy differences as small as 0.2 kJ/mol in cluster ions. |
Digium launches their standalone G100 and G200 VoIP gateways, which negate the need for a TDM (T1/E1) card to be installed in your Asterisk server. Both products are fanless and have no moving parts, which means higher reliability. Further, many Asterisk deployments are now happening in virtualized environments or in the cloud where you cannot have a dedicated TDM card installed. These two VoIP gateways support TDM-to-SIP, SIP-to-TDM and SIP-to-SIP (transcoding) applications to bridge the TDM and SIP worlds.
Ensim Corporation today announced support for Microsoft Lync Server 2010 Multi-tenant environments allowing enterprises who wish to host Lync in the cloud to have a a powerful deployment tool at their disposal. Ensim Unify Service Provider Edition now offers full support for Microsoft Lync in multi-tenant environments for messaging, presence, web and video conferencing, and telephony with enterprise voice. With Ensim Unify's ability to allocate resources physically and logically, service providers using Lync Server 2010 Multi-tenant Hosting Pack (Lync Hosting Pack for short) can support small or large deployments in multi-tenant mode or can dedicate a single server to a single organization and allow custom SIP integration for each organization - all while managing Lync as a single platform.
Ensim Unify Service Provider Edition offers service providers and a complete, centralized, relational platform that manages creation, activation, configuration, and administration of an entire hosted application and cloud service offering.
Zingaya today announced Zingaya Enterprise, a new platform and API enabling VoIP calls from a browser or a mobile app with a single click. Their platform enables developers to build out Mobile VoIP apps, with applications that include support desk and sales & e-commerce, with the goal of improved conversion rates.
Zingaya enables VoIP calls without a phone or without requiring a download. E-commerce companies and other customer-focused organizations can embed a widget on their website that allows their customers to simply click a button to start speaking to a live customer agent.
netTALK today launched netTALK DUO Wi-Fi, launching exclusively first in Target stores nationwide. Check out my review of their original non-Wi-Fi netTALK DUO, which required an Ethernet (wired) connection. Their new wireless product will be available starting early April at Target stores nationwide, with other retailers being added soon.
“We are truly making history with the launch of netTALK DUO WiFi,” said Anastasios ‘Takis’ Kyriakides, President and CEO.
maaii pronounced as “mahy-ee” or “My-ee” is a free mobile VoIP application for iPhone and Android featuring Facebook integration and it comes bundled with 100 free minutes ($1.90). However, as part of their launch they're recharging each users balance back to $1.90 each day, thus giving each user 100 free VoIP calling minutes every day!
I decided to take the app for a test drive on my iPhone 4S. The maaii app will run in the background unless you force the app closed. Thus, you can receive inbound calls very quickly without waiting for the app to load.
The Federal Communications Commission today voted and passed a requirement that interconnected VoIP service providers report significant network outages that meet specific criteria and thresholds. The goal is to ensure 911 system reliability and perhaps customer awareness of fly-by-night VoIP operations that are just trying to make a buck. The FCC will use outage reports to "track and analyze information on interconnected VoIP outages affecting 9-1-1 service and determine if action is needed to prevent future outages." In other words you might be looking at fines if you don't have a reliable VoIP network.
According to Chairman Julius Genachowski, "With today’s action, the FCC is helping ensure that our communications infrastructure is more resilient.
KEMP Technologies today announced that its LoadMaster hardware-based and virtual appliance load balancers are now approved for Microsoft Lync Server 2010. If you recall, I spoke with Kemp last year about their Exchange 2010 load balancer, so adding Lync load balancing certainly rounds out their Microsoft portfolio. KEMP’s LoadMaster products offer server load balancing, optimized application delivery and built-in SSL acceleration. These features enable the LoadMasters to seamlessly integrate with Microsoft's Lync server pools.
I've tested, used, and reviewed many Polycom phones over the years, but apparently I never noticed or received this warning letter with these phones. Check out this ridiculousness:
WARNING ALL SOUNDPOINT IP PHONESWith respect to section 5.4.3.10 of the Australian Communications Authority as Telecommunications Technical Standard AS/ACIF S004 2004 under the s376 of the Telecommunications Act 1997:
You should be aware that, under certain operating conditions, the handset earpiece may retain small metallic objects. If this occurs, these objects should be removed before using the handset.
Dell has partnered with Ontario-based Fongo to offer Dell Voice, a VoIP app exclusively available exclusively in Canada that offers a Canadian phone number and free calls to most of Canada. Also, incoming calls and Dell Voice-to-Dell Voice calls are free of charge. This reminds me of how Dell partnered with Sightspeed, now a part of Logitech to offer a multi-party video conferencing service called Dell Video Chat. I reviewed the software and it works well, but with free alternatives like Skype, having the ability to do 9-way (3x3) Brady Bunch video is a very niche application. Practically nobody has ever heard of Dell Video Chat, so here let me share a couple screenshots of it...
Screenshot of me testing it:
2x2 (4-way video call)
I suspect Dell Voice will suffer the same ignominious fate as Dell Video Chat. There's just too much competition, including superior offerings from Google Voice, Skype, and most recently Vonage. |
Unusual findings in papillary thyroid microcarcinoma suggesting partial regression: a study of two cases.
Histologic changes of regression have been recognized in many malignant tumors, although they have not been documented in thyroid carcinoma. We analyze here the histologic features of 2 cases of papillary thyroid microcarcinoma, one of the diffuse sclerosing variant and another multicentric of the follicular variant, that suggest partial regression. The histologic and clinical features of the 2 thyroid microcarcinomas were compared with the features of regression reported in other tumors. Hematoxylin and eosin stains were examined in each case. In addition, immunoperoxidase stains for thyroglobulin and thyroid transcription factor-1 were performed on the metastatic and primary lesions of each case. Immunostains for CD4 and CD8 performed on the thyroid lesions were also examined. Both patients presented with metastatic papillary thyroid carcinoma in regional lymph nodes with no clinical or radiologic evidence of primary tumor in the thyroid glands. When examined, the thyroid glands revealed only microscopic foci of papillary thyroid carcinoma measuring less than 1.5 mm, diffuse sclerosis and a lymphocytic infiltrate mainly composed of cytotoxic T lymphocytes around the neoplastic microfollicles. Numerous psammoma bodies were also found in the thyroid of case 1, and venulitis similar to that seen in acute hepatic rejection was also seen in the microcarcinoma of case 2. The 2 patients reported had papillary thyroid microcarcinomas measuring less than 1.5 mm and features suggestive of regression characterized by extensive fibrosis, an accompanying T lymphocyte infiltrate, venulitis, and only a few clusters of neoplastic cells or a few neoplastic follicles. Thus, we believe that these histologic changes suggest regression because papillary thyroid microcarcinomas measuring less than 1.5 mm do not metastasize and have been considered innocuous or medical curiosities. |
#!/usr/bin/zsh
netdata-conf() {
cat <<EOF
[global]
# special port for dowse
port = 29999
ip version = ipv4
bind socket to ip = 127.0.0.1
run as user = $dowse_uid
web files owner = $dowse_uid
web files group = $dowse_gid
error log = $H/run/netdata-error.log
access log = $H/run/netdata-access.log
debug log = $H/run/netdata-debug.log
memory deduplication = yes
# save - dump on exit
# map - write to disk realtime
memory mode = ram
[plugins]
tc = no
idlejitter = no
cgroups = no
checks = no
apps = no
node.d = no
[plugin:proc]
/proc/diskstats = no
/proc/net/ip_vs/stats = no
/proc/vmstat = no
/proc/net/rpc/nfsd = no
/proc/interrupts = no
/proc/softirqs = no
/sys/kernel/mm/ksm = no
[plugin:proc:/proc/stat]
cpu interrupts = no
[plugin:proc:/proc/meminfo]
system swap = no
EOF
}
netdata-exec() {
fn netdata-start $*
req=(conf)
freq=($conf)
ckreq || return $?
# check if required dirs exist
mkdir -p $H/lib/netdata/registry
mkdir -p $H/cache/netdata
pid=$H/run/netdata.pid
launch netdata -P $pid -c $conf -p 29999
savepid netdata $pid
return $?
}
|
alreadyConnected=Nodes already connected
containsValidationErrors=Contains validation errors
collapse-expand=Collapse/Expand
doubleClickOrientation=Doubleclick to change orientation
|
Q:
Calculating the prorata of employee calls per Business Unit in SQL Server 2014
I am establishing business rules to determine the number of active call center agents per 30 minutes intervals.
We have 2 types of agents: Billing & Technical Ops.
We've recently let billing agents take technical calls, and vice-versa.
I have written the following code that returns the call count per agent, per interval and per call type:
SELECT
HAGENT.[ROW_DATE],
CASE
WHEN LEN([STARTTIME]) = 1 THEN '00:00'
WHEN LEN([STARTTIME]) = 2 THEN '00:30'
WHEN LEN([STARTTIME]) = 3 THEN (LEFT([STARTTIME],1) + ':' + RIGHT([STARTTIME],2))
WHEN LEN([STARTTIME]) = 4 THEN (LEFT([STARTTIME],2) + ':' + RIGHT([STARTTIME],2))
END AS THETIME,
([LOGID]) AS AGENTS,
COUNT(HAGENT.ACDCALLS) AS CALL_COUNT,
CASE
WHEN SPLITMATRIX.[Business_Unit] LIKE '%Billing%' THEN 'CDN Billing'
WHEN SPLITMATRIX.[Business_Unit] LIKE '%TechOps%' THEN 'CDN Tech Ops'
END AS Bunit
FROM
[KPI_DATA].[dbo].[DM_CMS_HAGENT] HAGENT
LEFT JOIN
[GEMDB].[dbo].[T_PRD_REF_xAGENT_AGENTLIST] AGENTLIST
ON AGENTLIST.asp_raw_cmsID1 = HAGENT.LOGID COLLATE DATABASE_DEFAULT
AND HAGENT.ROW_DATE BETWEEN AGENTLIST.[asp_raw_START_SDEPT] AND AGENTLIST.asp_raw_STOP_SDEPT
AND HAGENT.ROW_DATE BETWEEN AGENTLIST.[asp_raw_START_TEAM] AND AGENTLIST.[asp_raw_STOP_TEAM]
LEFT JOIN
[MATRIX_DATA].[dbo].[REF_CMS_SPLIT_MATRIX] SPLITMATRIX
ON SPLITMATRIX.SPLIT = HAGENT.SPLIT
WHERE
ROW_DATE >= '2017-07-01'
AND [ACDCALLS] != 0
AND (SPLITMATRIX.[Business_Unit] LIKE '%Billing%'
OR SPLITMATRIX.[Business_Unit] LIKE '%TechOps%')
GROUP BY
GROUPING SETS (
(ROW_DATE, STARTTIME,([LOGID]), SPLITMATRIX.[Business_Unit]),
(ROW_DATE, STARTTIME,([LOGID]))
)
ORDER BY
ROW_DATE DESC, THETIME DESC, [LOGID] DESC
The output looks like this:
SQL Output
With AGENTS being the unique logid of an agent, Bunit the type of Calls taken (When Bunit is NULL, it's the total number of calls taken by an agent for that interval).
From this output, I would like to calculate an active employee count per interval & Calls Types.
For example, if an agent took 2 Billing Calls & 1 Tech Ops Call, I would consider that 2/3 of this agent was working as a Billing Agent, and 1/3 of this agent was a Tech Ops agent.
Finally I would like to group the SUM of the agents ratio per Call types, per interval.
I tried using a PIVOT function, without luck.
My expected result would look like this:
https://i.stack.imgur.com/oKiUl.jpg
Any help?
A:
You can use PIVOT and UNPIVOT on this scenario
Sample Data
CREATE TABLE t_bu
(row_date DATE,
thetime TIME,
agents INT,
call_count INT,
bunit VARCHAR(20)
)
INSERT INTO t_bu VALUES
('8/17/2017','9:30',1210893,1,'CDN Billing'),
('8/17/2017','9:30',1210893,1,NULL),
('8/17/2017','9:30',1210870,2,'CDN Tech Ops'),
('8/17/2017','9:30',1210870,2,NULL),
('8/17/2017','9:30',1210858,3,'CDN Billing'),
('8/17/2017','9:30',1210858,3,NULL),
('8/17/2017','9:30',1210857,1,'CDN Tech Ops'),
('8/17/2017','9:30',1210857,1,NULL),
('8/17/2017','9:30',1210849,1,'CDN Billing'),
('8/17/2017','9:30',1210849,1,NULL),
('8/17/2017','9:30',1210832,2,'CDN Billing'),
('8/17/2017','9:30',1210832,1,'CDN Tech Ops'),
('8/17/2017','9:30',1210832,3,NULL),
('10/21/2017','10:30',1210857,3,'CDN Tech Ops'),
('10/21/2017','10:30',1210857,3,NULL),
('10/21/2017','12:30',1210857,3,'CDN Tech Ops'),
('10/21/2017','12:30',1210857,3,NULL),
('10/21/2017','12:30',1210849,4,'CDN Billing'),
('10/21/2017','12:30',1210849,4,NULL),
('10/21/2017','12:30',1210832,3,'CDN Billing'),
('10/21/2017','12:30',1210832,5,'CDN Tech Ops'),
('10/21/2017','12:30',1210832,8,NULL);
SQL Query (Dynamic)
DECLARE @cols AS NVARCHAR(MAX),
@query AS NVARCHAR(MAX)
SET @cols = STUFF((SELECT DISTINCT ',' + QUOTENAME(CASE WHEN t.bunit IS NULL THEN 'Total' ELSE t.bunit END)
FROM t_bu t -- use your table name
FOR XML PATH(''), TYPE
).value('.', 'NVARCHAR(MAX)'),1,1,'')
SET @query = 'WITH t_comp AS
(SELECT row_date, thetime, SUM(CAST([CDN Billing] AS FLOAT)/CAST([Total] AS FLOAT)) [CDN Billing], SUM(CAST([CDN Tech Ops] AS FLOAT)/CAST([Total] AS FLOAT)) [CDN Tech Ops]
FROM (SELECT agents, row_date, thetime, ' + @cols +
' FROM (SELECT agents,
row_date,
thetime,
CASE WHEN bunit IS NULL THEN ''Total'' ELSE bunit END AS bunit,
call_count
FROM t_bu -- use your table name
) x
PIVOT (MAX(call_count)
FOR bunit in (' + @cols + ')) p
) a
GROUP BY row_date, thetime
)
SELECT row_date, thetime, call_type, active_agents
FROM t_comp
UNPIVOT (active_agents
FOR call_type IN ([CDN Billing], [CDN Tech Ops])) u'
EXECUTE(@query)
GO
Result
row_date thetime call_type active_agents
2017-08-17 09:30:00.0000000 CDN Billing 3.66666666666667
2017-08-17 09:30:00.0000000 CDN Tech Ops 2.33333333333333
2017-10-21 10:30:00.0000000 CDN Tech Ops 1
2017-10-21 12:30:00.0000000 CDN Billing 1.375
2017-10-21 12:30:00.0000000 CDN Tech Ops 1.625
|
World Class 556 point run at North Texas FLL Regional Championship
Here’s an annotated video of our team’s 555 point run at the North Texas FLL Regional Championship, held on February 14, 2015 at Parish Episcopal School in Dallas and sponsored by the Perot Museum of Nature and Science. Matthew was the driver for this round, with Walter running attachments. |
PepsiCo Agrees to Pay $5 Million to Settle California Drivers’ Work Break Lawsuit
About 1,800 current and former drivers in the Golden State will share the payout, according to their motion for court approval. If every class member participates in the settlement, each driver would receive about $1,990, the motion estimates.
California requires employers to provide rest breaks and meal breaks. Workers are supposed to be free of work duties during their breaks.
But the drivers weren’t free of duties because they were expected to respond to telephone calls from dispatchers and customers, they say. As a result, they should be compensated for that time, according to the lawsuit. They also said their pay stubs and other records were incorrect as a result of the incorrect compensation.
If the drivers were to win all claims in a trial, the companies’ maximum liability would be about $7 million, the drivers estimated. The parties said they agreed to settle to avoid the risks, costs and delays of litigation.
New Bern Transport Corp. and Pepsi-Cola Sales and Distribution, Inc., which are subsidiaries of PepsiCo., also are named as defendants.
The proposed settlement is subject to approval by Judge Edward M. Chen of the U.S. District Court for the Northern District of California. He’ll consider whether it’s a fair, adequate and reasonable resolution of the dispute, taking into consideration the strength of the claims, the amount of the payout and the reaction by class members.
William Turley, David Mara, and Jamie Serb of the Turley & Mara Law Firm in San Diego represent the drivers. |
Mark Twain Biography
At a Glance
Mark Twain himself was Twain’s first successful work of fiction. Born in 1835 as Samuel Langhorne Clemens, Twain worked as a river boat captain on the Mississippi while a young man. When the pilots called out the depth of the river, “mark twain” meant that the river was two fathoms deep. A master of vernacular English, Twain eventually traveled all over America (and beyond), paying attention to how people really spoke and what really entertained them. He published poetry, jokes, tall tales, nonfiction, and, of course, some of the greatest novels in American history. His characters Tom Sawyer and Huckleberry Finn seem to capture the meaning of boyhood, America, and life on the wild Mississippi River.
Facts and Trivia
Twain grew up in Missouri, a slave state. However, when the Civil War broke out, Missouri didn’t join the Confederacy, so Twain and some friends formed a militia to fight on the Confederate side. This lasted until the first battle. When a man was killed, Twain deserted.
Twain was a successful lecturer, generating money and fame via speaking tours throughout the United States and Europe.
When Twain disliked you, you knew it. His essay “Fennimore Cooper’s Literary Offenses” does an entertainingly malicious job of taking apart the author of Last of the Mohicans.
Twain made lots of money, but he lost most of it. He was as bad at investing as he was good at writing, and he eventually had to declare bankruptcy.
Ernest Hemingway once said, “All modern American literature comes from one book by Mark Twain called Huckleberry Finn.”
Article abstract: In The Adventures of Huckleberry Finn (1884), Twain gave America the prototypical initiation novel, but his humor and nostalgia for the past increasingly gave way to his pessimism about man’s technological “progress.”
Early Life
Samuel Langhorne Clemens was born November 30, 1835, in Florida, Missouri. The ancestors of his mother, née Jane Lampton, and his father, John Marshall Clemens, were mostly English and Irish and had lived in Virginia and Kentucky. While both sides of his family claimed distinguished English ancestors, those aristocratic ties were never clearly identified, and the Clemens family was hardly affluent when Samuel was born. Nevertheless, Samuel’s father was a cultivated, educated man (he had studied law) who was determined to be successful financially. Consequently, because there appeared to be more opportunity, in 1839 the elder Clemens moved his family to Hannibal, located on the banks of the Mississippi. Unfortunately, John’s financial dreams did not materialize, and he died in 1847, when Samuel was eleven. Partly by default and partly because of her personality, Jane Clemens became a central influence in Samuel’s life. In fact, the similarities between his mother and Olivia Langdon, his wife, were so pronounced that one could speculate that his mother’s influence subconsciously affected his choice of a wife.
Shortly after his father’s death, Samuel, probably for financial reasons, was apprenticed to a local printer, and his newspaper career was launched. In 1850, he went to work for his older brother, Orion, on the Hannibal Western Union, and until 1857, he worked as a typesetter for various newspapers. During this period, he also wrote sketches and published his first story. His newspaper career was fortuitously interrupted in 1857, when he learned to be a steamboat pilot on the Mississippi. Those experiences formed the basis for his Life on the Mississippi (1883) and also deepened the influence that the Mississippi had on the body of his work. In 1862, he first used the pen name “Mark Twain,” taken from the river boatmen’s cry to indicate two fathoms of safe water. When the outbreak of the Civil War brought his piloting career to an end, Twain served briefly with some Confederate “irregulars,” but he gladly accepted Orion’s offer to accompany him to Nevada, where Orion served as “secretary” to that territory.
During his Nevada years, Twain unsuccessfully prospected for gold and silver and successfully returned to the newspaper world, writing for the Virginia City Territorial Enterprise, where he developed, partly through emulating humorist Artemus Ward, his lecturing persona. In 1864, he moved to San Francisco, where he continued his newspaper work on the Morning Call and also contributed work to the Californian, a literary magazine. Among his California works was “The Celebrated Jumping Frog of Calaveras County,” a short story that catapulted him to national prominence and established him as a spokesman for the vanishing American frontier. After a trip to Hawaii, about which he wrote and lectured, he left California in 1866 and went East to New York City.
Life’s Work
Twain’s decision to go east was a significant one. Despite his “frontier” humor and Southern speech, he became an Easterner who looked nostalgically to the South for his literary landscape and to the West for his values. In effect, Twain was split between the progressive, materialistic East of the future and the reactionary, individualistic Southwest of the past. Even Twain’s appearance seemed a contradiction: A handsome man given to elegant clothes (white suits became his trademark in his later years), he was also a cigar-smoker and whiskey-drinker who never became “genteel” in manner. Far from subscribing to the notion of “art for art’s sake,” he made writing his business and was ambitious both financially and socially. In fact, it was the split between art and business that produced works that appear inconsistent, contradictory, and careless. The pressure to make money did cause him to produce inferior work, as Twain himself acknowledged.
Shortly after moving to New York, Twain met Henry Ward Beecher, a prominent preacher and brother to Harriet Beecher Stowe, the author of Uncle Tom’s Cabin (1852). When he learned that Beecher’s congregation was planning a Mediterranean steamboat excursion to Europe and the Holy Land, he persuaded the Alta California to finance his trip in exchange for providing the newspaper with travel letters, which were popular at the time. The revised travel accounts eventually became The Innocents Abroad (1869), a book that enabled him to abandon his newspaper work and to devote his full attention to writing. The trip was also significant because it resulted in his marriage, in 1870, to Olivia Langdon, whose brother had met Twain on the voyage and had showed the author Olivia’s picture. During their thirty-three years of marriage, Olivia was the ideal wife and confidante, but she also served as an unofficial “editor” whose moral views tempered Twain’s writing.
After his marriage, Twain embarked on what was to become a typical divided course of action: He began to write Roughing It (1872), and he acquired part ownership of the Buffalo Express, the first of a series of unsuccessful business ventures. Another pattern was also established during the early years of the marriage: depression caused by sickness and death. Olivia’s father died in 1870; Olivia herself was sick and gave birth prematurely to their first child, Langdon, who died in 1872. Despite these setbacks, Twain moved his family to Hartford, Connecticut, where he built an impressive mansion, a symbol of his ambition and materialism.
Twain’s Hartford years were his most productive artistically and financially. In 1873, he published, in collaboration with his Hartford neighbor, Charles Dudley Warner, The Gilded Age, his first attempt at an extended work of fiction. After successfully adapting the novel to the stage (1874), he published The Adventures of Tom Sawyer in 1876 and, in 1880, published another travel book, A Tramp Abroad. In 1882, The Prince and the Pauper appeared, and in 1884, The Adventures of Huckleberry Finn, his most artistic and significant novel, was published. Within a month, The Adventures of Huckleberry Finn was embroiled in censorship problems that continued to plague the novel, but the novel also quickly became a best-seller and has become one of the most widely read and taught novels in American literature.
The Adventures of Huckleberry Finn was the first publication of the Charles L. Webster Publication Company, which Twain formed after having problems with his previous publishers. Like his father, Twain believed that he had business acumen, and the financial success of The Adventures of Huckleberry Finn and The Personal Memoirs of U. S. Grant (1885-1886), which Twain published in his publishing company, Charles L. Webster and Company, confirmed his belief that he was both a financial and artistic genius. In 1886, an overconfident Twain, who optimistically believed in technology and in the promise of a typesetting machine, acquired half ownership of the Paige Typesetter; in 1889, he purchased all rights to the machine. By the time Twain ended his futile speculation in the ill-fated invention, he had accumulated debts of $100,000. In an effort to economize, he closed his Hartford house in 1891 and moved to Europe, but he was bankrupt by 1894. Even his substantial earnings from the publication of A Connecticut Yankee in King Arthur’s Court (1889) and Tom Sawyer Abroad (1894) could not compensate for the financial strain caused by his obsession with the typesetting machine.
Twain, to his credit, did not attempt to take advantage of bankruptcy laws and instead set about paying off his debts by undertaking an exhausting round-the-world lecture tour in 1895 and by continuing to publish books: Personal Recollections of Joan of Arc (1896), Tom Sawyer, Detective (1896), and Following the Equator (1897), a travel account prompted by his 1895 lecture tour. These sales, coupled with a lucrative contract with Harper and Row for rights to his collected works, enabled Twain to pay off his debts in full by January of 1898. Although he recovered financially, Twain suffered several setbacks from which he never fully recovered. While he was in England in 1896, his favorite daughter died of meningitis; his already frail wife died in 1904, after suffering from physical and mental problems; his daughter Clara married and settled in Europe in 1909; Jean, his other daughter, died scarcely two months after Clara’s marriage.
Despite the misfortunes that plagued him after 1898, Twain continued to write prolifically, but most of this material, because of its nihilistic philosophy, was not published until after his death. Olivia, who was concerned about his image and who served as his literary editor/censor, opposed the publication of the deterministic tract What Is Man? (1906). The Mysterious Stranger, which occupied Twain for several years and which existed in various versions, was not published until 1916, when Albert Bigelow Paine, Twain’s official biographer, conflated the versions and published his reconstruction as Twain’s own work. Twain, who had been left quite alone by Clara’s marriage and the deaths of his wife and other children, died April 21, 1910, long before the American public had been made aware of the “literary Lincoln’s” darker side.
Summary
In many ways, Mark Twain was as contradictory a person as his real name and pen name suggest. The adoption of the pen name indicates, to some extent, a person not content with himself but determined to forge a new personality, to create a new person—in effect, not unlike James Gatz/Jay Gatsby, to be both creator and creature. Like Gatsby, too, Twain was caught up in the American dream of material success, social ascent, and technological progress; unlike Gatsby, however, he came to satirize and scorn many of the values to which he subscribed.
For most Americans, Mark Twain is indelibly associated with Huckleberry Finn, the youthful protagonist who “lights out for the territory” rather than return to the “civilization” represented by Aunt Sally. Yet The Adventures of Huckleberry Finn contains another juvenile persona who only “plays” at nonconformity and rebellion: Tom Sawyer. There is as much Tom Sawyer in Twain as there is Huckleberry Finn. Even The Adventures of Huckleberry Finn is more than it appears to be, juvenile fiction in the vein of The Adventures of Tom Sawyer; it is also an initiation novel which depicts a boy’s adventures and his inner growth, presents the conflict between appearance and reality, and satirizes Southern gentility and aristocratic pretension. Because The Adventures of Huckleberry Finn is such an enjoyable story, however, many readers ignored the Colonel Sherburn incident, with its scathing indictment of mankind. For many readers, Mark Twain was the lecturer-writer of juvenile fiction and travel books, a humorous teller of frontier tales.
Twain’s humor was considerably blacker than the general public, which lionized him, believed. In some ways, his humor was similar to Ambrose Bierce’s, but that similarity was overlooked by a public which dubbed the latter “Bitter Bierce.” As his ambitious entrepreneurial schemes failed and his loved ones died, Twain became increasingly pessimistic about men and about institutions, and his later works are marked by pessimism, determinism, and nihilism. Although Twain was nostalgic about the innocence of children, the children in The Mysterious Stranger are light-years away from Tom and Huck. A Connecticut Yankee in King Arthur’s Court provides yet another example of public unwillingness to confront the complexity that was Twain. Twain’s novel satirizes the institutions, particularly chivalry and the Church, of medieval England, which is juxtaposed to turn-of-the-century America, represented by Hank Morgan, a believer in progress and technology. Morgan’s well-intentioned technology, however, ultimately produces only death. When Twain’s novel was adapted to film, it was bowdlerized into a musical starring Bing Crosby.
Twain was very much a product of his age. As a spokesman for an already vanishing frontier, he lampooned the pretense and the institutions of the East while he yearned for the lost values of youth and individualism. These nineteenth century values were in conflict with the twentieth century technology he first embraced and then, like Henry Adams, came to despise.
Bibliography
Brooks, Van Wyck. The Ordeal of Mark Twain. New York: E. P. Dutton, 1920. A seminal book on Mark Twain in which Twain is seen as a victim of his environment. Brooks’s book criticizes the role that Eastern respectability had in neutering Twain’s work and discusses the frontier as a negative influence.
DeVoto, Bernard. Mark Twain’s America. Boston: Little, Brown and Co., 1932. DeVoto’s book attacks the thesis espoused by Brooks and insists that the frontier, particularly frontier humor, actually made Twain a better writer. DeVoto’s book is seen as a healthy corrective to Brooks’s book.
Ferguson, John De Lancey. Mark Twain: Man and Legend. Indianapolis: Bobbs-Merrill Co., 1943. A well-written study that takes into account previous Twain scholarship. Contains some particularly interesting commentary on the significance of the river in Twain’s fiction.
Geismar, Maxwell. Mark Twain: An American Prophet. Boston: Houghton Mifflin Co., 1970. Geismar opposes the view that commercial interests and censorship weakened Twain’s work and claims that Twain’s greatness was partly a result of his lifelong interest in the past and in childhood.
Lynn, Kenneth S. Mark Twain and Southwestern Humor. Boston: Little, Brown and Co., 1959. A sympathetic treatment of Twain’s use of Southwestern folk humor in which Lynn discusses Twain’s artistic use of that humor.
Salomon, Roger B. Twain and the Image of History. New Haven, Conn.: Yale University Press, 1961. One of the best treatments of Twain’s conceptions of history and of human nature, Salomon’s book explores the role of the dream as a means of escaping the implications of Twain’s nihilism.
Smith, Henry Nash. Mark Twain: The Development of a Writer. Cambridge, Mass.: Harvard University Press, 1962. Smith traces Twain’s problems with style and structure in several of his novels, examines his ethical ideas, and discusses the conflict between contemporary culture and native American humor.
Tenney, Thomas Asa. Mark Twain: A Reference Guide. Boston: G. K. Hall and Co., 1977. The most comprehensive bibliography of Mark Twain scholarship, the book is indispensable to the Twain scholar.
Wagenknecht, Edward. Mark Twain: The Man and His Work. New Haven, Conn.: Yale University Press, 1935. Reprint. Norman: University of Oklahoma Press, 1967. A good overview of Twain and his work. Slightly changed from its first edition and contains a helpful bibliography.
Twain showed that literary art of international reputation could be made from the simplicities of rural American life and that the comic representation of that life did not necessarily have to patronize the actions and ideas of simple people trying to lead decent lives in a country still physically and intellectually unformed. He made Americans proud of his celebration of childhood innocence and childhood character and aware of the physical beauty and the psychological greatness of its midwestern landscape. He also showed that a comic writer need not eschew serious ideas and that the imagination of a writer of adventure literature could be used to consider serious human themes.
After his education was cut short by the death of a stern father who had more ambition than success, at the age of eleven Mark Twain was apprenticed to a newspaper office, which, except for the money earned from four years of piloting on the Mississippi, supplied most of his income until 1868. Then, he quickly won eminence as a lecturer and author before his marriage to wealthy Olivia Langdon in 1870 led to a memorably comfortable and active family life which included three daughters. Although always looking to his writing for income, he increasingly devoted energy to business affairs and investments until his publishing house declared bankruptcy in 1894. After his world lecture tour of 1895-1896, he became one of the most admired figures of his time and continued to earn honors until his death in 1910.
Mark Twain was born Samuel Langhorne Clemens in Florida, Missouri, in 1835. He first used the pen name Mark Twain, taken from the leadsman’s cry for two fathoms of water, in 1862. Twain’s father was a Virginia lawyer, and the family was of poor but respectable southern stock. In 1839, the family moved to Hannibal, Missouri, the Mississippi River town that provided the source material and background of some of Twain’s best-known fiction. After his father died in 1847, Twain left school to become an apprentice in the printing shop of his brother, Orion. From 1853 to 1856, Twain worked as a journeyman printer in St. Louis, New York, Philadelphia, Keokuk, and Cincinnati.
Between 1857 and 1860, Twain acquired much of his knowledge of the Mississippi River as a pilot, beginning that short though richly productive career under the tutelage of a senior pilot, Horace Bixby. He was a Confederate volunteer for several weeks after the American Civil War began. In 1861, he left for the Nevada Territory with Orion, where he drifted into prospecting and journalism, beginning his career as a reporter with the Virginia City Territorial Enterprise and continuing it with the San Francisco Morning Call.
Twain’s literary career and the beginning of his fame might be said to have begun in 1865 with the publication in the New York Saturday Press of “Jim Smiley and His Jumping Frog” (later known as “The Celebrated Jumping Frog of Calaveras County”). As a journalist, he went to the Sandwich Islands in 1866 and to Europe and the Holy Land in 1867. The latter of the two provided him with the experiences that he shaped into his first book, The Innocents Abroad. Hisnarrative of pioneers striving to establish civilization on the frontier, Roughing It, appeared in 1872, and his first novel-length fiction, The Gilded Age, written with Charles Dudley Warner, came in 1873.
In 1870, Twain married Olivia Langdon. After beginning their married life in Buffalo, New York, they resettled in Hartford, Connecticut, in 1871. Their infant son, Langdon, died in 1872, the year Susy, their first daughter, was born. Her sisters, Clara and Jean, were born in 1874 and 1880, respectively. Twain’s most productive years as a novelist came in this middle period when his daughters were young and he was prospering. The Adventures of Tom Sawyer, The Prince and the Pauper, Adventures of Huckleberry Finn, and A Connecticut Yankee in King Arthur’s Court were all written during this highly productive period.
By 1890, Twain’s financial fortunes were crumbling, mostly owing to bad investment in his own publishing firm and in the Paige typesetter. In 1891, he closed the Hartford mansion, sold the furniture, and went to Europe to economize. In 1896, after he completed a round-the-world lecture tour, his daughter, Susy, died, and his wife shortly afterward suffered a nervous collapse from which she never recovered. Twain blamed himself for bringing on his beloved family the circumstances that led to both tragedies. His abiding skepticism about human nature deepened to cynicism and found expression in those dark stories of his last years, such as “The Man That Corrupted Hadleyburg,” “The Mysterious Stranger,” and the essay “What Is Man?” Twain died in 1910 at the age of seventy-four in Redding, Connecticut.
Mark Twain was born Samuel Langhorne Clemens on November 30, 1835, in Florida, Missouri. Four years later, his family moved to Hannibal, Missouri, the fictionalized St. Petersburg of Adventures of Huckleberry Finn and Dawson’s Landing of The Tragedy of Pudd’nhead Wilson (1894). As a youth, Twain learned the printer’s trade, but in 1857 he fulfilled his boyhood dream of becoming a steamboat pilot, which he describes in “Old Times on the Mississippi” (1876) and Life on the Mississippi (1883). After the Civil War (1861-1865) ended commercial steamboat traffic on the Lower Mississippi River, he spent the next five years (1861-1866) as a miner and journalist in California and the Nevada Territory, an experience he later recounted in the highly fictionalized Roughing It (1872). It was during this period that he first used the pseudonym Mark Twain (a nautical term for two fathoms of water).
With the publication of “Jim Smiley and His Frog” (later republished as “The Celebrated Jumping Frog of Calaveras County”) in New York’s The Saturday Press in 1865, Twain came to national attention, not as a serious, respectable writer, however, but as a southwestern humorist. He traveled to the Sandwich Islands (Hawaii), lectured widely, and in 1867 he toured the Mediterranean and Holy Land, culling material for his masterwork of American-style humorous irreverence, The Innocents Abroad (1869).
Twain’s marriage to Olivia Langdon, the daughter of a New York coal baron, in 1870, had a double effect. It not only provided him with the emotional and social stability he craved but also further accentuated the division in his own personality, the split between the frontier humorist whose work and person were not tolerated in polite company and the serious writer who longed for literary and social acceptance. Continuing to mine his own experiences for literary material, Twain produced his two best-known works, The Adventures of Tom Sawyer (1876) and Adventures of Huckleberry Finn. His business ventures during the 1880’s and early 1890’s, such as the formation of his own publishing firm, Charles L. Webster and Company, and his obsession with new inventions, especially the Paige automatic typesetter, brought about his bankruptcy in 1894.
From mid-1895 to mid-1896, Twain went on a lecture tour around the world in order to pay off his creditors in full. His behavior was a matter of personal obligation rather than legal necessity. Although by 1904 he was once again prosperous and celebrated, the memory of the earlier bankruptcy and the deaths of his wife and daughter darkened his final years and caused him to accentuate the pessimistic strain that had never been very far from the surface of even his most humorous work. His gloom, in particular his growing belief that human life was entirely determined and as entirely devoid of meaning, led him to suppress certain works that he believed were too shocking for publication and to leave others, including his “mysterious stranger” manuscripts, unfinished. “The Lincoln of our literature,” as his friend William Dean Howells called him, died on April 21, 1910.
Mark Twain was born Samuel Langhorne Clemens in Florida, Missouri, on November 30, 1835. His father and mother both came from old Virginia families. His father was trained as a lawyer; somewhat feckless and unsuccessful in business, he moved slowly westward, involving himself in land speculation. In 1839, the family reached Hannibal, Missouri, a small town on the Mississippi River upriver from St. Louis, and it was there that Twain spent his early childhood and developed his love of the great river.
His father died when Twain was twelve years old, and Twain left school to learn the trade of printing, which his brother had entered before him. Twain spent several years as a roving journeyman printer, working as far east as New York City. In 1857, he was taken on by Horace Bixby, who trained him as a Mississippi steamboat pilot, a trade he practiced until the Civil War. The war wrecked the Mississippi River traffic, so in 1861 he went with his brother, Orion, to Carson City, Nevada, where Orion worked as a secretary in the new territorial government. Twain drifted into silver mining and eventually back to journalism with the Virginia City Territorial Enterprise. It was in 1862 that he first adopted the pen name Mark Twain. Within a few years, while writing for newspapers in San Francisco, his composition of short sketches and stories was encouraged by Bret Harte.
Twain was developing a minor reputation as a humorist and lecturer in the mid-1860’s, but it was the publication of “The Celebrated Jumping Frog of Calaveras County” in 1865 in the New York Saturday Press that brought him countrywide attention. He had a further success with a series of articles about a trip to Hawaii, commissioned by the Sacramento Union in 1866, and from then on he was able to make a living on the lecture circuit. The first major work to come out of this was The Innocents Abroad (1869), which was received with considerable praise, tempered by some criticism of the author’s Western lack of polish and discretion.
His experience as a Mississippi pilot and his wandering life as a printer, writer, and jack-of-all-trades gave him the raw material for a successful career as a writer and a lecturer. In 1870, he was able to marry Olivia Langdon of Elmira, New York, the daughter of a respected member of the eastern establishment. In 1870, Twain became joint owner and editor of the Buffalo, New York, newspaper the Express, but two years later he sold his interest, having lost a considerable amount of money in the project. He withdrew from newspaper work to Hartford, Connecticut, where he was to spend the following two decades and where he settled seriously into his career as a novelist. Some critics have suggested that this entrance into genteel social life affected the power of his work, but it was after this date that The Adventures of Tom Sawyer (1876), Adventures of Huckleberry Finn (1884), and, indeed, all of his major novels were to be written.
Twain was never to forget his past, and his greatest book, Adventures of Huckleberry Finn, and his greatest nonfiction work, Life on the Mississippi (1883), are directly related to the time and place of his early experiences as a child and a young man. However long he remained away from the Midwest, he was never to lose his allegiance to it, and the somewhat rough-cast quality of his humor, which is often seen as an integral part of his literary gift, has a rural, Western tang to it which no amount of New England gentility could ever expunge.
It is probably fair to say that his best work was done by the end of the 1880’s. Certainly it is true that his work after that time becomes much more pessimistic, and the publications of the 1890’s are his least read, and certainly least popular, titles, although he continued to write into the twentieth century.
The reasons for the change from comic happiness to work of misanthropic gloom are complicated. There were occasional moments of cruelty in his work from the beginning, and he could be satirically sharp, as he showed as early as The Innocents Abroad. There clearly is a quantitative increase in human stupidity and violence from work to work through the period prior to 1890. A Connecticut Yankee in King Arthur’s Court, published in 1889, if still ripe with the richness of invention that was one of his gifts, is a much more violent book than anything he had produced previously, and it rejects the happy endings of many of his early novels. So the tendency was there, and the works leading through the period between the late 1860’s to the beginning of the 1890’s show an interesting pattern of slowly increasing seriousness and pessimism.
In the 1890’s, Twain’s life outside literature added to his pessimism. He lost a large amount of money early in the decade in a business proposition. His health began to fail, and the ill health and eventual deaths of his two daughters and his wife plunged him into unmitigated sorrow through the 1890’s and into the early years of the twentieth century. The literature produced in this period clearly reflects not only his increasing pessimism as he grew older but also the unimpeded run of bad luck and personal sorrow that he experienced up to his own death in 1910. This is the Twain known in the main to the critics; it does not detract from his reputation as one of the great comic writers or from his reputation as the writer of, perhaps, the best book ever written about the joys of being a young boy, free at last on the great river.
Twain did, however, write a considerable amount of material during the l890’s. His financial difficulties hardly allowed him to stop working, and he spent a lot of time both in the United States and internationally on the lecture circuit, amusing audiences. Following the Equator (1897) reveals his feelings about the experience of appearing publicly as the smiling, professional humorist at a time when his personal life was so unhappy. The book that is best known from this period is The Tragedy of Pudd’nhead Wilson (1894), and it carries the stamp of Twain’s deepening pessimism. He wrote a further handful of books, but the gloom was undiminished in all of his later work. He died in 1910, having lost his wife in 1904, as something of an enigma, a man of sometimes fierce misanthropic impulses who had begun his career as the sunniest of men.
Mark Twain’s most famous work, Adventures of Huckleberry Finn, has been banned in classrooms and libraries since its first year of American publication, 1885. At the prodding of Louisa May Alcott, the public library of Concord, Massachusetts, banned the book, charging that it was unsuitable for impressionable young people. Such criticism died down until the racially charged environment of the 1960’s, when African Americans began calling the novel “racist trash.” Attempts to ban the book achieved prominent attention as in 1989, when a black administrator of an intermediate school named after Mark Twain in Fairfax, Virginia, pushed to ban the book.
Other censored works by Mark Twain include The Adventures of Tom Sawyer (1876), which the Brooklyn Library in New York banned on its publication, calling it too coarse for young readers. During Mark Twain’s brief 1864 stint as a news reporter for the San Francisco Call, his editor censored and suppressed his articles exposing social problems and police misconduct in order not to offend the paper’s largely white and working- class readers. Anti-British sentiments expressed in the novel A Connecticut Yankee in King Arthur’s Court (1889) and the travel book Following the Equator (1897) provoked mild attempts to ban these books in Great Britain. Communist nations, particularly the Soviet Union and China, have banned some of Mark Twain’s work as “bourgeois” literature, while simultaneously lionizing his antireligious and anti-imperialistic writings.
Family and Friends
As a printer’s apprentice on Missouri newspapers, the young Sam Clemens wrote occasional articles, but felt constrained by his older brother, Orion Clemens, who restricted his humorous jibes. Conflicts with Orion contributed to his leaving Hannibal in 1853 for the East Coast, where he worked as a printer. Mark Twain’s real career as a writer began in Nevada in 1862, when he became a reporter for the Virginia City Territorial Enterprise. After one of his irreverent sketches that was reprinted in an Iowa newspaper offended his mother and sister, he asked to have his initials removed from later sketches republished in the East so not to upset his female relatives.
In later years friends such as fellow writer and Atlantic Monthly editor William Dean Howells and Mary Mason Fairbanks both provided editorial suggestions and cuts to his works they felt might offend potential readers. Fairbanks persuaded Mark Twain to tone down his barbs at religion in the 1867 travel letters he wrote from Europe and the Holy Land that became the basis for his hugely popular book Innocents Abroad (1869). In later years, when he became concerned with maintaining appearances of propriety, Mark Twain himself allowed friends and family members to suggest deletions and changes in his writings. However, he often rankled under their suggestions, which he did not always accept.
His wife, Livy, was particularly concerned about his use of coarse language. For example, she persuaded him to rephrase “combed it all to hell” to “combed it all to thunder” in Adventures of Huckleberry Finn. Despite later claims that Livy’s censorship blunted Mark Twain’s satirical potential, her suggestions helped him to improve his literary style and to retain his reading audience, and he was grateful for her assistance.
During Mark Twain’s last years, his daughters provided editorial advice, particularly when his political essays grew too brutal and harsh. His polemic King Leopold’s Soliloquy (1906), for example, was found so scathing it was determined unsuitable for magazine publication, and was instead issued as a pamphlet. His daughter Jean helped persuade him not to publish his bitter antiwar polemic, “The War Prayer.” After Mark Twain died, another daughter, Clara, instructed the author of a short book about his time in Bermuda not to include potentially compromising photographs of him with young girls. She believed that readers might misconstrue his affection for the children.
Sex
As a Victorian era male, Mark Twain was uneasy about publishing overtly sexual material in his writings. He effectively censored himself by simply avoiding the subject. For example, his books Roughing It (1872) and Life on the Mississippi (1883) do not even hint at the existence of prostitution in western mining towns or on Mississippi steamboats. His autobiographical pieces, such as a memoir of Hannibal village residents that he wrote in 1897, deliberately sentimentalized his childhood, avoiding references to adultery and sexual practices of which he was clearly aware.
Mark Twain did, however, occasionally write scatological pieces privately, such as 1601 (written in 1876), a bawdy parody on Elizabethan manners. In 1879 he delivered a speech on masturbation, “Some Thoughts on the Science of Onanism,” in Paris. Mark Twain had 1601 privately printed in the 1880’s and many unauthorized editions followed, but his “Onanism” speech was not published until 1964—in Fact and Playboy magazines.
Philosophical Issues
Throughout his life, Mark Twain was interested in censorship. He observed the censorship of other authors, repeatedly decrying attackers of his philosophical mentor, essayist Thomas Paine. He defended poet Walt Whitman while advising that Whitman’s Leaves of Grass be kept out of children’s hands because of its sexual frankness. A “Pudd’nhead Wilson” maxim in Following the Equator summed up his feelings on free expression:
It is by the goodness of God that in our country we have those three unspeakably precious things: freedom of speech, freedom of conscience, and the prudence never to practice either of them.
Central to Mark Twain’s experiences with censorship were his views on Christianity. His attacks on religion resulted in a series of suppressions that continued fifty years after his death. For example, his anonymously published book What Is Man? (1906)—which he called his “Bible”—was tightly restricted; Mark Twain issued only 250 copies during his lifetime. He began writing Extract from Captain Stormfield’s Visit to Heaven in 1881, but did not publish it until 1909 because he believed it could never be published “unless I trim it like everything.”
One of the most egregious examples of censorship of Mark Twain’s writings was his literary executor Albert Bigelow Paine’s publication of The Mysterious Stranger in 1916. Although Paine represented this book as a novel written by Mark Twain, the published book was in fact a heavily edited and substantially rewritten version of two different manuscripts that Mark Twain had left unpublished. Among the many changes that Paine and Harper editor Frederick Duneka made was replacing an evil Roman Catholic priest with a nonsectarian astrologer and removing all direct references to the Catholic church.
Five chapters of his autobiography that Mark Twain dictated in 1906 that were titled “Reflections on Religion” were suppressed by Mark Twain himself, Paine, and sole surviving daughter, Clara Clemens, until 1963. The selections finally appeared in the Hudson Review after two other magazines rejected them as too inflammatory. Mark Twain himself had directed that the passages not be published until a hundred years after his death. At the time he dictated them, he wrote to his friend Howells saying, “Tomorrow I mean to dictate a chapter that will get my heirs and assigns burnt alive if ever they venture to print it this side of 2006 a.d.—which I judge they won’t.” On some manuscripts, he prohibited publication for five centuries. These directives, which converged with the desires of his family and literary heirs, created one of the most interesting episodes of censorship in American literary history.
Posthumous Censorship
After Mark Twain died, his daughter Clara and his literary executor, Paine, suppressed and selectively edited for publication many of his previously unpublished manuscripts in order to preserve his image as a wholesome, kindly funnyman. Some of their efforts followed Mark Twain’s own instructions. In other cases, however, decisions to censor arose from Clara’s and Paine’s own biases. For example, Paine’s authorized biography of Mark Twain virtually ignores Mark Twain’s personal secretary Isabel Lyon, whom Clara disliked. More often, however, Paine—who controlled publication of Mark Twain’s manuscripts until his own death in 1935—was simply reluctant to publish anything negative about Mark Twain.
After Paine died, Clara frequently quarreled with Bernard DeVoto, who succeeded Paine as her father’s literary editor. DeVoto—an accomplished scholar in his own right—wished to publish manuscripts that Clara feared might offend relatives of persons Mark Twain criticized in his autobiographical passages. DeVoto had earlier been hindered by Paine’s refusal to let him inspect unpublished manuscripts. Unlike Paine or Clara, DeVoto understood the purely commercial value of keeping Mark Twain scholarship alive and controversial. He believed that Mark Twain’s autobiography manuscripts—which he had composed with publication in mind—should not be edited or suppressed. After DeVoto published a selection of his material in Mark Twain in Eruption (1940), he discovered that Clara had suppressed passages without his knowledge. For this and other reasons, he resigned his position as editor of the Mark Twain Papers in frustration.
Clara also rigorously opposed publication of her father’s Letters from the Earth, a savage satire on Christian beliefs that DeVoto prepared for publication in 1939. Mark Twain himself had worried about publishing this material. In 1909 he wrote to a friend saying that the book “will never be published—in fact it couldn’t be because it would be a felony.” Shortly before her own death in 1962, Clara finally consented to publication of Letters from the Earth. By then she realized that her father’s religious ideas were well known, and that Americans were more tolerant of dissenting views of religion than in her father’s time.
Meanwhile, Clara had refused to allow publication of the “Reflections on Religion” passages in Charles Neider’s 1959 edition, Autobiography of Mark Twain. She believed that communists might find support for their ideology in her father’s attacks on the Christian god, and she feared his sacrilegious opinions might provoke social turmoil and invite attacks on his reputation. She told Neider that publication of The Mysterious Stranger had already established her father’s darker philosophical side, and that she did not want him perceived as “a dark angel.” Clara was also privately unhappy with her father’s negative writings on Mary Baker Eddy, the founder of Christian Science, as she was a member of that denomination.
After Neider noted Clara’s refusal to publish the religion passages in the introduction to his edition of the autobiography, the Soviet Union’s Literary Gazette published an editorial claiming that Mark Twain was being officially censored in his home country. These charges finally moved Clara to permit Neider to publish the “Reflections” passages—but not as part of the autobiography. Neider’s publisher, Harper & Row, agreed that the material did not belong in a “family book.” Even after Clara’s death, and after publication of “Reflections” in the Hudson Review in 1963, another twenty-three years elapsed before the passages appeared in book form, in Neider’s, The Outrageous Mark Twain (1987). A number of clergymen reacted against the piece, including Roman Catholic bishop Norman Vincent Peale, who accused Mark Twain of cowardice for not having published the material in his own lifetime.
After Clara’s death, other long-suppressed Mark Twain works—including many he had never intended for publication—began appearing in books edited by the Mark Twain Papers project at the University of California at Berkeley. Such project publications as What Is Man? and Other Philosophical Writings (1973), Which Was the Dream? and Other Symbolic Writings of the Later Years (1967), Fables of Man (1972), and The Devil’s Race-Track: Mark Twain’s Great Dark Writings (1980) contain unfinished novels, sketches, and literary fragments that had either never been previously published or that had appeared only in magazines or newspapers.
Bibliography
Briden, Earl F. “Twainian Pedagogy and the No- Account Lessons of ‘Hadleyburg.’” Studies in Short Fiction 28 (Spring, 1991): 125-234. Argues that within the context of Twain’s skepticism about man’s capacity for moral education “The Man That Corrupted Hadleyburg” is not a story about a town’s redemptive lessons of sin but rather an exposé about humanity’s inability to learn morality from either theory or practice, abstract principle or moral pedagogy.
Camfield, Gregg. The Oxford Companion to Mark Twain. New York: Oxford University Press, 2003. Collection of original essays, including several by other scholars, on diverse aspects of Twain’s life and writing, with encyclopedia reference features.
Emerson, Everett. Mark Twain: A Literary Life. Philadelphia: University of Pennsylvania Press, 2000. A complete revision of Emerson’s The Authentic Mark Twain (1984), this masterful study traces the development of Twain’s writing against the events in his life and provides illuminating discussions of many individual works.
Fishkin, Shelley Fisher. Lighting Out for the Territory: Reflections on Mark Twain and American Culture. New York: Oxford University Press, 1996. A broad survey of Mark Twain’s influence on modern culture, including the many writers who have acknowledged their indebtedness to him; discusses Twain’s use of Hannibal, Missouri, in his writings; charts his transformation from a southern racist to a committed antiracist.
Fulton, Joe B. Mark Twain in the Margins: The Quarry Farm Marginalia and “A Connecticut Yankee in King Arthur’s Court.” Alabama, 2000. An examination of the marginalia that Fulton finds revealing of the development of Twain’s Connecticut Yankee.
Kaplan, Justin. Mr. Clemens and Mark Twain. New York: Simon & Schuster, 1966. Pulitzer Prize-winning biography is a superior general work on Twain’s life after 1861.
Lauber, John. The Inventions of Mark Twain. New York: Hill and Wang, 1990. Very well-written and often humorous, this biography reveals Twain as an extremely complex, self-contradictory individual. Includes an annotated bibliography.
LeMaster, J. R., and James D. Wilson, eds. The Mark Twain Encyclopedia. New York: Garland, 1993. Comprehensive reference work broadly similar in organization to Rasmussen’s Mark Twain A to Z, differing in devoting most of its space to literary analysis.
Leonard, James. S., ed. Making Mark Twain Work in the Classroom. Durham, N.C.: Duke University Press, 1999. Collection of essays by leading Twain scholars designed for students and teachers. Special attention is given to A Connecticut Yankee in King Arthur’s Court, Joan of Arc, Innocents Abroad, and Adventures of Huckleberry Finn.
Messent, Peter B. Mark Twain. New York: St. Martin’s Press, 1997. A standard introduction to Twain’s life and works. Provides bibliographical references and an index.
Messent, Peter B. The Short Works of Mark Twain: A Critical Study. Philadelphia: University of Pennsylvania Press, 2001. Detailed exploration of Twain’s shorter works that takes the innovative approach of examining how Twain planned the individual collections in which they were first published in book form.
Paine, Albert Bigelow. Mark Twain: A Biography. 3 vols. 1912. Reprint. Philadelphia: Chelsea House, 1997. Often reprinted, this immense study by Twain’s authorized biographer and editor remains the fullest study of Twain’s life and benefits from Paine’s close personal acquaintance with Twain and his access to sources that no longer exist.
Sanborn, Margaret. Mark Twain: The Bachelor Years. New York: Doubleday, 1990. This biography covers the adventure-filled years from the author’s boyhood to marriage in 1870 at age thirty-four. Based on extensive research into letters written to Twain’s mother, sister, brothers, and close friends. Includes many letters not referenced by Twain’s official biographer, Albert Bigelow Paine. Also includes valuable insights gained from 184 letters written between 1868 and 1870, while courting Olivia Langdon, whom Twain eventually married.
Sloane, David E. E. Student Companion to Mark Twain. New York: Greenwood Press, 2001. Essays on aspects of Twain’s life, with special chapters on individual books.
Smith, Henry Nash. Mark Twain: A Collection of Critical Essays. Englewood Cliffs, N.J.: Prentice-Hall, 1963. A collection of essays with an introduction by Smith. Among the contributors is W. H. Auden. A chronology of important dates in the author’s life is also included.
Twain, Mark. Adventures of Huckleberry Finn. University of California, 2001. The complete original manuscript, including more than six hundred excised pages.
Wagenknecht, Edward. Mark Twain: The Man and His Work. 3d ed. Norman: University of Oklahoma Press, 1967. A thorough revision of the 1935 work in which Wagenknecht considers the vast historical and critical study conducted between 1935 and 1960. He has modified many of his original ideas, most notably, that Mark Twain was “The Divine Amateur.” The original chapter with that title has been rewritten and renamed “The Man of Letters.”
Ward, Geoffrey C., and Dayton Duncan. Mark Twain: An Illustrated Biography. New York: Alfred A. Knopf, 2001. A heavily illustrated companion to the PBS television documentary. More than a picture book, however, this volume provides ample biographical information that is well researched and thoughtfully presented.
Wilson, James D. A Reader’s Guide to the Short Stories of Mark Twain. Boston: G. K. Hall, 1987. Detailed summaries and analyses of sixty-five stories, including several that appear within Twain’s travel books.
Wonham, Henry B. Mark Twain and the Art of the Tall Tale. New York: Oxford University Press, 1993. Discusses how Twain used the tall-tale conventions of interpretive play, dramatic encounters, and the folk community. Focuses on the relationship between storyteller and audience in Twain’s fiction.
Mark Twain is both the greatest humorist American literature has produced and one of its most important novelists. Born Samuel Langhorne Clemens, the son of John Marshall and Jane Lampton Clemens, in the small town of Florida, Missouri, he spent his boyhood in nearby Hannibal on the banks of the Mississippi River, a setting that would figure prominently in many of his best works. His father died before he turned twelve, and he quit school and went to work as a printer’s apprentice a few years later. While working on his older brother’s newspaper, he began writing humorous sketches. In 1852, he published his first piece in the East, “The Dandy Frightening the Squatter,” which appeared in a Boston magazine. A year later, he left Hannibal and found work as a printer in several eastern cities before deciding, at the age of twenty-one, to set out for South America. While traveling down the Mississippi River by steamboat, however, he altered his plans and persuaded a steamboat pilot to teach him his trade.{$S[A]Clemens, Samuel Langhorne;Twain, Mark}
Twain’s career as a pilot was cut short by the Civil War, and after a two-week stint in a Missouri militia unit, he went with his brother to Nevada. There, he made unsuccessful forays into silver mining and adopted the pseudonym “Mark Twain”—a nautical phrase meaning two fathoms deep—while working for a Virginia City newspaper. After relocating to San Francisco, he wrote the story that would win him national recognition, “The Celebrated Jumping Frog of Calaveras County” (early titles vary). The story shows Twain already a master of the deadpan, Western-flavored tall tale, and its use of dialect introduces the idiomatic style that would help earn him a place among the giants of American literature.
As a reporter for the Sacramento Union, Twain traveled to Hawaii in 1866 and sent home humorous travel sketches in the form of letters. In 1867, he embarked for Europe and the Holy Land as a newspaper travel correspondent, and his revised and expanded sketches were published in his first major book in 1869, The Innocents Abroad. That book’s immense popularity soon made its author a familiar figure on the lecture circuit. In 1870, Twain married Olivia Langdon, with whom he had four children, only one of whom outlived him. The couple eventually resettled in Hartford, Connecticut, where they remained for twenty years. Roughing It, Twain’s comical recollections of his time in the West, was published in 1872 and was followed the next year by The Gilded Age, a social and political satire that he cowrote with his friend Charles Dudley Warner.
In 1876, Twain published what would become one of his best-loved novels, The Adventures of Tom Sawyer. Drawing on his memories of his childhood in Hannibal, Twain created a rollicking portrait of an American boyhood characterized by high spirits, a thirst for adventure, and an irrepressible talent for mischief. The book became a classic and has never been out of print.
In 1884, Twain completed a novel he had begun eight years earlier. Generally acknowledged as his greatest work, Adventures of Huckleberry Finn is a scathing social satire disguised as a young boy’s adventure. During the course of Huck’s trip downriver with the runaway slave Jim, he encounters the hypocrisy, greed, and cruelty of “civilized” society and notes, in the book’s famous final passage, “I reckon I got to light out for the Territory ahead of the rest, because Aunt Sally she’s going to adopt me and sivilize me, and I can’t stand it. I been there before.” Criticized as crude and vulgar by some at the time of its publication, Adventures of Huckleberry Finn has since entered the ranks of the most important and influential American novels; it was praised by Ernest Hemingway as the beginning of modern American fiction.
Although Twain’s final years were marred by business failures and personal sorrow (the deaths of his wife and two daughters), Twain found himself a celebrated and beloved public figure, recognized throughout the world and a legend in his own time. His last years were devoted to philosophical works, often dark and bitter in tone, and to his autobiography, a portion of which was edited and published after his death by his official biographer, Albert Bigelow Paine. When Twain died of heart disease in 1910, he left an immense body of unpublished writings in various stages of completion.
Mark Twain’s reputation as a writer has grown in the years since his death as the richness of his legacy has come to be appreciated by subsequent generations of readers and critics. He is often credited with giving American literature its first uniquely American voice, and the color and vibrancy of his work stand in stark contrast to the elegant language and seriousness of tone that mark other nineteenth century novels. Yet Twain’s command of language was one of his chief strengths, and his genius lay in his ability to make even the roughest of dialects serve his purposes as eloquently as the most refined and educated of accents. Twain brought the energy and truth-stretching humor of the West to his work and used it to entertain society with an account of its own foibles and vices.
Mark Twain (Samuel Langhorne Clemens) was born in Hannibal, Missouri, on November 30, 1835. He had two brothers and a sister. A slave named Jenny worked for the family, and it is thought that her storytelling had a strong influence on the young Twain. He traveled extensively, working in various jobs, including a stint on a newspaper and one as a riverboat pilot. He supposedly took his pseudonym from the way a river's depth was measured: a piece of line with knots at three-foot intervals was dropped into the river, and when the rope hit bottom, the depth was called out to the pilot. Therefore, “Mark Twain” or “two knots” literally means “six feet.”
In 1864, Twain left for San Francisco where he worked as a reporter. After a trip to Hawaii for The Sacramento Union, he began giving lectures. Later, in 1869, he wrote The Innocents Abroad based on his experiences traveling in France and Italy. The book was immensely popular, and Twain's sharp, humorous barbs set him apart from most other writers of the time.
Twain married Olivia Langdon in 1870, and between 1876 and 1884, he wrote Tom Sawyer, The Prince and The Pauper, and The Adventures of Huckleberry Finn. Twain also became a very popular lecturer, drawing huge crowds to hear him read his own works.
Family tragedies, including the death of his beloved daughter, and a series of bad financial investments left him bitter and depressed in his old age. His later writings, most of which were published posthumously, reflect his disappointment at what he saw were grave weaknesses and flaws in human nature.
Mark Twain died in 1910; his death, like his birth, coincided with the appearance of Halley's Comet.
Today, he is thought of as both a fine humorist with an uncanny ear for speech and the first truly modern American novelist, adept at pointing out hypocrisy and the inconsistencies in human nature. |
{
"name": "tlmgr-electron-react",
"version": "0.0.1",
"lockfileVersion": 1,
"requires": true,
"dependencies": {
"@types/node": {
"version": "8.10.29",
"resolved": "https://registry.npmjs.org/@types/node/-/node-8.10.29.tgz",
"integrity": "sha512-zbteaWZ2mdduacm0byELwtRyhYE40aK+pAanQk415gr1eRuu67x7QGOLmn8jz5zI8LDK7d0WI/oT6r5Trz4rzQ==",
"dev": true
},
"ajv": {
"version": "5.5.2",
"resolved": "https://registry.npmjs.org/ajv/-/ajv-5.5.2.tgz",
"integrity": "sha1-c7Xuyj+rZT49P5Qis0GtQiBdyWU=",
"dev": true,
"requires": {
"co": "^4.6.0",
"fast-deep-equal": "^1.0.0",
"fast-json-stable-stringify": "^2.0.0",
"json-schema-traverse": "^0.3.0"
}
},
"ansi-regex": {
"version": "2.1.1",
"resolved": "https://registry.npmjs.org/ansi-regex/-/ansi-regex-2.1.1.tgz",
"integrity": "sha1-w7M6te42DYbg5ijwRorn7yfWVN8="
},
"ansi-styles": {
"version": "2.2.1",
"resolved": "https://registry.npmjs.org/ansi-styles/-/ansi-styles-2.2.1.tgz",
"integrity": "sha1-tDLdM1i2NM914eRmQ2gkBTPB3b4="
},
"array-find-index": {
"version": "1.0.2",
"resolved": "https://registry.npmjs.org/array-find-index/-/array-find-index-1.0.2.tgz",
"integrity": "sha1-3wEKoSh+Fku9pvlyOwqWoexBh6E=",
"dev": true
},
"asap": {
"version": "2.0.6",
"resolved": "https://registry.npmjs.org/asap/-/asap-2.0.6.tgz",
"integrity": "sha1-5QNHYR1+aQlDIIu9r+vLwvuGbUY="
},
"asn1": {
"version": "0.2.4",
"resolved": "https://registry.npmjs.org/asn1/-/asn1-0.2.4.tgz",
"integrity": "sha512-jxwzQpLQjSmWXgwaCZE9Nz+glAG01yF1QnWgbhGwHI5A6FRIEY6IVqtHhIepHqI7/kyEyQEagBC5mBEFlIYvdg==",
"dev": true,
"requires": {
"safer-buffer": "~2.1.0"
}
},
"assert-plus": {
"version": "1.0.0",
"resolved": "https://registry.npmjs.org/assert-plus/-/assert-plus-1.0.0.tgz",
"integrity": "sha1-8S4PPF13sLHN2RRpQuTpbB5N1SU=",
"dev": true
},
"asynckit": {
"version": "0.4.0",
"resolved": "https://registry.npmjs.org/asynckit/-/asynckit-0.4.0.tgz",
"integrity": "sha1-x57Zf380y48robyXkLzDZkdLS3k=",
"dev": true
},
"aws-sign2": {
"version": "0.7.0",
"resolved": "https://registry.npmjs.org/aws-sign2/-/aws-sign2-0.7.0.tgz",
"integrity": "sha1-tG6JCTSpWR8tL2+G1+ap8bP+dqg=",
"dev": true
},
"aws4": {
"version": "1.8.0",
"resolved": "https://registry.npmjs.org/aws4/-/aws4-1.8.0.tgz",
"integrity": "sha512-ReZxvNHIOv88FlT7rxcXIIC0fPt4KZqZbOlivyWtXLt8ESx84zd3kMC6iK5jVeS2qt+g7ftS7ye4fi06X5rtRQ==",
"dev": true
},
"babel-code-frame": {
"version": "6.26.0",
"resolved": "https://registry.npmjs.org/babel-code-frame/-/babel-code-frame-6.26.0.tgz",
"integrity": "sha1-Y/1D99weO7fONZR9uP42mj9Yx0s=",
"requires": {
"chalk": "^1.1.3",
"esutils": "^2.0.2",
"js-tokens": "^3.0.2"
}
},
"babel-core": {
"version": "6.26.3",
"resolved": "https://registry.npmjs.org/babel-core/-/babel-core-6.26.3.tgz",
"integrity": "sha512-6jyFLuDmeidKmUEb3NM+/yawG0M2bDZ9Z1qbZP59cyHLz8kYGKYwpJP0UwUKKUiTRNvxfLesJnTedqczP7cTDA==",
"requires": {
"babel-code-frame": "^6.26.0",
"babel-generator": "^6.26.0",
"babel-helpers": "^6.24.1",
"babel-messages": "^6.23.0",
"babel-register": "^6.26.0",
"babel-runtime": "^6.26.0",
"babel-template": "^6.26.0",
"babel-traverse": "^6.26.0",
"babel-types": "^6.26.0",
"babylon": "^6.18.0",
"convert-source-map": "^1.5.1",
"debug": "^2.6.9",
"json5": "^0.5.1",
"lodash": "^4.17.4",
"minimatch": "^3.0.4",
"path-is-absolute": "^1.0.1",
"private": "^0.1.8",
"slash": "^1.0.0",
"source-map": "^0.5.7"
}
},
"babel-generator": {
"version": "6.26.1",
"resolved": "https://registry.npmjs.org/babel-generator/-/babel-generator-6.26.1.tgz",
"integrity": "sha512-HyfwY6ApZj7BYTcJURpM5tznulaBvyio7/0d4zFOeMPUmfxkCjHocCuoLa2SAGzBI8AREcH3eP3758F672DppA==",
"requires": {
"babel-messages": "^6.23.0",
"babel-runtime": "^6.26.0",
"babel-types": "^6.26.0",
"detect-indent": "^4.0.0",
"jsesc": "^1.3.0",
"lodash": "^4.17.4",
"source-map": "^0.5.7",
"trim-right": "^1.0.1"
},
"dependencies": {
"jsesc": {
"version": "1.3.0",
"resolved": "https://registry.npmjs.org/jsesc/-/jsesc-1.3.0.tgz",
"integrity": "sha1-RsP+yMGJKxKwgz25vHYiF226s0s="
}
}
},
"babel-helper-builder-react-jsx": {
"version": "6.26.0",
"resolved": "https://registry.npmjs.org/babel-helper-builder-react-jsx/-/babel-helper-builder-react-jsx-6.26.0.tgz",
"integrity": "sha1-Of+DE7dci2Xc7/HzHTg+D/KkCKA=",
"requires": {
"babel-runtime": "^6.26.0",
"babel-types": "^6.26.0",
"esutils": "^2.0.2"
}
},
"babel-helper-call-delegate": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-helper-call-delegate/-/babel-helper-call-delegate-6.24.1.tgz",
"integrity": "sha1-7Oaqzdx25Bw0YfiL/Fdb0Nqi340=",
"requires": {
"babel-helper-hoist-variables": "^6.24.1",
"babel-runtime": "^6.22.0",
"babel-traverse": "^6.24.1",
"babel-types": "^6.24.1"
}
},
"babel-helper-define-map": {
"version": "6.26.0",
"resolved": "https://registry.npmjs.org/babel-helper-define-map/-/babel-helper-define-map-6.26.0.tgz",
"integrity": "sha1-pfVtq0GiX5fstJjH66ypgZ+Vvl8=",
"requires": {
"babel-helper-function-name": "^6.24.1",
"babel-runtime": "^6.26.0",
"babel-types": "^6.26.0",
"lodash": "^4.17.4"
}
},
"babel-helper-function-name": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-helper-function-name/-/babel-helper-function-name-6.24.1.tgz",
"integrity": "sha1-00dbjAPtmCQqJbSDUasYOZ01gKk=",
"requires": {
"babel-helper-get-function-arity": "^6.24.1",
"babel-runtime": "^6.22.0",
"babel-template": "^6.24.1",
"babel-traverse": "^6.24.1",
"babel-types": "^6.24.1"
}
},
"babel-helper-get-function-arity": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-helper-get-function-arity/-/babel-helper-get-function-arity-6.24.1.tgz",
"integrity": "sha1-j3eCqpNAfEHTqlCQj4mwMbG2hT0=",
"requires": {
"babel-runtime": "^6.22.0",
"babel-types": "^6.24.1"
}
},
"babel-helper-hoist-variables": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-helper-hoist-variables/-/babel-helper-hoist-variables-6.24.1.tgz",
"integrity": "sha1-HssnaJydJVE+rbyZFKc/VAi+enY=",
"requires": {
"babel-runtime": "^6.22.0",
"babel-types": "^6.24.1"
}
},
"babel-helper-optimise-call-expression": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-helper-optimise-call-expression/-/babel-helper-optimise-call-expression-6.24.1.tgz",
"integrity": "sha1-96E0J7qfc/j0+pk8VKl4gtEkQlc=",
"requires": {
"babel-runtime": "^6.22.0",
"babel-types": "^6.24.1"
}
},
"babel-helper-regex": {
"version": "6.26.0",
"resolved": "https://registry.npmjs.org/babel-helper-regex/-/babel-helper-regex-6.26.0.tgz",
"integrity": "sha1-MlxZ+QL4LyS3T6zu0DY5VPZJXnI=",
"requires": {
"babel-runtime": "^6.26.0",
"babel-types": "^6.26.0",
"lodash": "^4.17.4"
}
},
"babel-helper-replace-supers": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-helper-replace-supers/-/babel-helper-replace-supers-6.24.1.tgz",
"integrity": "sha1-v22/5Dk40XNpohPKiov3S2qQqxo=",
"requires": {
"babel-helper-optimise-call-expression": "^6.24.1",
"babel-messages": "^6.23.0",
"babel-runtime": "^6.22.0",
"babel-template": "^6.24.1",
"babel-traverse": "^6.24.1",
"babel-types": "^6.24.1"
}
},
"babel-helpers": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-helpers/-/babel-helpers-6.24.1.tgz",
"integrity": "sha1-NHHenK7DiOXIUOWX5Yom3fN2ArI=",
"requires": {
"babel-runtime": "^6.22.0",
"babel-template": "^6.24.1"
}
},
"babel-messages": {
"version": "6.23.0",
"resolved": "https://registry.npmjs.org/babel-messages/-/babel-messages-6.23.0.tgz",
"integrity": "sha1-8830cDhYA1sqKVHG7F7fbGLyYw4=",
"requires": {
"babel-runtime": "^6.22.0"
}
},
"babel-plugin-check-es2015-constants": {
"version": "6.22.0",
"resolved": "https://registry.npmjs.org/babel-plugin-check-es2015-constants/-/babel-plugin-check-es2015-constants-6.22.0.tgz",
"integrity": "sha1-NRV7EBQm/S/9PaP3XH0ekYNbv4o=",
"requires": {
"babel-runtime": "^6.22.0"
}
},
"babel-plugin-syntax-flow": {
"version": "6.18.0",
"resolved": "https://registry.npmjs.org/babel-plugin-syntax-flow/-/babel-plugin-syntax-flow-6.18.0.tgz",
"integrity": "sha1-TDqyCiryaqIM0lmVw5jE63AxDI0="
},
"babel-plugin-syntax-jsx": {
"version": "6.18.0",
"resolved": "https://registry.npmjs.org/babel-plugin-syntax-jsx/-/babel-plugin-syntax-jsx-6.18.0.tgz",
"integrity": "sha1-CvMqmm4Tyno/1QaeYtew9Y0NiUY="
},
"babel-plugin-transform-es2015-arrow-functions": {
"version": "6.22.0",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-arrow-functions/-/babel-plugin-transform-es2015-arrow-functions-6.22.0.tgz",
"integrity": "sha1-RSaSy3EdX3ncf4XkQM5BufJE0iE=",
"requires": {
"babel-runtime": "^6.22.0"
}
},
"babel-plugin-transform-es2015-block-scoped-functions": {
"version": "6.22.0",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-block-scoped-functions/-/babel-plugin-transform-es2015-block-scoped-functions-6.22.0.tgz",
"integrity": "sha1-u8UbSflk1wy42OC5ToICRs46YUE=",
"requires": {
"babel-runtime": "^6.22.0"
}
},
"babel-plugin-transform-es2015-block-scoping": {
"version": "6.26.0",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-block-scoping/-/babel-plugin-transform-es2015-block-scoping-6.26.0.tgz",
"integrity": "sha1-1w9SmcEwjQXBL0Y4E7CgnnOxiV8=",
"requires": {
"babel-runtime": "^6.26.0",
"babel-template": "^6.26.0",
"babel-traverse": "^6.26.0",
"babel-types": "^6.26.0",
"lodash": "^4.17.4"
}
},
"babel-plugin-transform-es2015-classes": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-classes/-/babel-plugin-transform-es2015-classes-6.24.1.tgz",
"integrity": "sha1-WkxYpQyclGHlZLSyo7+ryXolhNs=",
"requires": {
"babel-helper-define-map": "^6.24.1",
"babel-helper-function-name": "^6.24.1",
"babel-helper-optimise-call-expression": "^6.24.1",
"babel-helper-replace-supers": "^6.24.1",
"babel-messages": "^6.23.0",
"babel-runtime": "^6.22.0",
"babel-template": "^6.24.1",
"babel-traverse": "^6.24.1",
"babel-types": "^6.24.1"
}
},
"babel-plugin-transform-es2015-computed-properties": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-computed-properties/-/babel-plugin-transform-es2015-computed-properties-6.24.1.tgz",
"integrity": "sha1-b+Ko0WiV1WNPTNmZttNICjCBWbM=",
"requires": {
"babel-runtime": "^6.22.0",
"babel-template": "^6.24.1"
}
},
"babel-plugin-transform-es2015-destructuring": {
"version": "6.23.0",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-destructuring/-/babel-plugin-transform-es2015-destructuring-6.23.0.tgz",
"integrity": "sha1-mXux8auWf2gtKwh2/jWNYOdlxW0=",
"requires": {
"babel-runtime": "^6.22.0"
}
},
"babel-plugin-transform-es2015-duplicate-keys": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-duplicate-keys/-/babel-plugin-transform-es2015-duplicate-keys-6.24.1.tgz",
"integrity": "sha1-c+s9MQypaePvnskcU3QabxV2Qj4=",
"requires": {
"babel-runtime": "^6.22.0",
"babel-types": "^6.24.1"
}
},
"babel-plugin-transform-es2015-for-of": {
"version": "6.23.0",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-for-of/-/babel-plugin-transform-es2015-for-of-6.23.0.tgz",
"integrity": "sha1-9HyVsrYT3x0+zC/bdXNiPHUkhpE=",
"requires": {
"babel-runtime": "^6.22.0"
}
},
"babel-plugin-transform-es2015-function-name": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-function-name/-/babel-plugin-transform-es2015-function-name-6.24.1.tgz",
"integrity": "sha1-g0yJhTvDaxrw86TF26qU/Y6sqos=",
"requires": {
"babel-helper-function-name": "^6.24.1",
"babel-runtime": "^6.22.0",
"babel-types": "^6.24.1"
}
},
"babel-plugin-transform-es2015-literals": {
"version": "6.22.0",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-literals/-/babel-plugin-transform-es2015-literals-6.22.0.tgz",
"integrity": "sha1-T1SgLWzWbPkVKAAZox0xklN3yi4=",
"requires": {
"babel-runtime": "^6.22.0"
}
},
"babel-plugin-transform-es2015-modules-amd": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-modules-amd/-/babel-plugin-transform-es2015-modules-amd-6.24.1.tgz",
"integrity": "sha1-Oz5UAXI5hC1tGcMBHEvS8AoA0VQ=",
"requires": {
"babel-plugin-transform-es2015-modules-commonjs": "^6.24.1",
"babel-runtime": "^6.22.0",
"babel-template": "^6.24.1"
}
},
"babel-plugin-transform-es2015-modules-commonjs": {
"version": "6.26.2",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-modules-commonjs/-/babel-plugin-transform-es2015-modules-commonjs-6.26.2.tgz",
"integrity": "sha512-CV9ROOHEdrjcwhIaJNBGMBCodN+1cfkwtM1SbUHmvyy35KGT7fohbpOxkE2uLz1o6odKK2Ck/tz47z+VqQfi9Q==",
"requires": {
"babel-plugin-transform-strict-mode": "^6.24.1",
"babel-runtime": "^6.26.0",
"babel-template": "^6.26.0",
"babel-types": "^6.26.0"
}
},
"babel-plugin-transform-es2015-modules-systemjs": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-modules-systemjs/-/babel-plugin-transform-es2015-modules-systemjs-6.24.1.tgz",
"integrity": "sha1-/4mhQrkRmpBhlfXxBuzzBdlAfSM=",
"requires": {
"babel-helper-hoist-variables": "^6.24.1",
"babel-runtime": "^6.22.0",
"babel-template": "^6.24.1"
}
},
"babel-plugin-transform-es2015-modules-umd": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-modules-umd/-/babel-plugin-transform-es2015-modules-umd-6.24.1.tgz",
"integrity": "sha1-rJl+YoXNGO1hdq22B9YCNErThGg=",
"requires": {
"babel-plugin-transform-es2015-modules-amd": "^6.24.1",
"babel-runtime": "^6.22.0",
"babel-template": "^6.24.1"
}
},
"babel-plugin-transform-es2015-object-super": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-object-super/-/babel-plugin-transform-es2015-object-super-6.24.1.tgz",
"integrity": "sha1-JM72muIcuDp/hgPa0CH1cusnj40=",
"requires": {
"babel-helper-replace-supers": "^6.24.1",
"babel-runtime": "^6.22.0"
}
},
"babel-plugin-transform-es2015-parameters": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-parameters/-/babel-plugin-transform-es2015-parameters-6.24.1.tgz",
"integrity": "sha1-V6w1GrScrxSpfNE7CfZv3wpiXys=",
"requires": {
"babel-helper-call-delegate": "^6.24.1",
"babel-helper-get-function-arity": "^6.24.1",
"babel-runtime": "^6.22.0",
"babel-template": "^6.24.1",
"babel-traverse": "^6.24.1",
"babel-types": "^6.24.1"
}
},
"babel-plugin-transform-es2015-shorthand-properties": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-shorthand-properties/-/babel-plugin-transform-es2015-shorthand-properties-6.24.1.tgz",
"integrity": "sha1-JPh11nIch2YbvZmkYi5R8U3jiqA=",
"requires": {
"babel-runtime": "^6.22.0",
"babel-types": "^6.24.1"
}
},
"babel-plugin-transform-es2015-spread": {
"version": "6.22.0",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-spread/-/babel-plugin-transform-es2015-spread-6.22.0.tgz",
"integrity": "sha1-1taKmfia7cRTbIGlQujdnxdG+NE=",
"requires": {
"babel-runtime": "^6.22.0"
}
},
"babel-plugin-transform-es2015-sticky-regex": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-sticky-regex/-/babel-plugin-transform-es2015-sticky-regex-6.24.1.tgz",
"integrity": "sha1-AMHNsaynERLN8M9hJsLta0V8zbw=",
"requires": {
"babel-helper-regex": "^6.24.1",
"babel-runtime": "^6.22.0",
"babel-types": "^6.24.1"
}
},
"babel-plugin-transform-es2015-template-literals": {
"version": "6.22.0",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-template-literals/-/babel-plugin-transform-es2015-template-literals-6.22.0.tgz",
"integrity": "sha1-qEs0UPfp+PH2g51taH2oS7EjbY0=",
"requires": {
"babel-runtime": "^6.22.0"
}
},
"babel-plugin-transform-es2015-typeof-symbol": {
"version": "6.23.0",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-typeof-symbol/-/babel-plugin-transform-es2015-typeof-symbol-6.23.0.tgz",
"integrity": "sha1-3sCfHN3/lLUqxz1QXITfWdzOs3I=",
"requires": {
"babel-runtime": "^6.22.0"
}
},
"babel-plugin-transform-es2015-unicode-regex": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-es2015-unicode-regex/-/babel-plugin-transform-es2015-unicode-regex-6.24.1.tgz",
"integrity": "sha1-04sS9C6nMj9yk4fxinxa4frrNek=",
"requires": {
"babel-helper-regex": "^6.24.1",
"babel-runtime": "^6.22.0",
"regexpu-core": "^2.0.0"
}
},
"babel-plugin-transform-flow-strip-types": {
"version": "6.22.0",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-flow-strip-types/-/babel-plugin-transform-flow-strip-types-6.22.0.tgz",
"integrity": "sha1-hMtnKTXUNxT9wyvOhFaNh0Qc988=",
"requires": {
"babel-plugin-syntax-flow": "^6.18.0",
"babel-runtime": "^6.22.0"
}
},
"babel-plugin-transform-react-display-name": {
"version": "6.25.0",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-react-display-name/-/babel-plugin-transform-react-display-name-6.25.0.tgz",
"integrity": "sha1-Z+K/Hx6ck6sI25Z5LgU5K/LMKNE=",
"requires": {
"babel-runtime": "^6.22.0"
}
},
"babel-plugin-transform-react-jsx": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-react-jsx/-/babel-plugin-transform-react-jsx-6.24.1.tgz",
"integrity": "sha1-hAoCjn30YN/DotKfDA2R9jduZqM=",
"requires": {
"babel-helper-builder-react-jsx": "^6.24.1",
"babel-plugin-syntax-jsx": "^6.8.0",
"babel-runtime": "^6.22.0"
}
},
"babel-plugin-transform-react-jsx-self": {
"version": "6.22.0",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-react-jsx-self/-/babel-plugin-transform-react-jsx-self-6.22.0.tgz",
"integrity": "sha1-322AqdomEqEh5t3XVYvL7PBuY24=",
"requires": {
"babel-plugin-syntax-jsx": "^6.8.0",
"babel-runtime": "^6.22.0"
}
},
"babel-plugin-transform-react-jsx-source": {
"version": "6.22.0",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-react-jsx-source/-/babel-plugin-transform-react-jsx-source-6.22.0.tgz",
"integrity": "sha1-ZqwSFT9c0tF7PBkmj0vwGX9E7NY=",
"requires": {
"babel-plugin-syntax-jsx": "^6.8.0",
"babel-runtime": "^6.22.0"
}
},
"babel-plugin-transform-regenerator": {
"version": "6.26.0",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-regenerator/-/babel-plugin-transform-regenerator-6.26.0.tgz",
"integrity": "sha1-4HA2lvveJ/Cj78rPi03KL3s6jy8=",
"requires": {
"regenerator-transform": "^0.10.0"
}
},
"babel-plugin-transform-strict-mode": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-plugin-transform-strict-mode/-/babel-plugin-transform-strict-mode-6.24.1.tgz",
"integrity": "sha1-1fr3qleKZbvlkc9e2uBKDGcCB1g=",
"requires": {
"babel-runtime": "^6.22.0",
"babel-types": "^6.24.1"
}
},
"babel-preset-es2015": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-preset-es2015/-/babel-preset-es2015-6.24.1.tgz",
"integrity": "sha1-1EBQ1rwsn+6nAqrzjXJ6AhBTiTk=",
"requires": {
"babel-plugin-check-es2015-constants": "^6.22.0",
"babel-plugin-transform-es2015-arrow-functions": "^6.22.0",
"babel-plugin-transform-es2015-block-scoped-functions": "^6.22.0",
"babel-plugin-transform-es2015-block-scoping": "^6.24.1",
"babel-plugin-transform-es2015-classes": "^6.24.1",
"babel-plugin-transform-es2015-computed-properties": "^6.24.1",
"babel-plugin-transform-es2015-destructuring": "^6.22.0",
"babel-plugin-transform-es2015-duplicate-keys": "^6.24.1",
"babel-plugin-transform-es2015-for-of": "^6.22.0",
"babel-plugin-transform-es2015-function-name": "^6.24.1",
"babel-plugin-transform-es2015-literals": "^6.22.0",
"babel-plugin-transform-es2015-modules-amd": "^6.24.1",
"babel-plugin-transform-es2015-modules-commonjs": "^6.24.1",
"babel-plugin-transform-es2015-modules-systemjs": "^6.24.1",
"babel-plugin-transform-es2015-modules-umd": "^6.24.1",
"babel-plugin-transform-es2015-object-super": "^6.24.1",
"babel-plugin-transform-es2015-parameters": "^6.24.1",
"babel-plugin-transform-es2015-shorthand-properties": "^6.24.1",
"babel-plugin-transform-es2015-spread": "^6.22.0",
"babel-plugin-transform-es2015-sticky-regex": "^6.24.1",
"babel-plugin-transform-es2015-template-literals": "^6.22.0",
"babel-plugin-transform-es2015-typeof-symbol": "^6.22.0",
"babel-plugin-transform-es2015-unicode-regex": "^6.24.1",
"babel-plugin-transform-regenerator": "^6.24.1"
}
},
"babel-preset-flow": {
"version": "6.23.0",
"resolved": "https://registry.npmjs.org/babel-preset-flow/-/babel-preset-flow-6.23.0.tgz",
"integrity": "sha1-5xIYiHCFrpoktb5Baa/7WZgWxJ0=",
"requires": {
"babel-plugin-transform-flow-strip-types": "^6.22.0"
}
},
"babel-preset-react": {
"version": "6.24.1",
"resolved": "https://registry.npmjs.org/babel-preset-react/-/babel-preset-react-6.24.1.tgz",
"integrity": "sha1-umnfrqRfw+xjm2pOzqbhdwLJE4A=",
"requires": {
"babel-plugin-syntax-jsx": "^6.3.13",
"babel-plugin-transform-react-display-name": "^6.23.0",
"babel-plugin-transform-react-jsx": "^6.24.1",
"babel-plugin-transform-react-jsx-self": "^6.22.0",
"babel-plugin-transform-react-jsx-source": "^6.22.0",
"babel-preset-flow": "^6.23.0"
}
},
"babel-register": {
"version": "6.26.0",
"resolved": "https://registry.npmjs.org/babel-register/-/babel-register-6.26.0.tgz",
"integrity": "sha1-btAhFz4vy0htestFxgCahW9kcHE=",
"requires": {
"babel-core": "^6.26.0",
"babel-runtime": "^6.26.0",
"core-js": "^2.5.0",
"home-or-tmp": "^2.0.0",
"lodash": "^4.17.4",
"mkdirp": "^0.5.1",
"source-map-support": "^0.4.15"
}
},
"babel-runtime": {
"version": "6.26.0",
"resolved": "https://registry.npmjs.org/babel-runtime/-/babel-runtime-6.26.0.tgz",
"integrity": "sha1-llxwWGaOgrVde/4E/yM3vItWR/4=",
"requires": {
"core-js": "^2.4.0",
"regenerator-runtime": "^0.11.0"
}
},
"babel-template": {
"version": "6.26.0",
"resolved": "https://registry.npmjs.org/babel-template/-/babel-template-6.26.0.tgz",
"integrity": "sha1-3gPi0WOWsGn0bdn/+FIfsaDjXgI=",
"requires": {
"babel-runtime": "^6.26.0",
"babel-traverse": "^6.26.0",
"babel-types": "^6.26.0",
"babylon": "^6.18.0",
"lodash": "^4.17.4"
}
},
"babel-traverse": {
"version": "6.26.0",
"resolved": "https://registry.npmjs.org/babel-traverse/-/babel-traverse-6.26.0.tgz",
"integrity": "sha1-RqnL1+3MYsjlwGTi0tjQ9ANXZu4=",
"requires": {
"babel-code-frame": "^6.26.0",
"babel-messages": "^6.23.0",
"babel-runtime": "^6.26.0",
"babel-types": "^6.26.0",
"babylon": "^6.18.0",
"debug": "^2.6.8",
"globals": "^9.18.0",
"invariant": "^2.2.2",
"lodash": "^4.17.4"
}
},
"babel-types": {
"version": "6.26.0",
"resolved": "https://registry.npmjs.org/babel-types/-/babel-types-6.26.0.tgz",
"integrity": "sha1-o7Bz+Uq0nrb6Vc1lInozQ4BjJJc=",
"requires": {
"babel-runtime": "^6.26.0",
"esutils": "^2.0.2",
"lodash": "^4.17.4",
"to-fast-properties": "^1.0.3"
}
},
"babylon": {
"version": "6.18.0",
"resolved": "https://registry.npmjs.org/babylon/-/babylon-6.18.0.tgz",
"integrity": "sha512-q/UEjfGJ2Cm3oKV71DJz9d25TPnq5rhBVL2Q4fA5wcC3jcrdn7+SssEybFIxwAvvP+YCsCYNKughoF33GxgycQ=="
},
"balanced-match": {
"version": "1.0.0",
"resolved": "https://registry.npmjs.org/balanced-match/-/balanced-match-1.0.0.tgz",
"integrity": "sha1-ibTRmasr7kneFk6gK4nORi1xt2c="
},
"bcrypt-pbkdf": {
"version": "1.0.2",
"resolved": "https://registry.npmjs.org/bcrypt-pbkdf/-/bcrypt-pbkdf-1.0.2.tgz",
"integrity": "sha1-pDAdOJtqQ/m2f/PKEaP2Y342Dp4=",
"dev": true,
"optional": true,
"requires": {
"tweetnacl": "^0.14.3"
}
},
"brace-expansion": {
"version": "1.1.8",
"resolved": "https://registry.npmjs.org/brace-expansion/-/brace-expansion-1.1.8.tgz",
"integrity": "sha1-wHshHHyVLsH479Uad+8NHTmQopI=",
"requires": {
"balanced-match": "^1.0.0",
"concat-map": "0.0.1"
}
},
"buffer-from": {
"version": "1.1.1",
"resolved": "https://registry.npmjs.org/buffer-from/-/buffer-from-1.1.1.tgz",
"integrity": "sha512-MQcXEUbCKtEo7bhqEs6560Hyd4XaovZlO/k9V3hjVUF/zwW7KBVdSK4gIt/bzwS9MbR5qob+F5jusZsb0YQK2A==",
"dev": true
},
"builtin-modules": {
"version": "1.1.1",
"resolved": "https://registry.npmjs.org/builtin-modules/-/builtin-modules-1.1.1.tgz",
"integrity": "sha1-Jw8HbFpywC9bZaR9+Uxf46J4iS8=",
"dev": true
},
"camelcase": {
"version": "2.1.1",
"resolved": "https://registry.npmjs.org/camelcase/-/camelcase-2.1.1.tgz",
"integrity": "sha1-fB0W1nmhu+WcoCys7PsBHiAfWh8=",
"dev": true
},
"camelcase-keys": {
"version": "2.1.0",
"resolved": "https://registry.npmjs.org/camelcase-keys/-/camelcase-keys-2.1.0.tgz",
"integrity": "sha1-MIvur/3ygRkFHvodkyITyRuPkuc=",
"dev": true,
"requires": {
"camelcase": "^2.0.0",
"map-obj": "^1.0.0"
}
},
"caseless": {
"version": "0.12.0",
"resolved": "https://registry.npmjs.org/caseless/-/caseless-0.12.0.tgz",
"integrity": "sha1-G2gcIf+EAzyCZUMJBolCDRhxUdw=",
"dev": true
},
"chalk": {
"version": "1.1.3",
"resolved": "https://registry.npmjs.org/chalk/-/chalk-1.1.3.tgz",
"integrity": "sha1-qBFcVeSnAv5NFQq9OHKCKn4J/Jg=",
"requires": {
"ansi-styles": "^2.2.1",
"escape-string-regexp": "^1.0.2",
"has-ansi": "^2.0.0",
"strip-ansi": "^3.0.0",
"supports-color": "^2.0.0"
}
},
"classnames": {
"version": "2.2.6",
"resolved": "https://registry.npmjs.org/classnames/-/classnames-2.2.6.tgz",
"integrity": "sha512-JR/iSQOSt+LQIWwrwEzJ9uk0xfN3mTVYMwt1Ir5mUcSN6pU+V4zQFFaJsclJbPuAUQH+yfWef6tm7l1quW3C8Q=="
},
"co": {
"version": "4.6.0",
"resolved": "https://registry.npmjs.org/co/-/co-4.6.0.tgz",
"integrity": "sha1-bqa989hTrlTMuOR7+gvz+QMfsYQ=",
"dev": true
},
"code-point-at": {
"version": "1.1.0",
"resolved": "https://registry.npmjs.org/code-point-at/-/code-point-at-1.1.0.tgz",
"integrity": "sha1-DQcLTQQ6W+ozovGkDi7bPZpMz3c=",
"dev": true
},
"combined-stream": {
"version": "1.0.6",
"resolved": "https://registry.npmjs.org/combined-stream/-/combined-stream-1.0.6.tgz",
"integrity": "sha1-cj599ugBrFYTETp+RFqbactjKBg=",
"dev": true,
"requires": {
"delayed-stream": "~1.0.0"
}
},
"concat-map": {
"version": "0.0.1",
"resolved": "https://registry.npmjs.org/concat-map/-/concat-map-0.0.1.tgz",
"integrity": "sha1-2Klr13/Wjfd5OnMDajug1UBdR3s="
},
"concat-stream": {
"version": "1.6.2",
"resolved": "https://registry.npmjs.org/concat-stream/-/concat-stream-1.6.2.tgz",
"integrity": "sha512-27HBghJxjiZtIk3Ycvn/4kbJk/1uZuJFfuPEns6LaEvpvG1f0hTea8lilrouyo9mVc2GWdcEZ8OLoGmSADlrCw==",
"dev": true,
"requires": {
"buffer-from": "^1.0.0",
"inherits": "^2.0.3",
"readable-stream": "^2.2.2",
"typedarray": "^0.0.6"
},
"dependencies": {
"isarray": {
"version": "1.0.0",
"resolved": "https://registry.npmjs.org/isarray/-/isarray-1.0.0.tgz",
"integrity": "sha1-u5NdSFgsuhaMBoNJV6VKPgcSTxE=",
"dev": true
},
"readable-stream": {
"version": "2.3.6",
"resolved": "https://registry.npmjs.org/readable-stream/-/readable-stream-2.3.6.tgz",
"integrity": "sha512-tQtKA9WIAhBF3+VLAseyMqZeBjW0AHJoxOtYqSUZNJxauErmLbVm2FW1y+J/YA9dUrAC39ITejlZWhVIwawkKw==",
"dev": true,
"requires": {
"core-util-is": "~1.0.0",
"inherits": "~2.0.3",
"isarray": "~1.0.0",
"process-nextick-args": "~2.0.0",
"safe-buffer": "~5.1.1",
"string_decoder": "~1.1.1",
"util-deprecate": "~1.0.1"
}
},
"string_decoder": {
"version": "1.1.1",
"resolved": "https://registry.npmjs.org/string_decoder/-/string_decoder-1.1.1.tgz",
"integrity": "sha512-n/ShnvDi6FHbbVfviro+WojiFzv+s8MPMHBczVePfUpDJLwoLT0ht1l4YwBCbi8pJAveEEdnkHyPyTP/mzRfwg==",
"dev": true,
"requires": {
"safe-buffer": "~5.1.0"
}
}
}
},
"convert-source-map": {
"version": "1.5.1",
"resolved": "https://registry.npmjs.org/convert-source-map/-/convert-source-map-1.5.1.tgz",
"integrity": "sha1-uCeAl7m8IpNl3lxiz1/K7YtVmeU="
},
"core-js": {
"version": "2.5.1",
"resolved": "https://registry.npmjs.org/core-js/-/core-js-2.5.1.tgz",
"integrity": "sha1-rmh03GaTd4m4B1T/VCjfZoGcpQs="
},
"core-util-is": {
"version": "1.0.2",
"resolved": "https://registry.npmjs.org/core-util-is/-/core-util-is-1.0.2.tgz",
"integrity": "sha1-tf1UIgqivFq1eqtxQMlAdUUDwac=",
"dev": true
},
"create-react-class": {
"version": "15.6.2",
"resolved": "https://registry.npmjs.org/create-react-class/-/create-react-class-15.6.2.tgz",
"integrity": "sha1-zx7RXxKq1/FO9fLf4F5sQvke8Co=",
"requires": {
"fbjs": "^0.8.9",
"loose-envify": "^1.3.1",
"object-assign": "^4.1.1"
}
},
"currently-unhandled": {
"version": "0.4.1",
"resolved": "https://registry.npmjs.org/currently-unhandled/-/currently-unhandled-0.4.1.tgz",
"integrity": "sha1-mI3zP+qxke95mmE2nddsF635V+o=",
"dev": true,
"requires": {
"array-find-index": "^1.0.1"
}
},
"dashdash": {
"version": "1.14.1",
"resolved": "https://registry.npmjs.org/dashdash/-/dashdash-1.14.1.tgz",
"integrity": "sha1-hTz6D3y+L+1d4gMmuN1YEDX24vA=",
"dev": true,
"requires": {
"assert-plus": "^1.0.0"
}
},
"debug": {
"version": "2.6.9",
"resolved": "https://registry.npmjs.org/debug/-/debug-2.6.9.tgz",
"integrity": "sha512-bC7ElrdJaJnPbAP+1EotYvqZsb3ecl5wi6Bfi6BJTUcNowp6cvspg0jXznRTKDjm/E7AdgFBVeAPVMNcKGsHMA==",
"requires": {
"ms": "2.0.0"
}
},
"decamelize": {
"version": "1.2.0",
"resolved": "https://registry.npmjs.org/decamelize/-/decamelize-1.2.0.tgz",
"integrity": "sha1-9lNNFRSCabIDUue+4m9QH5oZEpA=",
"dev": true
},
"deep-extend": {
"version": "0.6.0",
"resolved": "https://registry.npmjs.org/deep-extend/-/deep-extend-0.6.0.tgz",
"integrity": "sha512-LOHxIOaPYdHlJRtCQfDIVZtfw/ufM8+rVj649RIHzcm/vGwQRXFt6OPqIFWsm2XEMrNIEtWR64sY1LEKD2vAOA==",
"dev": true
},
"delayed-stream": {
"version": "1.0.0",
"resolved": "https://registry.npmjs.org/delayed-stream/-/delayed-stream-1.0.0.tgz",
"integrity": "sha1-3zrhmayt+31ECqrgsp4icrJOxhk=",
"dev": true
},
"detect-indent": {
"version": "4.0.0",
"resolved": "https://registry.npmjs.org/detect-indent/-/detect-indent-4.0.0.tgz",
"integrity": "sha1-920GQ1LN9Docts5hnE7jqUdd4gg=",
"requires": {
"repeating": "^2.0.0"
}
},
"ecc-jsbn": {
"version": "0.1.2",
"resolved": "https://registry.npmjs.org/ecc-jsbn/-/ecc-jsbn-0.1.2.tgz",
"integrity": "sha1-OoOpBOVDUyh4dMVkt1SThoSamMk=",
"dev": true,
"optional": true,
"requires": {
"jsbn": "~0.1.0",
"safer-buffer": "^2.1.0"
}
},
"electron": {
"version": "1.8.8",
"resolved": "https://registry.npmjs.org/electron/-/electron-1.8.8.tgz",
"integrity": "sha512-1f9zJehcTTGjrkb06o6ds+gsRq6SYhZJyxOk6zIWjRH8hVy03y/RzUDELzNas71f5vcvXmfGVvyjeEsadDI8tg==",
"dev": true,
"requires": {
"@types/node": "^8.0.24",
"electron-download": "^3.0.1",
"extract-zip": "^1.0.3"
}
},
"electron-download": {
"version": "3.3.0",
"resolved": "https://registry.npmjs.org/electron-download/-/electron-download-3.3.0.tgz",
"integrity": "sha1-LP1U1pZsAZxNSa1l++Zcyc3vaMg=",
"dev": true,
"requires": {
"debug": "^2.2.0",
"fs-extra": "^0.30.0",
"home-path": "^1.0.1",
"minimist": "^1.2.0",
"nugget": "^2.0.0",
"path-exists": "^2.1.0",
"rc": "^1.1.2",
"semver": "^5.3.0",
"sumchecker": "^1.2.0"
},
"dependencies": {
"minimist": {
"version": "1.2.0",
"resolved": "https://registry.npmjs.org/minimist/-/minimist-1.2.0.tgz",
"integrity": "sha1-o1AIsg9BOD7sH7kU9M1d95omQoQ=",
"dev": true
}
}
},
"encoding": {
"version": "0.1.12",
"resolved": "https://registry.npmjs.org/encoding/-/encoding-0.1.12.tgz",
"integrity": "sha1-U4tm8+5izRq1HsMjgp0flIDHS+s=",
"requires": {
"iconv-lite": "~0.4.13"
}
},
"error-ex": {
"version": "1.3.2",
"resolved": "https://registry.npmjs.org/error-ex/-/error-ex-1.3.2.tgz",
"integrity": "sha512-7dFHNmqeFSEt2ZBsCriorKnn3Z2pj+fd9kmI6QoWw4//DL+icEBfc0U7qJCisqrTsKTjw4fNFy2pW9OqStD84g==",
"dev": true,
"requires": {
"is-arrayish": "^0.2.1"
}
},
"es6-promise": {
"version": "4.2.4",
"resolved": "https://registry.npmjs.org/es6-promise/-/es6-promise-4.2.4.tgz",
"integrity": "sha512-/NdNZVJg+uZgtm9eS3O6lrOLYmQag2DjdEXuPaHlZ6RuVqgqaVZfgYCepEIKsLqwdQArOPtC3XzRLqGGfT8KQQ==",
"dev": true
},
"escape-string-regexp": {
"version": "1.0.5",
"resolved": "https://registry.npmjs.org/escape-string-regexp/-/escape-string-regexp-1.0.5.tgz",
"integrity": "sha1-G2HAViGQqN/2rjuyzwIAyhMLhtQ="
},
"esutils": {
"version": "2.0.2",
"resolved": "https://registry.npmjs.org/esutils/-/esutils-2.0.2.tgz",
"integrity": "sha1-Cr9PHKpbyx96nYrMbepPqqBLrJs="
},
"exenv": {
"version": "1.2.2",
"resolved": "https://registry.npmjs.org/exenv/-/exenv-1.2.2.tgz",
"integrity": "sha1-KueOhdmJQVhnCwPUe+wfA72Ru50="
},
"extend": {
"version": "3.0.2",
"resolved": "https://registry.npmjs.org/extend/-/extend-3.0.2.tgz",
"integrity": "sha512-fjquC59cD7CyW6urNXK0FBufkZcoiGG80wTuPujX590cB5Ttln20E2UB4S/WARVqhXffZl2LNgS+gQdPIIim/g==",
"dev": true
},
"extract-zip": {
"version": "1.6.7",
"resolved": "https://registry.npmjs.org/extract-zip/-/extract-zip-1.6.7.tgz",
"integrity": "sha1-qEC0uK9kAyZMjbV/Txp0Mz74H+k=",
"dev": true,
"requires": {
"concat-stream": "1.6.2",
"debug": "2.6.9",
"mkdirp": "0.5.1",
"yauzl": "2.4.1"
}
},
"extsprintf": {
"version": "1.3.0",
"resolved": "https://registry.npmjs.org/extsprintf/-/extsprintf-1.3.0.tgz",
"integrity": "sha1-lpGEQOMEGnpBT4xS48V06zw+HgU=",
"dev": true
},
"fast-deep-equal": {
"version": "1.1.0",
"resolved": "https://registry.npmjs.org/fast-deep-equal/-/fast-deep-equal-1.1.0.tgz",
"integrity": "sha1-wFNHeBfIa1HaqFPIHgWbcz0CNhQ=",
"dev": true
},
"fast-json-stable-stringify": {
"version": "2.0.0",
"resolved": "https://registry.npmjs.org/fast-json-stable-stringify/-/fast-json-stable-stringify-2.0.0.tgz",
"integrity": "sha1-1RQsDK7msRifh9OnYREGT4bIu/I=",
"dev": true
},
"fbjs": {
"version": "0.8.16",
"resolved": "https://registry.npmjs.org/fbjs/-/fbjs-0.8.16.tgz",
"integrity": "sha1-XmdDL1UNxBtXK/VYR7ispk5TN9s=",
"requires": {
"core-js": "^1.0.0",
"isomorphic-fetch": "^2.1.1",
"loose-envify": "^1.0.0",
"object-assign": "^4.1.0",
"promise": "^7.1.1",
"setimmediate": "^1.0.5",
"ua-parser-js": "^0.7.9"
},
"dependencies": {
"core-js": {
"version": "1.2.7",
"resolved": "https://registry.npmjs.org/core-js/-/core-js-1.2.7.tgz",
"integrity": "sha1-ZSKUwUZR2yj6k70tX/KYOk8IxjY="
}
}
},
"fd-slicer": {
"version": "1.0.1",
"resolved": "https://registry.npmjs.org/fd-slicer/-/fd-slicer-1.0.1.tgz",
"integrity": "sha1-i1vL2ewyfFBBv5qwI/1nUPEXfmU=",
"dev": true,
"requires": {
"pend": "~1.2.0"
}
},
"find-up": {
"version": "1.1.2",
"resolved": "https://registry.npmjs.org/find-up/-/find-up-1.1.2.tgz",
"integrity": "sha1-ay6YIrGizgpgq2TWEOzK1TyyTQ8=",
"dev": true,
"requires": {
"path-exists": "^2.0.0",
"pinkie-promise": "^2.0.0"
}
},
"forever-agent": {
"version": "0.6.1",
"resolved": "https://registry.npmjs.org/forever-agent/-/forever-agent-0.6.1.tgz",
"integrity": "sha1-+8cfDEGt6zf5bFd60e1C2P2sypE=",
"dev": true
},
"form-data": {
"version": "2.3.2",
"resolved": "https://registry.npmjs.org/form-data/-/form-data-2.3.2.tgz",
"integrity": "sha1-SXBJi+YEwgwAXU9cI67NIda0kJk=",
"dev": true,
"requires": {
"asynckit": "^0.4.0",
"combined-stream": "1.0.6",
"mime-types": "^2.1.12"
}
},
"fs-extra": {
"version": "0.30.0",
"resolved": "https://registry.npmjs.org/fs-extra/-/fs-extra-0.30.0.tgz",
"integrity": "sha1-8jP/zAjU2n1DLapEl3aYnbHfk/A=",
"dev": true,
"requires": {
"graceful-fs": "^4.1.2",
"jsonfile": "^2.1.0",
"klaw": "^1.0.0",
"path-is-absolute": "^1.0.0",
"rimraf": "^2.2.8"
}
},
"fs.realpath": {
"version": "1.0.0",
"resolved": "https://registry.npmjs.org/fs.realpath/-/fs.realpath-1.0.0.tgz",
"integrity": "sha1-FQStJSMVjKpA20onh8sBQRmU6k8=",
"dev": true
},
"get-stdin": {
"version": "4.0.1",
"resolved": "https://registry.npmjs.org/get-stdin/-/get-stdin-4.0.1.tgz",
"integrity": "sha1-uWjGsKBDhDJJAui/Gl3zJXmkUP4=",
"dev": true
},
"getpass": {
"version": "0.1.7",
"resolved": "https://registry.npmjs.org/getpass/-/getpass-0.1.7.tgz",
"integrity": "sha1-Xv+OPmhNVprkyysSgmBOi6YhSfo=",
"dev": true,
"requires": {
"assert-plus": "^1.0.0"
}
},
"glob": {
"version": "7.1.3",
"resolved": "https://registry.npmjs.org/glob/-/glob-7.1.3.tgz",
"integrity": "sha512-vcfuiIxogLV4DlGBHIUOwI0IbrJ8HWPc4MU7HzviGeNho/UJDfi6B5p3sHeWIQ0KGIU0Jpxi5ZHxemQfLkkAwQ==",
"dev": true,
"requires": {
"fs.realpath": "^1.0.0",
"inflight": "^1.0.4",
"inherits": "2",
"minimatch": "^3.0.4",
"once": "^1.3.0",
"path-is-absolute": "^1.0.0"
}
},
"globals": {
"version": "9.18.0",
"resolved": "https://registry.npmjs.org/globals/-/globals-9.18.0.tgz",
"integrity": "sha512-S0nG3CLEQiY/ILxqtztTWH/3iRRdyBLw6KMDxnKMchrtbj2OFmehVh0WUCfW3DUrIgx/qFrJPICrq4Z4sTR9UQ=="
},
"graceful-fs": {
"version": "4.1.11",
"resolved": "https://registry.npmjs.org/graceful-fs/-/graceful-fs-4.1.11.tgz",
"integrity": "sha1-Dovf5NHduIVNZOBOp8AOKgJuVlg=",
"dev": true
},
"har-schema": {
"version": "2.0.0",
"resolved": "https://registry.npmjs.org/har-schema/-/har-schema-2.0.0.tgz",
"integrity": "sha1-qUwiJOvKwEeCoNkDVSHyRzW37JI=",
"dev": true
},
"har-validator": {
"version": "5.1.0",
"resolved": "https://registry.npmjs.org/har-validator/-/har-validator-5.1.0.tgz",
"integrity": "sha512-+qnmNjI4OfH2ipQ9VQOw23bBd/ibtfbVdK2fYbY4acTDqKTW/YDp9McimZdDbG8iV9fZizUqQMD5xvriB146TA==",
"dev": true,
"requires": {
"ajv": "^5.3.0",
"har-schema": "^2.0.0"
}
},
"has-ansi": {
"version": "2.0.0",
"resolved": "https://registry.npmjs.org/has-ansi/-/has-ansi-2.0.0.tgz",
"integrity": "sha1-NPUEnOHs3ysGSa8+8k5F7TVBbZE=",
"requires": {
"ansi-regex": "^2.0.0"
}
},
"home-or-tmp": {
"version": "2.0.0",
"resolved": "https://registry.npmjs.org/home-or-tmp/-/home-or-tmp-2.0.0.tgz",
"integrity": "sha1-42w/LSyufXRqhX440Y1fMqeILbg=",
"requires": {
"os-homedir": "^1.0.0",
"os-tmpdir": "^1.0.1"
}
},
"home-path": {
"version": "1.0.6",
"resolved": "https://registry.npmjs.org/home-path/-/home-path-1.0.6.tgz",
"integrity": "sha512-wo+yjrdAtoXt43Vy92a+0IPCYViiyLAHyp0QVS4xL/tfvVz5sXIW1ubLZk3nhVkD92fQpUMKX+fzMjr5F489vw==",
"dev": true
},
"hosted-git-info": {
"version": "2.7.1",
"resolved": "https://registry.npmjs.org/hosted-git-info/-/hosted-git-info-2.7.1.tgz",
"integrity": "sha512-7T/BxH19zbcCTa8XkMlbK5lTo1WtgkFi3GvdWEyNuc4Vex7/9Dqbnpsf4JMydcfj9HCg4zUWFTL3Za6lapg5/w==",
"dev": true
},
"http-signature": {
"version": "1.2.0",
"resolved": "https://registry.npmjs.org/http-signature/-/http-signature-1.2.0.tgz",
"integrity": "sha1-muzZJRFHcvPZW2WmCruPfBj7rOE=",
"dev": true,
"requires": {
"assert-plus": "^1.0.0",
"jsprim": "^1.2.2",
"sshpk": "^1.7.0"
}
},
"iconv-lite": {
"version": "0.4.19",
"resolved": "https://registry.npmjs.org/iconv-lite/-/iconv-lite-0.4.19.tgz",
"integrity": "sha512-oTZqweIP51xaGPI4uPa56/Pri/480R+mo7SeU+YETByQNhDG55ycFyNLIgta9vXhILrxXDmF7ZGhqZIcuN0gJQ=="
},
"indent-string": {
"version": "2.1.0",
"resolved": "https://registry.npmjs.org/indent-string/-/indent-string-2.1.0.tgz",
"integrity": "sha1-ji1INIdCEhtKghi3oTfppSBJ3IA=",
"dev": true,
"requires": {
"repeating": "^2.0.0"
}
},
"inflight": {
"version": "1.0.6",
"resolved": "https://registry.npmjs.org/inflight/-/inflight-1.0.6.tgz",
"integrity": "sha1-Sb1jMdfQLQwJvJEKEHW6gWW1bfk=",
"dev": true,
"requires": {
"once": "^1.3.0",
"wrappy": "1"
}
},
"inherits": {
"version": "2.0.3",
"resolved": "https://registry.npmjs.org/inherits/-/inherits-2.0.3.tgz",
"integrity": "sha1-Yzwsg+PaQqUC9SRmAiSA9CCCYd4=",
"dev": true
},
"ini": {
"version": "1.3.5",
"resolved": "https://registry.npmjs.org/ini/-/ini-1.3.5.tgz",
"integrity": "sha512-RZY5huIKCMRWDUqZlEi72f/lmXKMvuszcMBduliQ3nnWbx9X/ZBQO7DijMEYS9EhHBb2qacRUMtC7svLwe0lcw==",
"dev": true
},
"invariant": {
"version": "2.2.2",
"resolved": "https://registry.npmjs.org/invariant/-/invariant-2.2.2.tgz",
"integrity": "sha1-nh9WrArNtr8wMwbzOL47IErmA2A=",
"requires": {
"loose-envify": "^1.0.0"
}
},
"is-arrayish": {
"version": "0.2.1",
"resolved": "https://registry.npmjs.org/is-arrayish/-/is-arrayish-0.2.1.tgz",
"integrity": "sha1-d8mYQFJ6qOyxqLppe4BkWnqSap0=",
"dev": true
},
"is-builtin-module": {
"version": "1.0.0",
"resolved": "https://registry.npmjs.org/is-builtin-module/-/is-builtin-module-1.0.0.tgz",
"integrity": "sha1-VAVy0096wxGfj3bDDLwbHgN6/74=",
"dev": true,
"requires": {
"builtin-modules": "^1.0.0"
}
},
"is-finite": {
"version": "1.0.2",
"resolved": "https://registry.npmjs.org/is-finite/-/is-finite-1.0.2.tgz",
"integrity": "sha1-zGZ3aVYCvlUO8R6LSqYwU0K20Ko=",
"requires": {
"number-is-nan": "^1.0.0"
}
},
"is-fullwidth-code-point": {
"version": "1.0.0",
"resolved": "https://registry.npmjs.org/is-fullwidth-code-point/-/is-fullwidth-code-point-1.0.0.tgz",
"integrity": "sha1-754xOG8DGn8NZDr4L95QxFfvAMs=",
"dev": true,
"requires": {
"number-is-nan": "^1.0.0"
}
},
"is-stream": {
"version": "1.1.0",
"resolved": "https://registry.npmjs.org/is-stream/-/is-stream-1.1.0.tgz",
"integrity": "sha1-EtSj3U5o4Lec6428hBc66A2RykQ="
},
"is-typedarray": {
"version": "1.0.0",
"resolved": "https://registry.npmjs.org/is-typedarray/-/is-typedarray-1.0.0.tgz",
"integrity": "sha1-5HnICFjfDBsR3dppQPlgEfzaSpo=",
"dev": true
},
"is-utf8": {
"version": "0.2.1",
"resolved": "https://registry.npmjs.org/is-utf8/-/is-utf8-0.2.1.tgz",
"integrity": "sha1-Sw2hRCEE0bM2NA6AeX6GXPOffXI=",
"dev": true
},
"isarray": {
"version": "0.0.1",
"resolved": "https://registry.npmjs.org/isarray/-/isarray-0.0.1.tgz",
"integrity": "sha1-ihis/Kmo9Bd+Cav8YDiTmwXR7t8=",
"dev": true
},
"isomorphic-fetch": {
"version": "2.2.1",
"resolved": "https://registry.npmjs.org/isomorphic-fetch/-/isomorphic-fetch-2.2.1.tgz",
"integrity": "sha1-YRrhrPFPXoH3KVB0coGf6XM1WKk=",
"requires": {
"node-fetch": "^1.0.1",
"whatwg-fetch": ">=0.10.0"
}
},
"isstream": {
"version": "0.1.2",
"resolved": "https://registry.npmjs.org/isstream/-/isstream-0.1.2.tgz",
"integrity": "sha1-R+Y/evVa+m+S4VAOaQ64uFKcCZo=",
"dev": true
},
"js-tokens": {
"version": "3.0.2",
"resolved": "https://registry.npmjs.org/js-tokens/-/js-tokens-3.0.2.tgz",
"integrity": "sha1-mGbfOVECEw449/mWvOtlRDIJwls="
},
"jsbn": {
"version": "0.1.1",
"resolved": "https://registry.npmjs.org/jsbn/-/jsbn-0.1.1.tgz",
"integrity": "sha1-peZUwuWi3rXyAdls77yoDA7y9RM=",
"dev": true,
"optional": true
},
"jsesc": {
"version": "0.5.0",
"resolved": "https://registry.npmjs.org/jsesc/-/jsesc-0.5.0.tgz",
"integrity": "sha1-597mbjXW/Bb3EP6R1c9p9w8IkR0="
},
"json-schema": {
"version": "0.2.3",
"resolved": "https://registry.npmjs.org/json-schema/-/json-schema-0.2.3.tgz",
"integrity": "sha1-tIDIkuWaLwWVTOcnvT8qTogvnhM=",
"dev": true
},
"json-schema-traverse": {
"version": "0.3.1",
"resolved": "https://registry.npmjs.org/json-schema-traverse/-/json-schema-traverse-0.3.1.tgz",
"integrity": "sha1-NJptRMU6Ud6JtAgFxdXlm0F9M0A=",
"dev": true
},
"json-stringify-safe": {
"version": "5.0.1",
"resolved": "https://registry.npmjs.org/json-stringify-safe/-/json-stringify-safe-5.0.1.tgz",
"integrity": "sha1-Epai1Y/UXxmg9s4B1lcB4sc1tus=",
"dev": true
},
"json5": {
"version": "0.5.1",
"resolved": "https://registry.npmjs.org/json5/-/json5-0.5.1.tgz",
"integrity": "sha1-Hq3nrMASA0rYTiOWdn6tn6VJWCE="
},
"jsonfile": {
"version": "2.4.0",
"resolved": "https://registry.npmjs.org/jsonfile/-/jsonfile-2.4.0.tgz",
"integrity": "sha1-NzaitCi4e72gzIO1P6PWM6NcKug=",
"dev": true,
"requires": {
"graceful-fs": "^4.1.6"
}
},
"jsprim": {
"version": "1.4.1",
"resolved": "https://registry.npmjs.org/jsprim/-/jsprim-1.4.1.tgz",
"integrity": "sha1-MT5mvB5cwG5Di8G3SZwuXFastqI=",
"dev": true,
"requires": {
"assert-plus": "1.0.0",
"extsprintf": "1.3.0",
"json-schema": "0.2.3",
"verror": "1.10.0"
}
},
"klaw": {
"version": "1.3.1",
"resolved": "https://registry.npmjs.org/klaw/-/klaw-1.3.1.tgz",
"integrity": "sha1-QIhDO0azsbolnXh4XY6W9zugJDk=",
"dev": true,
"requires": {
"graceful-fs": "^4.1.9"
}
},
"load-json-file": {
"version": "1.1.0",
"resolved": "https://registry.npmjs.org/load-json-file/-/load-json-file-1.1.0.tgz",
"integrity": "sha1-lWkFcI1YtLq0wiYbBPWfMcmTdMA=",
"dev": true,
"requires": {
"graceful-fs": "^4.1.2",
"parse-json": "^2.2.0",
"pify": "^2.0.0",
"pinkie-promise": "^2.0.0",
"strip-bom": "^2.0.0"
}
},
"lodash": {
"version": "4.17.10",
"resolved": "https://registry.npmjs.org/lodash/-/lodash-4.17.10.tgz",
"integrity": "sha512-UejweD1pDoXu+AD825lWwp4ZGtSwgnpZxb3JDViD7StjQz+Nb/6l093lx4OQ0foGWNRoc19mWy7BzL+UAK2iVg=="
},
"loose-envify": {
"version": "1.3.1",
"resolved": "https://registry.npmjs.org/loose-envify/-/loose-envify-1.3.1.tgz",
"integrity": "sha1-0aitM/qc4OcT1l/dCsi3SNR4yEg=",
"requires": {
"js-tokens": "^3.0.0"
}
},
"loud-rejection": {
"version": "1.6.0",
"resolved": "https://registry.npmjs.org/loud-rejection/-/loud-rejection-1.6.0.tgz",
"integrity": "sha1-W0b4AUft7leIcPCG0Eghz5mOVR8=",
"dev": true,
"requires": {
"currently-unhandled": "^0.4.1",
"signal-exit": "^3.0.0"
}
},
"map-obj": {
"version": "1.0.1",
"resolved": "https://registry.npmjs.org/map-obj/-/map-obj-1.0.1.tgz",
"integrity": "sha1-2TPOuSBdgr3PSIb2dCvcK03qFG0=",
"dev": true
},
"meow": {
"version": "3.7.0",
"resolved": "https://registry.npmjs.org/meow/-/meow-3.7.0.tgz",
"integrity": "sha1-cstmi0JSKCkKu/qFaJJYcwioAfs=",
"dev": true,
"requires": {
"camelcase-keys": "^2.0.0",
"decamelize": "^1.1.2",
"loud-rejection": "^1.0.0",
"map-obj": "^1.0.1",
"minimist": "^1.1.3",
"normalize-package-data": "^2.3.4",
"object-assign": "^4.0.1",
"read-pkg-up": "^1.0.1",
"redent": "^1.0.0",
"trim-newlines": "^1.0.0"
},
"dependencies": {
"minimist": {
"version": "1.2.0",
"resolved": "https://registry.npmjs.org/minimist/-/minimist-1.2.0.tgz",
"integrity": "sha1-o1AIsg9BOD7sH7kU9M1d95omQoQ=",
"dev": true
}
}
},
"mime-db": {
"version": "1.36.0",
"resolved": "https://registry.npmjs.org/mime-db/-/mime-db-1.36.0.tgz",
"integrity": "sha512-L+xvyD9MkoYMXb1jAmzI/lWYAxAMCPvIBSWur0PZ5nOf5euahRLVqH//FKW9mWp2lkqUgYiXPgkzfMUFi4zVDw==",
"dev": true
},
"mime-types": {
"version": "2.1.20",
"resolved": "https://registry.npmjs.org/mime-types/-/mime-types-2.1.20.tgz",
"integrity": "sha512-HrkrPaP9vGuWbLK1B1FfgAkbqNjIuy4eHlIYnFi7kamZyLLrGlo2mpcx0bBmNpKqBtYtAfGbodDddIgddSJC2A==",
"dev": true,
"requires": {
"mime-db": "~1.36.0"
}
},
"minimatch": {
"version": "3.0.4",
"resolved": "https://registry.npmjs.org/minimatch/-/minimatch-3.0.4.tgz",
"integrity": "sha512-yJHVQEhyqPLUTgt9B83PXu6W3rx4MvvHvSUvToogpwoGDOUQ+yDrR0HRot+yOCdCO7u4hX3pWft6kWBBcqh0UA==",
"requires": {
"brace-expansion": "^1.1.7"
}
},
"minimist": {
"version": "0.0.8",
"resolved": "https://registry.npmjs.org/minimist/-/minimist-0.0.8.tgz",
"integrity": "sha1-hX/Kv8M5fSYluCKCYuhqp6ARsF0="
},
"mkdirp": {
"version": "0.5.1",
"resolved": "https://registry.npmjs.org/mkdirp/-/mkdirp-0.5.1.tgz",
"integrity": "sha1-MAV0OOrGz3+MR2fzhkjWaX11yQM=",
"requires": {
"minimist": "0.0.8"
}
},
"ms": {
"version": "2.0.0",
"resolved": "https://registry.npmjs.org/ms/-/ms-2.0.0.tgz",
"integrity": "sha1-VgiurfwAvmwpAd9fmGF4jeDVl8g="
},
"node-fetch": {
"version": "1.7.3",
"resolved": "https://registry.npmjs.org/node-fetch/-/node-fetch-1.7.3.tgz",
"integrity": "sha512-NhZ4CsKx7cYm2vSrBAr2PvFOe6sWDf0UYLRqA6svUYg7+/TSfVAu49jYC4BvQ4Sms9SZgdqGBgroqfDhJdTyKQ==",
"requires": {
"encoding": "^0.1.11",
"is-stream": "^1.0.1"
}
},
"normalize-package-data": {
"version": "2.4.0",
"resolved": "https://registry.npmjs.org/normalize-package-data/-/normalize-package-data-2.4.0.tgz",
"integrity": "sha512-9jjUFbTPfEy3R/ad/2oNbKtW9Hgovl5O1FvFWKkKblNXoN/Oou6+9+KKohPK13Yc3/TyunyWhJp6gvRNR/PPAw==",
"dev": true,
"requires": {
"hosted-git-info": "^2.1.4",
"is-builtin-module": "^1.0.0",
"semver": "2 || 3 || 4 || 5",
"validate-npm-package-license": "^3.0.1"
}
},
"nugget": {
"version": "2.0.1",
"resolved": "https://registry.npmjs.org/nugget/-/nugget-2.0.1.tgz",
"integrity": "sha1-IBCVpIfhrTYIGzQy+jytpPjQcbA=",
"dev": true,
"requires": {
"debug": "^2.1.3",
"minimist": "^1.1.0",
"pretty-bytes": "^1.0.2",
"progress-stream": "^1.1.0",
"request": "^2.45.0",
"single-line-log": "^1.1.2",
"throttleit": "0.0.2"
},
"dependencies": {
"minimist": {
"version": "1.2.0",
"resolved": "https://registry.npmjs.org/minimist/-/minimist-1.2.0.tgz",
"integrity": "sha1-o1AIsg9BOD7sH7kU9M1d95omQoQ=",
"dev": true
}
}
},
"number-is-nan": {
"version": "1.0.1",
"resolved": "https://registry.npmjs.org/number-is-nan/-/number-is-nan-1.0.1.tgz",
"integrity": "sha1-CXtgK1NCKlIsGvuHkDGDNpQaAR0="
},
"oauth-sign": {
"version": "0.9.0",
"resolved": "https://registry.npmjs.org/oauth-sign/-/oauth-sign-0.9.0.tgz",
"integrity": "sha512-fexhUFFPTGV8ybAtSIGbV6gOkSv8UtRbDBnAyLQw4QPKkgNlsH2ByPGtMUqdWkos6YCRmAqViwgZrJc/mRDzZQ==",
"dev": true
},
"object-assign": {
"version": "4.1.1",
"resolved": "https://registry.npmjs.org/object-assign/-/object-assign-4.1.1.tgz",
"integrity": "sha1-IQmtx5ZYh8/AXLvUQsrIv7s2CGM="
},
"object-keys": {
"version": "0.4.0",
"resolved": "https://registry.npmjs.org/object-keys/-/object-keys-0.4.0.tgz",
"integrity": "sha1-KKaq50KN0sOpLz2V8hM13SBOAzY=",
"dev": true
},
"once": {
"version": "1.4.0",
"resolved": "https://registry.npmjs.org/once/-/once-1.4.0.tgz",
"integrity": "sha1-WDsap3WWHUsROsF9nFC6753Xa9E=",
"dev": true,
"requires": {
"wrappy": "1"
}
},
"os-homedir": {
"version": "1.0.2",
"resolved": "https://registry.npmjs.org/os-homedir/-/os-homedir-1.0.2.tgz",
"integrity": "sha1-/7xJiDNuDoM94MFox+8VISGqf7M="
},
"os-tmpdir": {
"version": "1.0.2",
"resolved": "https://registry.npmjs.org/os-tmpdir/-/os-tmpdir-1.0.2.tgz",
"integrity": "sha1-u+Z0BseaqFxc/sdm/lc0VV36EnQ="
},
"parse-json": {
"version": "2.2.0",
"resolved": "https://registry.npmjs.org/parse-json/-/parse-json-2.2.0.tgz",
"integrity": "sha1-9ID0BDTvgHQfhGkJn43qGPVaTck=",
"dev": true,
"requires": {
"error-ex": "^1.2.0"
}
},
"path-exists": {
"version": "2.1.0",
"resolved": "https://registry.npmjs.org/path-exists/-/path-exists-2.1.0.tgz",
"integrity": "sha1-D+tsZPD8UY2adU3V77YscCJ2H0s=",
"dev": true,
"requires": {
"pinkie-promise": "^2.0.0"
}
},
"path-is-absolute": {
"version": "1.0.1",
"resolved": "https://registry.npmjs.org/path-is-absolute/-/path-is-absolute-1.0.1.tgz",
"integrity": "sha1-F0uSaHNVNP+8es5r9TpanhtcX18="
},
"path-type": {
"version": "1.1.0",
"resolved": "https://registry.npmjs.org/path-type/-/path-type-1.1.0.tgz",
"integrity": "sha1-WcRPfuSR2nBNpBXaWkBwuk+P5EE=",
"dev": true,
"requires": {
"graceful-fs": "^4.1.2",
"pify": "^2.0.0",
"pinkie-promise": "^2.0.0"
}
},
"pend": {
"version": "1.2.0",
"resolved": "https://registry.npmjs.org/pend/-/pend-1.2.0.tgz",
"integrity": "sha1-elfrVQpng/kRUzH89GY9XI4AelA=",
"dev": true
},
"performance-now": {
"version": "2.1.0",
"resolved": "https://registry.npmjs.org/performance-now/-/performance-now-2.1.0.tgz",
"integrity": "sha1-Ywn04OX6kT7BxpMHrjZLSzd8nns=",
"dev": true
},
"pify": {
"version": "2.3.0",
"resolved": "https://registry.npmjs.org/pify/-/pify-2.3.0.tgz",
"integrity": "sha1-7RQaasBDqEnqWISY59yosVMw6Qw=",
"dev": true
},
"pinkie": {
"version": "2.0.4",
"resolved": "https://registry.npmjs.org/pinkie/-/pinkie-2.0.4.tgz",
"integrity": "sha1-clVrgM+g1IqXToDnckjoDtT3+HA=",
"dev": true
},
"pinkie-promise": {
"version": "2.0.1",
"resolved": "https://registry.npmjs.org/pinkie-promise/-/pinkie-promise-2.0.1.tgz",
"integrity": "sha1-ITXW36ejWMBprJsXh3YogihFD/o=",
"dev": true,
"requires": {
"pinkie": "^2.0.0"
}
},
"pretty-bytes": {
"version": "1.0.4",
"resolved": "https://registry.npmjs.org/pretty-bytes/-/pretty-bytes-1.0.4.tgz",
"integrity": "sha1-CiLoIQYJrTVUL4yNXSFZr/B1HIQ=",
"dev": true,
"requires": {
"get-stdin": "^4.0.1",
"meow": "^3.1.0"
}
},
"private": {
"version": "0.1.8",
"resolved": "https://registry.npmjs.org/private/-/private-0.1.8.tgz",
"integrity": "sha512-VvivMrbvd2nKkiG38qjULzlc+4Vx4wm/whI9pQD35YrARNnhxeiRktSOhSukRLFNlzg6Br/cJPet5J/u19r/mg=="
},
"process-nextick-args": {
"version": "2.0.0",
"resolved": "https://registry.npmjs.org/process-nextick-args/-/process-nextick-args-2.0.0.tgz",
"integrity": "sha512-MtEC1TqN0EU5nephaJ4rAtThHtC86dNN9qCuEhtshvpVBkAW5ZO7BASN9REnF9eoXGcRub+pFuKEpOHE+HbEMw==",
"dev": true
},
"progress-stream": {
"version": "1.2.0",
"resolved": "https://registry.npmjs.org/progress-stream/-/progress-stream-1.2.0.tgz",
"integrity": "sha1-LNPP6jO6OonJwSHsM0er6asSX3c=",
"dev": true,
"requires": {
"speedometer": "~0.1.2",
"through2": "~0.2.3"
}
},
"promise": {
"version": "7.3.1",
"resolved": "https://registry.npmjs.org/promise/-/promise-7.3.1.tgz",
"integrity": "sha512-nolQXZ/4L+bP/UGlkfaIujX9BKxGwmQ9OT4mOt5yvy8iK1h3wqTEJCijzGANTCCl9nWjY41juyAn2K3Q1hLLTg==",
"requires": {
"asap": "~2.0.3"
}
},
"prop-types": {
"version": "15.6.0",
"resolved": "https://registry.npmjs.org/prop-types/-/prop-types-15.6.0.tgz",
"integrity": "sha1-zq8IMCL8RrSjX2nhPvda7Q1jmFY=",
"requires": {
"fbjs": "^0.8.16",
"loose-envify": "^1.3.1",
"object-assign": "^4.1.1"
}
},
"psl": {
"version": "1.1.29",
"resolved": "https://registry.npmjs.org/psl/-/psl-1.1.29.tgz",
"integrity": "sha512-AeUmQ0oLN02flVHXWh9sSJF7mcdFq0ppid/JkErufc3hGIV/AMa8Fo9VgDo/cT2jFdOWoFvHp90qqBH54W+gjQ==",
"dev": true
},
"punycode": {
"version": "1.4.1",
"resolved": "https://registry.npmjs.org/punycode/-/punycode-1.4.1.tgz",
"integrity": "sha1-wNWmOycYgArY4esPpSachN1BhF4=",
"dev": true
},
"qs": {
"version": "6.5.2",
"resolved": "https://registry.npmjs.org/qs/-/qs-6.5.2.tgz",
"integrity": "sha512-N5ZAX4/LxJmF+7wN74pUD6qAh9/wnvdQcjq9TZjevvXzSUo7bfmw91saqMjzGS2xq91/odN2dW/WOl7qQHNDGA==",
"dev": true
},
"rc": {
"version": "1.2.8",
"resolved": "https://registry.npmjs.org/rc/-/rc-1.2.8.tgz",
"integrity": "sha512-y3bGgqKj3QBdxLbLkomlohkvsA8gdAiUQlSBJnBhfn+BPxg4bc62d8TcBW15wavDfgexCgccckhcZvywyQYPOw==",
"dev": true,
"requires": {
"deep-extend": "^0.6.0",
"ini": "~1.3.0",
"minimist": "^1.2.0",
"strip-json-comments": "~2.0.1"
},
"dependencies": {
"minimist": {
"version": "1.2.0",
"resolved": "https://registry.npmjs.org/minimist/-/minimist-1.2.0.tgz",
"integrity": "sha1-o1AIsg9BOD7sH7kU9M1d95omQoQ=",
"dev": true
}
}
},
"react": {
"version": "15.6.2",
"resolved": "https://registry.npmjs.org/react/-/react-15.6.2.tgz",
"integrity": "sha1-26BDSrQ5z+gvEI8PURZjkIF5qnI=",
"requires": {
"create-react-class": "^15.6.0",
"fbjs": "^0.8.9",
"loose-envify": "^1.1.0",
"object-assign": "^4.1.0",
"prop-types": "^15.5.10"
}
},
"react-bootstrap-table": {
"version": "4.3.1",
"resolved": "https://registry.npmjs.org/react-bootstrap-table/-/react-bootstrap-table-4.3.1.tgz",
"integrity": "sha1-9wS+Vbf2vwVX0vxb7G0l/TB9DN4=",
"requires": {
"classnames": "^2.1.2",
"prop-types": "^15.5.10",
"react-modal": "^3.1.7",
"react-s-alert": "^1.3.2"
}
},
"react-dom": {
"version": "15.6.2",
"resolved": "https://registry.npmjs.org/react-dom/-/react-dom-15.6.2.tgz",
"integrity": "sha1-Qc+t9pO3V/rycIRDodH9WgK+9zA=",
"requires": {
"fbjs": "^0.8.9",
"loose-envify": "^1.1.0",
"object-assign": "^4.1.0",
"prop-types": "^15.5.10"
}
},
"react-lifecycles-compat": {
"version": "3.0.4",
"resolved": "https://registry.npmjs.org/react-lifecycles-compat/-/react-lifecycles-compat-3.0.4.tgz",
"integrity": "sha512-fBASbA6LnOU9dOU2eW7aQ8xmYBSXUIWr+UmF9b1efZBazGNO+rcXT/icdKnYm2pTwcRylVUYwW7H1PHfLekVzA=="
},
"react-modal": {
"version": "3.5.1",
"resolved": "https://registry.npmjs.org/react-modal/-/react-modal-3.5.1.tgz",
"integrity": "sha512-GxL7ycOgKC+p641cR+V1bw5dC1faL2N86/AJlzbMVmvt1totoylgkJmn9zvLuHeuarGbB7CLfHMGpeRowaj2jQ==",
"requires": {
"exenv": "^1.2.0",
"prop-types": "^15.5.10",
"react-lifecycles-compat": "^3.0.0",
"warning": "^3.0.0"
}
},
"react-s-alert": {
"version": "1.4.1",
"resolved": "https://registry.npmjs.org/react-s-alert/-/react-s-alert-1.4.1.tgz",
"integrity": "sha512-+cSpVPe6YeGklhlo7zbVlB0Z6jdiU9HPmEVzp5nIhNm9lvdL7rVO2Jx09pCwT99GmODyoN0iNhbQku6r7six8A==",
"requires": {
"babel-runtime": "^6.23.0"
}
},
"read-pkg": {
"version": "1.1.0",
"resolved": "https://registry.npmjs.org/read-pkg/-/read-pkg-1.1.0.tgz",
"integrity": "sha1-9f+qXs0pyzHAR0vKfXVra7KePyg=",
"dev": true,
"requires": {
"load-json-file": "^1.0.0",
"normalize-package-data": "^2.3.2",
"path-type": "^1.0.0"
}
},
"read-pkg-up": {
"version": "1.0.1",
"resolved": "https://registry.npmjs.org/read-pkg-up/-/read-pkg-up-1.0.1.tgz",
"integrity": "sha1-nWPBMnbAZZGNV/ACpX9AobZD+wI=",
"dev": true,
"requires": {
"find-up": "^1.0.0",
"read-pkg": "^1.0.0"
}
},
"readable-stream": {
"version": "1.1.14",
"resolved": "https://registry.npmjs.org/readable-stream/-/readable-stream-1.1.14.tgz",
"integrity": "sha1-fPTFTvZI44EwhMY23SB54WbAgdk=",
"dev": true,
"requires": {
"core-util-is": "~1.0.0",
"inherits": "~2.0.1",
"isarray": "0.0.1",
"string_decoder": "~0.10.x"
}
},
"redent": {
"version": "1.0.0",
"resolved": "https://registry.npmjs.org/redent/-/redent-1.0.0.tgz",
"integrity": "sha1-z5Fqsf1fHxbfsggi3W7H9zDCr94=",
"dev": true,
"requires": {
"indent-string": "^2.1.0",
"strip-indent": "^1.0.1"
}
},
"regenerate": {
"version": "1.3.3",
"resolved": "https://registry.npmjs.org/regenerate/-/regenerate-1.3.3.tgz",
"integrity": "sha512-jVpo1GadrDAK59t/0jRx5VxYWQEDkkEKi6+HjE3joFVLfDOh9Xrdh0dF1eSq+BI/SwvTQ44gSscJ8N5zYL61sg=="
},
"regenerator-runtime": {
"version": "0.11.0",
"resolved": "https://registry.npmjs.org/regenerator-runtime/-/regenerator-runtime-0.11.0.tgz",
"integrity": "sha512-/aA0kLeRb5N9K0d4fw7ooEbI+xDe+DKD499EQqygGqeS8N3xto15p09uY2xj7ixP81sNPXvRLnAQIqdVStgb1A=="
},
"regenerator-transform": {
"version": "0.10.1",
"resolved": "https://registry.npmjs.org/regenerator-transform/-/regenerator-transform-0.10.1.tgz",
"integrity": "sha512-PJepbvDbuK1xgIgnau7Y90cwaAmO/LCLMI2mPvaXq2heGMR3aWW5/BQvYrhJ8jgmQjXewXvBjzfqKcVOmhjZ6Q==",
"requires": {
"babel-runtime": "^6.18.0",
"babel-types": "^6.19.0",
"private": "^0.1.6"
}
},
"regexpu-core": {
"version": "2.0.0",
"resolved": "https://registry.npmjs.org/regexpu-core/-/regexpu-core-2.0.0.tgz",
"integrity": "sha1-SdA4g3uNz4v6W5pCE5k45uoq4kA=",
"requires": {
"regenerate": "^1.2.1",
"regjsgen": "^0.2.0",
"regjsparser": "^0.1.4"
}
},
"regjsgen": {
"version": "0.2.0",
"resolved": "https://registry.npmjs.org/regjsgen/-/regjsgen-0.2.0.tgz",
"integrity": "sha1-bAFq3qxVT3WCP+N6wFuS1aTtsfc="
},
"regjsparser": {
"version": "0.1.5",
"resolved": "https://registry.npmjs.org/regjsparser/-/regjsparser-0.1.5.tgz",
"integrity": "sha1-fuj4Tcb6eS0/0K4ijSS9lJ6tIFw=",
"requires": {
"jsesc": "~0.5.0"
}
},
"repeating": {
"version": "2.0.1",
"resolved": "https://registry.npmjs.org/repeating/-/repeating-2.0.1.tgz",
"integrity": "sha1-UhTFOpJtNVJwdSf7q0FdvAjQbdo=",
"requires": {
"is-finite": "^1.0.0"
}
},
"request": {
"version": "2.88.0",
"resolved": "https://registry.npmjs.org/request/-/request-2.88.0.tgz",
"integrity": "sha512-NAqBSrijGLZdM0WZNsInLJpkJokL72XYjUpnB0iwsRgxh7dB6COrHnTBNwN0E+lHDAJzu7kLAkDeY08z2/A0hg==",
"dev": true,
"requires": {
"aws-sign2": "~0.7.0",
"aws4": "^1.8.0",
"caseless": "~0.12.0",
"combined-stream": "~1.0.6",
"extend": "~3.0.2",
"forever-agent": "~0.6.1",
"form-data": "~2.3.2",
"har-validator": "~5.1.0",
"http-signature": "~1.2.0",
"is-typedarray": "~1.0.0",
"isstream": "~0.1.2",
"json-stringify-safe": "~5.0.1",
"mime-types": "~2.1.19",
"oauth-sign": "~0.9.0",
"performance-now": "^2.1.0",
"qs": "~6.5.2",
"safe-buffer": "^5.1.2",
"tough-cookie": "~2.4.3",
"tunnel-agent": "^0.6.0",
"uuid": "^3.3.2"
}
},
"rimraf": {
"version": "2.6.2",
"resolved": "https://registry.npmjs.org/rimraf/-/rimraf-2.6.2.tgz",
"integrity": "sha512-lreewLK/BlghmxtfH36YYVg1i8IAce4TI7oao75I1g245+6BctqTVQiBP3YUJ9C6DQOXJmkYR9X9fCLtCOJc5w==",
"dev": true,
"requires": {
"glob": "^7.0.5"
}
},
"safe-buffer": {
"version": "5.1.2",
"resolved": "https://registry.npmjs.org/safe-buffer/-/safe-buffer-5.1.2.tgz",
"integrity": "sha512-Gd2UZBJDkXlY7GbJxfsE8/nvKkUEU1G38c1siN6QP6a9PT9MmHB8GnpscSmMJSoF8LOIrt8ud/wPtojys4G6+g==",
"dev": true
},
"safer-buffer": {
"version": "2.1.2",
"resolved": "https://registry.npmjs.org/safer-buffer/-/safer-buffer-2.1.2.tgz",
"integrity": "sha512-YZo3K82SD7Riyi0E1EQPojLz7kpepnSQI9IyPbHHg1XXXevb5dJI7tpyN2ADxGcQbHG7vcyRHk0cbwqcQriUtg==",
"dev": true
},
"semver": {
"version": "5.5.1",
"resolved": "https://registry.npmjs.org/semver/-/semver-5.5.1.tgz",
"integrity": "sha512-PqpAxfrEhlSUWge8dwIp4tZnQ25DIOthpiaHNIthsjEFQD6EvqUKUDM7L8O2rShkFccYo1VjJR0coWfNkCubRw==",
"dev": true
},
"setimmediate": {
"version": "1.0.5",
"resolved": "https://registry.npmjs.org/setimmediate/-/setimmediate-1.0.5.tgz",
"integrity": "sha1-KQy7Iy4waULX1+qbg3Mqt4VvgoU="
},
"signal-exit": {
"version": "3.0.2",
"resolved": "https://registry.npmjs.org/signal-exit/-/signal-exit-3.0.2.tgz",
"integrity": "sha1-tf3AjxKH6hF4Yo5BXiUTK3NkbG0=",
"dev": true
},
"single-line-log": {
"version": "1.1.2",
"resolved": "https://registry.npmjs.org/single-line-log/-/single-line-log-1.1.2.tgz",
"integrity": "sha1-wvg/Jzo+GhbtsJlWYdoO1e8DM2Q=",
"dev": true,
"requires": {
"string-width": "^1.0.1"
}
},
"slash": {
"version": "1.0.0",
"resolved": "https://registry.npmjs.org/slash/-/slash-1.0.0.tgz",
"integrity": "sha1-xB8vbDn8FtHNF61LXYlhFK5HDVU="
},
"source-map": {
"version": "0.5.7",
"resolved": "https://registry.npmjs.org/source-map/-/source-map-0.5.7.tgz",
"integrity": "sha1-igOdLRAh0i0eoUyA2OpGi6LvP8w="
},
"source-map-support": {
"version": "0.4.18",
"resolved": "https://registry.npmjs.org/source-map-support/-/source-map-support-0.4.18.tgz",
"integrity": "sha512-try0/JqxPLF9nOjvSta7tVondkP5dwgyLDjVoyMDlmjugT2lRZ1OfsrYTkCd2hkDnJTKRbO/Rl3orm8vlsUzbA==",
"requires": {
"source-map": "^0.5.6"
}
},
"spdx-correct": {
"version": "3.0.0",
"resolved": "https://registry.npmjs.org/spdx-correct/-/spdx-correct-3.0.0.tgz",
"integrity": "sha512-N19o9z5cEyc8yQQPukRCZ9EUmb4HUpnrmaL/fxS2pBo2jbfcFRVuFZ/oFC+vZz0MNNk0h80iMn5/S6qGZOL5+g==",
"dev": true,
"requires": {
"spdx-expression-parse": "^3.0.0",
"spdx-license-ids": "^3.0.0"
}
},
"spdx-exceptions": {
"version": "2.1.0",
"resolved": "https://registry.npmjs.org/spdx-exceptions/-/spdx-exceptions-2.1.0.tgz",
"integrity": "sha512-4K1NsmrlCU1JJgUrtgEeTVyfx8VaYea9J9LvARxhbHtVtohPs/gFGG5yy49beySjlIMhhXZ4QqujIZEfS4l6Cg==",
"dev": true
},
"spdx-expression-parse": {
"version": "3.0.0",
"resolved": "https://registry.npmjs.org/spdx-expression-parse/-/spdx-expression-parse-3.0.0.tgz",
"integrity": "sha512-Yg6D3XpRD4kkOmTpdgbUiEJFKghJH03fiC1OPll5h/0sO6neh2jqRDVHOQ4o/LMea0tgCkbMgea5ip/e+MkWyg==",
"dev": true,
"requires": {
"spdx-exceptions": "^2.1.0",
"spdx-license-ids": "^3.0.0"
}
},
"spdx-license-ids": {
"version": "3.0.0",
"resolved": "https://registry.npmjs.org/spdx-license-ids/-/spdx-license-ids-3.0.0.tgz",
"integrity": "sha512-2+EPwgbnmOIl8HjGBXXMd9NAu02vLjOO1nWw4kmeRDFyHn+M/ETfHxQUK0oXg8ctgVnl9t3rosNVsZ1jG61nDA==",
"dev": true
},
"speedometer": {
"version": "0.1.4",
"resolved": "https://registry.npmjs.org/speedometer/-/speedometer-0.1.4.tgz",
"integrity": "sha1-mHbb0qFp0xFUAtSObqYynIgWpQ0=",
"dev": true
},
"sshpk": {
"version": "1.14.2",
"resolved": "https://registry.npmjs.org/sshpk/-/sshpk-1.14.2.tgz",
"integrity": "sha1-xvxhZIo9nE52T9P8306hBeSSupg=",
"dev": true,
"requires": {
"asn1": "~0.2.3",
"assert-plus": "^1.0.0",
"bcrypt-pbkdf": "^1.0.0",
"dashdash": "^1.12.0",
"ecc-jsbn": "~0.1.1",
"getpass": "^0.1.1",
"jsbn": "~0.1.0",
"safer-buffer": "^2.0.2",
"tweetnacl": "~0.14.0"
}
},
"string-width": {
"version": "1.0.2",
"resolved": "https://registry.npmjs.org/string-width/-/string-width-1.0.2.tgz",
"integrity": "sha1-EYvfW4zcUaKn5w0hHgfisLmxB9M=",
"dev": true,
"requires": {
"code-point-at": "^1.0.0",
"is-fullwidth-code-point": "^1.0.0",
"strip-ansi": "^3.0.0"
}
},
"string_decoder": {
"version": "0.10.31",
"resolved": "https://registry.npmjs.org/string_decoder/-/string_decoder-0.10.31.tgz",
"integrity": "sha1-YuIDvEF2bGwoyfyEMB2rHFMQ+pQ=",
"dev": true
},
"strip-ansi": {
"version": "3.0.1",
"resolved": "https://registry.npmjs.org/strip-ansi/-/strip-ansi-3.0.1.tgz",
"integrity": "sha1-ajhfuIU9lS1f8F0Oiq+UJ43GPc8=",
"requires": {
"ansi-regex": "^2.0.0"
}
},
"strip-bom": {
"version": "2.0.0",
"resolved": "https://registry.npmjs.org/strip-bom/-/strip-bom-2.0.0.tgz",
"integrity": "sha1-YhmoVhZSBJHzV4i9vxRHqZx+aw4=",
"dev": true,
"requires": {
"is-utf8": "^0.2.0"
}
},
"strip-indent": {
"version": "1.0.1",
"resolved": "https://registry.npmjs.org/strip-indent/-/strip-indent-1.0.1.tgz",
"integrity": "sha1-DHlipq3vp7vUrDZkYKY4VSrhoKI=",
"dev": true,
"requires": {
"get-stdin": "^4.0.1"
}
},
"strip-json-comments": {
"version": "2.0.1",
"resolved": "https://registry.npmjs.org/strip-json-comments/-/strip-json-comments-2.0.1.tgz",
"integrity": "sha1-PFMZQukIwml8DsNEhYwobHygpgo=",
"dev": true
},
"sumchecker": {
"version": "1.3.1",
"resolved": "https://registry.npmjs.org/sumchecker/-/sumchecker-1.3.1.tgz",
"integrity": "sha1-ebs7RFbdBPGOvbwNcDodHa7FEF0=",
"dev": true,
"requires": {
"debug": "^2.2.0",
"es6-promise": "^4.0.5"
}
},
"supports-color": {
"version": "2.0.0",
"resolved": "https://registry.npmjs.org/supports-color/-/supports-color-2.0.0.tgz",
"integrity": "sha1-U10EXOa2Nj+kARcIRimZXp3zJMc="
},
"throttleit": {
"version": "0.0.2",
"resolved": "https://registry.npmjs.org/throttleit/-/throttleit-0.0.2.tgz",
"integrity": "sha1-z+34jmDADdlpe2H90qg0OptoDq8=",
"dev": true
},
"through2": {
"version": "0.2.3",
"resolved": "https://registry.npmjs.org/through2/-/through2-0.2.3.tgz",
"integrity": "sha1-6zKE2k6jEbbMis42U3SKUqvyWj8=",
"dev": true,
"requires": {
"readable-stream": "~1.1.9",
"xtend": "~2.1.1"
}
},
"to-fast-properties": {
"version": "1.0.3",
"resolved": "https://registry.npmjs.org/to-fast-properties/-/to-fast-properties-1.0.3.tgz",
"integrity": "sha1-uDVx+k2MJbguIxsG46MFXeTKGkc="
},
"tough-cookie": {
"version": "2.4.3",
"resolved": "https://registry.npmjs.org/tough-cookie/-/tough-cookie-2.4.3.tgz",
"integrity": "sha512-Q5srk/4vDM54WJsJio3XNn6K2sCG+CQ8G5Wz6bZhRZoAe/+TxjWB/GlFAnYEbkYVlON9FMk/fE3h2RLpPXo4lQ==",
"dev": true,
"requires": {
"psl": "^1.1.24",
"punycode": "^1.4.1"
}
},
"trim-newlines": {
"version": "1.0.0",
"resolved": "https://registry.npmjs.org/trim-newlines/-/trim-newlines-1.0.0.tgz",
"integrity": "sha1-WIeWa7WCpFA6QetST301ARgVphM=",
"dev": true
},
"trim-right": {
"version": "1.0.1",
"resolved": "https://registry.npmjs.org/trim-right/-/trim-right-1.0.1.tgz",
"integrity": "sha1-yy4SAwZ+DI3h9hQJS5/kVwTqYAM="
},
"tunnel-agent": {
"version": "0.6.0",
"resolved": "https://registry.npmjs.org/tunnel-agent/-/tunnel-agent-0.6.0.tgz",
"integrity": "sha1-J6XeoGs2sEoKmWZ3SykIaPD8QP0=",
"dev": true,
"requires": {
"safe-buffer": "^5.0.1"
}
},
"tweetnacl": {
"version": "0.14.5",
"resolved": "https://registry.npmjs.org/tweetnacl/-/tweetnacl-0.14.5.tgz",
"integrity": "sha1-WuaBd/GS1EViadEIr6k/+HQ/T2Q=",
"dev": true,
"optional": true
},
"typedarray": {
"version": "0.0.6",
"resolved": "https://registry.npmjs.org/typedarray/-/typedarray-0.0.6.tgz",
"integrity": "sha1-hnrHTjhkGHsdPUfZlqeOxciDB3c=",
"dev": true
},
"ua-parser-js": {
"version": "0.7.17",
"resolved": "https://registry.npmjs.org/ua-parser-js/-/ua-parser-js-0.7.17.tgz",
"integrity": "sha512-uRdSdu1oA1rncCQL7sCj8vSyZkgtL7faaw9Tc9rZ3mGgraQ7+Pdx7w5mnOSF3gw9ZNG6oc+KXfkon3bKuROm0g=="
},
"util-deprecate": {
"version": "1.0.2",
"resolved": "https://registry.npmjs.org/util-deprecate/-/util-deprecate-1.0.2.tgz",
"integrity": "sha1-RQ1Nyfpw3nMnYvvS1KKJgUGaDM8=",
"dev": true
},
"uuid": {
"version": "3.3.2",
"resolved": "https://registry.npmjs.org/uuid/-/uuid-3.3.2.tgz",
"integrity": "sha512-yXJmeNaw3DnnKAOKJE51sL/ZaYfWJRl1pK9dr19YFCu0ObS231AB1/LbqTKRAQ5kw8A90rA6fr4riOUpTZvQZA==",
"dev": true
},
"validate-npm-package-license": {
"version": "3.0.4",
"resolved": "https://registry.npmjs.org/validate-npm-package-license/-/validate-npm-package-license-3.0.4.tgz",
"integrity": "sha512-DpKm2Ui/xN7/HQKCtpZxoRWBhZ9Z0kqtygG8XCgNQ8ZlDnxuQmWhj566j8fN4Cu3/JmbhsDo7fcAJq4s9h27Ew==",
"dev": true,
"requires": {
"spdx-correct": "^3.0.0",
"spdx-expression-parse": "^3.0.0"
}
},
"verror": {
"version": "1.10.0",
"resolved": "https://registry.npmjs.org/verror/-/verror-1.10.0.tgz",
"integrity": "sha1-OhBcoXBTr1XW4nDB+CiGguGNpAA=",
"dev": true,
"requires": {
"assert-plus": "^1.0.0",
"core-util-is": "1.0.2",
"extsprintf": "^1.2.0"
}
},
"warning": {
"version": "3.0.0",
"resolved": "https://registry.npmjs.org/warning/-/warning-3.0.0.tgz",
"integrity": "sha1-MuU3fLVy3kqwR1O9+IIcAe1gW3w=",
"requires": {
"loose-envify": "^1.0.0"
}
},
"whatwg-fetch": {
"version": "2.0.3",
"resolved": "https://registry.npmjs.org/whatwg-fetch/-/whatwg-fetch-2.0.3.tgz",
"integrity": "sha1-nITsLc9oGH/wC8ZOEnS0QhduHIQ="
},
"wrappy": {
"version": "1.0.2",
"resolved": "https://registry.npmjs.org/wrappy/-/wrappy-1.0.2.tgz",
"integrity": "sha1-tSQ9jz7BqjXxNkYFvA0QNuMKtp8=",
"dev": true
},
"xtend": {
"version": "2.1.2",
"resolved": "https://registry.npmjs.org/xtend/-/xtend-2.1.2.tgz",
"integrity": "sha1-bv7MKk2tjmlixJAbM3znuoe10os=",
"dev": true,
"requires": {
"object-keys": "~0.4.0"
}
},
"yauzl": {
"version": "2.4.1",
"resolved": "https://registry.npmjs.org/yauzl/-/yauzl-2.4.1.tgz",
"integrity": "sha1-lSj0QtqxsihOWLQ3m7GU4i4MQAU=",
"dev": true,
"requires": {
"fd-slicer": "~1.0.1"
}
}
}
}
|
Q:
Select from four mysql table with count and sum columns and where clause
I have 5 tables in my schema.
First is opn:
| opnID | submitID | emailID | opnDate | invalidOPN |
+-------+----------+---------+---------------------+------------+
| 1 | 6 | 1 | 2014-10-15 11:45:50 | 2 |
| 2 | 6 | 2 | 2014-10-15 11:55:52 | 0 |
| 3 | 6 | 3 | 2014-10-15 12:41:52 | 10 |
| 4 | 7 | 2 | 2014-10-15 17:45:22 | 1 |
| 5 | 7 | 3 | 2014-10-16 00:45:55 | 5 |
| 6 | 6 | 5 | 2014-10-16 01:45:11 | 0 |
I also have clk:
| clkID| submitID | emailID | clkDate | invalidCLK |
+-------+----------+---------+---------------------+------------+
| 1 | 6 | 1 | 2014-10-15 11:45:55 | 1 |
| 2 | 6 | 2 | 2014-10-15 11:55:59 | 0 |
| 3 | 6 | 3 | 2014-10-15 12:42:52 | 5 |
| 4 | 7 | 3 | 2014-10-15 17:46:12 | 0 |
| 5 | 6 | 5 | 2014-10-16 00:46:55 | 0 |
A users table:
| userID | firstName | secondName |
+--------+-----------+------------+
| 1 | john | smith |
| 1 | susan | bella |
A submission table:
| submitID | userID |
+----------+--------+
| 6 | 1 |
| 7 | 2 |
I need to count opn.submitID to get the number of open and count clk.submitID to get the number of clicks and total of invalidclk and invalidopn for each users.
Here are my expected results:
| userID | fName | sName | numberOfOpen | SUM(opn.invalidOPN) | numberOfClicks | SUM(clk.invalidCLK) |
+--------+-------+-------+--------------+---------------------+----------------+---------------------+
| 1 | john | smith | 4 | 12 | 4 | 6 |
| 2 | susan | bella | 2 | 6 | 1 | 0 |
I tried with those two queries but I don't reach the result that I need
SELECT users.userID, users.FirstName, users.SecondName, count(opn.submitID) as "Number of Opens", sum(opn.InvalidOPN) as "Number of invalid Opens"
FROM users
RIGHT JOIN ( submission INNER JOIN opn ON opn.submitID = submission.submitID and OPNDate between "2013-10-01 00:00:00" AND "2014-10-31 23:59:59" ) ON submission.UserID = users.UserID group by users.userID
UNION
SELECT users.userID, users.FirstName, users.SecondName, count(clk.submitID) as "Number of clicks", sum(clk.InvalidCLK) as "Number of invalid clicks"
FROM users
RIGHT JOIN ( submission INNER JOIN clk ON clk.submitID = submission.submitID and CLKDate between "2013-10-01 00:00:00" AND "2014-10-31 23:59:59") ON submission.UserID = users.UserID group by users.userID
SELECT users.userID, users.FirstName, users.SecondName, count(opn.submitID) as "Number of Opens", sum(opn.InvalidOPN) as "Number of invalid Opens", count(clk.submitID) as "Number of clicks", sum(clk.InvalidCLK) as "Number of invalid clicks"
FROM users, submission, clk, opn
where opn.submitID = submission.submitID and clk.submitID = submission.submitID
And CLKDate between "2013-10-01 00:00:00" AND "2014-10-31 23:59:59"
AND submission.UserID = users.UserID group by users.userID
Please help me, and show me what I need to change.
A:
The main problem with doing this is that you land up joining the tables against each other and getting every combination of opn and clk records. In such a situation you land up needing to use COUNT(DISTINCT some_field_name) to count the unique values:-
SELECT users.UserId
COUNT(DISTINCT opn.OPNID),
COUNT(DISTINCT clk.CLKID)
FROM users
LEFT OUTER JOIN submission ON users.UserId = submission.UserId
LEFT OUTER JOIN opn ON submission.SubmitID = opn.SubmitID
LEFT OUTER JOIN clk ON submission.SubmitID = clk.SubmitID
GROUP BY users.UserId
However that doesn't help in this case as you also need the sum of the invalid___ fields.
As such I would suggest using a couple of sub queries, one for clk and one for opn. These get the counts and the sums grouped by the user id. And the results of these sub queries are joined to the users table.
Something like this:-
SELECT users.UserId,
users.fName,
users.sName,
numberOfOpen,
COALESCE(invalidopnsum, 0),
numberOfClicks,
COALESCE(invalidclksum, 0)
FROM users
LEFT OUTER JOIN
(
SELECT submission.UserId, COUNT(opn.SubmitID) AS numberOfOpen, SUM(opn.InvalidOPN) AS invalidopnsum
FROM submission
LEFT OUTER JOIN opn ON submission.SubmitID = opn.SubmitID
GROUP BY submission.UserId
) opn1
ON users.UserId = opn1.UserId
LEFT OUTER JOIN
(
SELECT submission.UserId, COUNT(clk.SubmitID) AS numberOfClicks, SUM(clk.InvalidCLK) AS invalidclksum
FROM submission
LEFT OUTER JOIN clk ON submission.SubmitID = clk.SubmitID
GROUP BY submission.UserId
) clk1
ON users.UserId = clk1.UserId
|
Carotenoids are a group of pigments that are characterized by the color including and ranging from yellow to red. Carotenoids are commonly produced by a wide variety of plant materials and most commonly associated with plants such as tomatoes, carrots and peppers.
Lycopene and its precursor phytofluene are carotenoids commonly found in tomatoes and are the predominant sources of the bright red color associated with tomatoes. Phytoene is a precursor to phytofluene, lycopene and other carotenoids, and is also found in high concentrations in tomatoes. Lycopene is generally present in the plasma of the human body; the serum concentrations of lycopene are typically about 2.5 times higher than those of .alpha.-carotene and 7.5 times greater than those of .beta.-carotene. Carotenoids are known to have antioxidant properties and consequently, provide numerous beneficial health effects including reducing the potential risks of cardiovascular diseases, cancers, and slowing and/or reversing the degenerative effects of aging on various human physiological activities.
Prostate cancer and benign prostatic hyperplasia (also called BPH) are aging-related conditions that affect prostate gland physiology and impair urinary function in men. As many men age, their prostate glands slowly enlarge causing (a) obstructive symptoms exemplified by weak and/or intermittent urinary streams, a sense of residual urine in the bladder after voiding, and dribbling or leakage at the end of urination, and/or (b) irritative symptoms as exemplified by urgency of micturation, increased frequency of urination, and uracratia. Obstructive and irritative urinary symptoms are commonly referred to as lower urinary tract symptoms (LUTS). The current treatments of prostrate cancer, BPH and LUTS symptoms consist of drug therapies and major surgery. The two primary drug classes used are alpha-blockers and 5-alpha-reductase inhibitors, which should be taken for life in order to get the persistent efficacy. When surgery is considered, the results are usually positive, but there are risks associated with such surgical operations.
US Patent Publication 2005/0031557 describes an oral composition containing lutein, phytoene and phytofluene, but professing no preference for any specific amount of either of phytoene or phytofluene relative to lutein or any one of the list consisting of .alpha.-carotene, astaxanthin, .alpha.-cryptoxanthin, .beta.-cryptoxanthin, zeaxanthin, phytoene, phtyofluene, .gamma.-carotene and neurosporin, nor any especially important reason for including any of the members of that list in the composition. The '557 publication fails to indicate any important benefit may be obtained by inclusion of phytoene or phytofluene in the composition relative to any other component thereof. |
Hello,
I created the site http://d.whosme.de ! I just want you to know. There you can find some Movie Tutorials on how to begin programming in D. Its Multilanguage: german and english so far.
The next Tutorials will contain more programming related stuff.
bye
Matthias Thurau wrote:
> Hello,
> > I created the site http://d.whosme.de ! I just want you to know. There you can find some Movie Tutorials on how to begin programming in D. Its Multilanguage: german and english so far.
> > The next Tutorials will contain more programming related stuff.
> > bye
One small critique, you may want to change the "Programming in D" title text to a more contrasting color, or simply move it up by a few pixels:
uberschrift{
padding-top: 22px; /* just an example */
color: #000; /* also just an example */
}
Sky blue on olive is really hard to read, IMO.
This is a great concept. Thanks for putting this online.
--
- EricAnderton at yahoo
Matthias Thurau wrote:
> Hello,
> > I created the site http://d.whosme.de ! I just want you to know. There you can find some Movie Tutorials on how to begin programming in D. Its Multilanguage: german and english so far.
> > The next Tutorials will contain more programming related stuff.
Nice!
I have a suggestion though: please add the phrase "D programming language" on your page template so it appears somewhere on each page. This is so that google will find your page, as I encourage people to google for "D programming language" when searching for D relates things. Googling on "D" is fairly useless.
Matthias Thurau wrote:
> Hello,
> > I created the site http://d.whosme.de ! I just want you to know. There you can find some Movie Tutorials on how to begin programming in D. Its Multilanguage: german and english so far.
> > The next Tutorials will contain more programming related stuff.
> > bye
Are you willing to accept and post tutorials by other people and/or on different subjects?
- Gregor Richards
Gregor Richards Wrote:
> Matthias Thurau wrote:
> > Hello,
> > > > I created the site http://d.whosme.de ! I just want you to know. There you can find some Movie Tutorials on how to begin programming in D. Its Multilanguage: german and english so far.
> > > > The next Tutorials will contain more programming related stuff.
> > > > bye
> > Are you willing to accept and post tutorials by other people and/or on different subjects?
> > - Gregor Richards
Yes, i will add Tutorials from other People, too. And of Course: More Translations if somebody want to translate something.
bye
Walter Bright Wrote:
> Matthias Thurau wrote:
> > Hello,
> > > > I created the site http://d.whosme.de ! I just want you to know. There you can find some Movie Tutorials on how to begin programming in D. Its Multilanguage: german and english so far.
> > > > The next Tutorials will contain more programming related stuff.
> > Nice!
> > I have a suggestion though: please add the phrase "D programming language" on your page template so it appears somewhere on each page. This is so that google will find your page, as I encourage people to google for "D programming language" when searching for D relates things. Googling on "D" is fairly useless.
Thats a useful Tip!! I will do that.
bye
Pragma Wrote:
> One small critique, you may want to change the "Programming in D" title text to a more contrasting color, or simply move it up by a few pixels:
> > uberschrift{
> padding-top: 22px; /* just an example */
> color: #000; /* also just an example */
> }
> > Sky blue on olive is really hard to read, IMO.
> > This is a great concept. Thanks for putting this online.
> > --
> - EricAnderton at yahoo
Hi,
What Browser are you Using? Normally there should be any blue on green. In Microsoft Internet Explorer 7 and on Firefox it looks like this:
http://data.whosme.de/dwhosmede/dwhosmede.jpg
bye
Matthias Thurau wrote:
> Pragma Wrote:
> >> One small critique, you may want to change the "Programming in D" title text to a more contrasting color, or simply move it up by a few pixels:
>>>> uberschrift{
>> padding-top: 22px; /* just an example */
>> color: #000; /* also just an example */
>> }
>>>> Sky blue on olive is really hard to read, IMO.
>>>> This is a great concept. Thanks for putting this online.
>>>> --
>> - EricAnderton at yahoo
> > Hi,
> > What Browser are you Using? Normally there should be any blue on green. In Microsoft Internet Explorer 7 and on Firefox it looks like this:
> http://data.whosme.de/dwhosmede/dwhosmede.jpg> > bye
>
I see a significant amount of blue-on-green in that jpeg you just posted ... and it looks like that in Firefox.
- Gregor Richards |
<page xmlns="http://projectmallard.org/1.0/"
xmlns:its="http://www.w3.org/2005/11/its"
xmlns:e="http://projectmallard.org/experimental/"
type="guide" style="2column task"
id="index">
<info>
<revision pkgversion="4.1.0" date="2018-04-24" status="draft"/>
<revision pkgversion="4.1.0" date="2018-05-28" status="candidate"/>
<desc>Bible study tool for reading, study, and research using modules from
The SWORD Project and elsewhere.</desc>
<title type='link' role="trail">
<media type="image" its:translate="no" src="figures/xiphos-trail-icon.png"/>
</title>
<title type='text'>Xiphos</title>
<credit type="author" its:translate="no">
<name>Andy Piper</name>
</credit>
<credit type="author" its:translate="no">
<name>Pierre Benz</name>
</credit>
<credit type="author" its:translate="no">
<name>Dr Peter von Kaehne</name>
</credit>
<credit type="author" its:translate="no">
<name>Karl Kleinpaste</name>
</credit>
<credit type="author" its:translate="no">
<name>Matthew Talbert</name>
</credit>
<include href="legal.xml" xmlns="http://www.w3.org/2001/XInclude"/>
</info>
<title its:translate="no">
<media type="image" its:translate="no" src="figures/xiphos-icon.png">
<span its:translate="yes">Xiphos logo</span>
</media>Xiphos
</title>
<p><app>Xiphos</app> is a Bible study tool, offering a rich and featureful
environment for reading, study, and research using modules from The SWORD
Project and elsewhere.</p>
<section id="getting-started" style="2column">
<title>First steps</title>
</section>
<section id="module-manager" style="2column">
<title>Module Manager</title>
</section>
<section id="search-function" style="2column">
<title>Search Functions</title>
</section>
<section id="personal-comments" style="2column">
<title>Add Comments and Notes</title>
</section>
<section id="preferences" style="2column">
<title>Preferences</title>
</section>
</page>
|
Filmmakers create movies. Bloggers report the news and shape public opinion. Explorers travel the globe, seeking out new cultures and sharing experiences. DJs and producers craft beats and tracks using an alchemical mix of audio artifacts and imagination. Rappers fashion rhymes and navigate the cadences of vocal delivery characterized as “flow.”
Blue Scholars do all these things—and a hell of a lot more—every damn day. First and foremost, DJ/producer Sabzi and MC Geologic are a music group. They do the fundamental things bands have done for decades: Make records and play live shows. But those are just points on a plane, bright stars in Blue Scholars’ ever-expanding universe. “It all revolves around using everything at our disposal to be good storytellers,” says Sabzi. Chuck D famously likened hip-hop to CNN, but frankly, Blue Scholars make Anderson Cooper and company look lazy by comparison.
Blue Scholars informally call their music “cinema art rap,” yet most folks will probably just hear it as smart 21st century pop. The duo is just as likely to take inspiration from the sugar rush of Empire of the Sun’s feel-good hit “Walking on a Dream” (check out the “Empire Remix” of “New People”) as from a classic Lalo Schifrin soundtrack. The roster of former Seattle Sonics or observations about Fox New commentators may provide the springboard for their next round of poetic musing.
Meanwhile, Blue Scholars are constantly churning out new missives as quickly as the inspiration hits them, disseminated via the Internet. Whether provoked by current events like the passage of Arizona’s Immigration Law SB1070 (“Joe Arpaio,” credited to Geo’s alter-ego Prometheus Brown), or contemplating how the Future went from a sparkling wonderland of flying cars and personal jet packs to a post-apocalyptic wasteland shot in shades of ash and bone (“Paul Valéry”), Blue Scholars react to real events in real time—with music that sounds fresh because it is.
Since 2002, Blue Scholars have been based in the 98118, decreed the most ethnically diverse zip code in America by the 2010 Census. Like the greater Seattle region, that neighborhood embodies the multi-cultural miasma that spawned Blue Scholars, the joining of forces between an Iranian DJ/producer and a Filipino rapper. These are dudes who nourish their bodies with Vietnamese coffee, Ethiopian injera, and steaming bowls of ph. Thanks to music, they have mingled with guests at a party hosted by renown glass artist Dale Cihuly, and conducted workshops at a Colorado juvenile detention center.
“I feel very lucky,” admits Sabzi. “So many people are in their own fishbowl, thinking they know what the world is, but never get the opportunity to see anything beyond their immediate environment. We’ve been fortunate to have had the opportunity to establish real human connections with people we’ve discovered aren’t really any different from us, because music has broken down the superficial barriers that would otherwise keep us apart.”
Blue Scholars actively contribute to the global community of artists and freethinkers in myriad ways. Drawing on Jamaican dancehall culture and the increasingly popular medium of artist mix tapes, Sabzi makes the instrumental foundations of all their songs available as individual riddims, to be adopted and adapted by whomever cares to use his beats. Meanwhile, every time they hook up with another artist, be it Seattle rapper Macklemore (Sabzi’s reworking of his Emerald City celebration “The Town” extended the shelf life of an already hugely popular joint) or Los Angeles’ Bambu, their network expands. New fans find Blue Scholars via new points of entry, and in turn, Blue Scholars discover more fodder for their imaginations.
Towards that end, and meeting more kindred spirits in the real world, Sabzi currently divides his time between New York and Seattle. How has that impacted Blue Scholars’ creative process? Not at all. Even as students at the University of Washington, where they first met and began making music together, Sabzi and Geologic were using the Internet as an integral part of their routine. The former would make a beat, upload it to the server, his partner would download it and write rhymes… and then they’d record together. They do the same thing today, just across bigger geographical distances.
Since 2002, the duo has become renowned live show veterans, rocking over 400 shows with the likes of Kanye West, De La Soul, Nas, Common, and supporting such acts on tour Zion-I, Hieroglyphics, and the Coup on tour. They’ve also played labor organizing conferences and youth-run community center shows, the main stage at Sasquatch! (2006 & ‘08) and Bumbershoot (2006), and in 2007 headlined their own Northwest Hip Hop festival, “The Program,” which sold out five nights in a row. Their discography includes the albums Blue Scholars (2004) and Biyani (2007), as well as the EPs The Long March (2005), Joe Metro (2007), BUTTER&GUN$ (2008), and OOF! (2009).
But enough about the past. What are Blue Scholars doing right now? Find out for yourself at www.bluescholars.com.
|
Q:
How do I parse a URL in PHP?
Possible Duplicate:
Parsing Domain From URL In PHP
how do i get
http://localhost/
from
http://localhost/something/
using php
I tried
$base = strtok($url, '/');
A:
You can use parse_url to get down to the hostname.
e.g.:
$url = "http://localhost/path/to/?here=there";
$data = parse_url($url);
var_dump($data);
/*
Array
(
[scheme] => http
[host] => localhost
[path] => /path/to/
[query] => here=there
)
*/
A:
$url = 'http://localhost/something/';
$parsedurl = parse_url($url);
echo $parsedurl['scheme'].'://'.$parsedurl['host'];
|
This month we’ve started doing some promotion of our three Spark programmes; DreamSpark , BizSpark and WebsiteSpark . These are programmes created to help students, entrepreneurs, software start-ups, young web design companies and next Bill Gates’ get...
As part of of our BizSpark promotional activities mentioned in my previous post, we’ve started highlighting local start-ups in the BizSpark programme. Our first case study and video was with Litmos , an online Learning Management System. Here is the case...
Have you filled in the Microsoft New Zealand Developer Survey yet? This is your chance to win a trip to the next Microsoft Professional Developer’s Conference in L.A. We really want to hear your thoughts and opinions on how we can serve you better so... |
Q:
Editing and reopening a closed question
There is a question that was posed back in January that wasn't well formed but which had the bones of a very good question in it. You can see it here, it is closed now. I'm wondering, can/should it be resurrected by editing the question, or would it be better to start a new question?
A:
Either option is fine. If it's closed but fixable, then editing it and getting it resurrected is good. It's also fine if you just ask your own new question.
|
/****************************************************************************
**
** Copyright (C) 2016 The Qt Company Ltd.
** Contact: https://www.qt.io/licensing/
**
** This file is part of the Qt Charts module of the Qt Toolkit.
**
** $QT_BEGIN_LICENSE:GPL$
** Commercial License Usage
** Licensees holding valid commercial Qt licenses may use this file in
** accordance with the commercial license agreement provided with the
** Software or, alternatively, in accordance with the terms contained in
** a written agreement between you and The Qt Company. For licensing terms
** and conditions see https://www.qt.io/terms-conditions. For further
** information use the contact form at https://www.qt.io/contact-us.
**
** GNU General Public License Usage
** Alternatively, this file may be used under the terms of the GNU
** General Public License version 3 or (at your option) any later version
** approved by the KDE Free Qt Foundation. The licenses are as published by
** the Free Software Foundation and appearing in the file LICENSE.GPL3
** included in the packaging of this file. Please review the following
** information to ensure the GNU General Public License requirements will
** be met: https://www.gnu.org/licenses/gpl-3.0.html.
**
** $QT_END_LICENSE$
**
****************************************************************************/
#include "callout.h"
#include <QAction>
#include <QMenu>
#include <QtCharts/QChart>
#include <QtGui/QFontMetrics>
#include <QtGui/QMouseEvent>
#include <QtGui/QPainter>
#include <QtWidgets/QGraphicsSceneMouseEvent>
#include "cacheplotview.h"
Callout::Callout(Ripes::CachePlotView* view, QChart* chart) : QGraphicsItem(chart), m_view(view), m_chart(chart) {}
QRectF Callout::boundingRect() const {
QPointF anchor = mapFromParent(m_chart->mapToPosition(m_anchor));
QRectF rect;
rect.setLeft(qMin(m_rect.left(), anchor.x()));
rect.setRight(qMax(m_rect.right(), anchor.x()));
rect.setTop(qMin(m_rect.top(), anchor.y()));
rect.setBottom(qMax(m_rect.bottom(), anchor.y()));
return rect;
}
void Callout::paint(QPainter* painter, const QStyleOptionGraphicsItem* option, QWidget* widget) {
painter->save();
Q_UNUSED(option)
Q_UNUSED(widget)
QPainterPath path;
path.addRoundedRect(m_rect, 5, 5);
QPointF anchor = mapFromParent(m_chart->mapToPosition(m_anchor));
if (!m_rect.contains(anchor)) {
QPointF point1, point2;
// establish the position of the anchor point in relation to m_rect
bool above = anchor.y() <= m_rect.top();
bool aboveCenter = anchor.y() > m_rect.top() && anchor.y() <= m_rect.center().y();
bool belowCenter = anchor.y() > m_rect.center().y() && anchor.y() <= m_rect.bottom();
bool below = anchor.y() > m_rect.bottom();
bool onLeft = anchor.x() <= m_rect.left();
bool leftOfCenter = anchor.x() > m_rect.left() && anchor.x() <= m_rect.center().x();
bool rightOfCenter = anchor.x() > m_rect.center().x() && anchor.x() <= m_rect.right();
bool onRight = anchor.x() > m_rect.right();
// get the nearest m_rect corner.
qreal x = (onRight + rightOfCenter) * m_rect.width();
qreal y = (below + belowCenter) * m_rect.height();
bool cornerCase = (above && onLeft) || (above && onRight) || (below && onLeft) || (below && onRight);
bool vertical = qAbs(anchor.x() - x) > qAbs(anchor.y() - y);
qreal x1 = x + leftOfCenter * 10 - rightOfCenter * 20 + cornerCase * !vertical * (onLeft * 10 - onRight * 20);
qreal y1 = y + aboveCenter * 10 - belowCenter * 20 + cornerCase * vertical * (above * 10 - below * 20);
point1.setX(x1);
point1.setY(y1);
qreal x2 = x + leftOfCenter * 20 - rightOfCenter * 10 + cornerCase * !vertical * (onLeft * 20 - onRight * 10);
qreal y2 = y + aboveCenter * 20 - belowCenter * 10 + cornerCase * vertical * (above * 20 - below * 10);
point2.setX(x2);
point2.setY(y2);
path.moveTo(point1);
path.lineTo(anchor);
path.lineTo(point2);
path = path.simplified();
}
painter->setBrush(QColor(255, 255, 255));
painter->drawPath(path);
painter->drawText(m_textRect, m_text);
painter->restore();
}
void Callout::contextMenuEvent(QGraphicsSceneContextMenuEvent* event) {
m_view->deleteCallout(this);
}
void Callout::mousePressEvent(QGraphicsSceneMouseEvent* event) {
event->setAccepted(true);
}
void Callout::mouseMoveEvent(QGraphicsSceneMouseEvent* event) {
if (event->buttons() & Qt::LeftButton) {
setPos(mapToParent(event->pos() - event->buttonDownPos(Qt::LeftButton)));
event->setAccepted(true);
} else {
event->setAccepted(false);
}
}
void Callout::setText(const QString& text) {
m_text = text;
QFontMetrics metrics(m_font);
m_textRect = metrics.boundingRect(QRect(0, 0, 150, 150), Qt::AlignLeft, m_text);
m_textRect.translate(5, 5);
prepareGeometryChange();
m_rect = m_textRect.adjusted(-5, -5, 5, 5);
}
void Callout::setAnchor(QPointF point) {
m_anchor = point;
}
void Callout::updateGeometry() {
prepareGeometryChange();
setPos(m_chart->mapToPosition(m_anchor) + QPoint(10, -50));
}
|
586 F.Supp. 30 (1984)
BAY COLONY CONDOMINIUM OWNERS ASSOCIATION, an Illinois not-for-profit Corporation, and Bay Colony Condominium Owners Association # 2, an Illinois not-for-profit Corporation, Plaintiffs,
v.
Thomas J. ORIGER, individually, and O'Hare International Bank, as Trustee under Trust Agreement known as Trust No. 506, Defendants.
No. 83 C 7604.
United States District Court, N.D. Illinois, E.D.
April 13, 1984.
*31 Jordan I. Shifrin, Shifrin & Waitzman, Ltd., Arlington Heights, Ill., for plaintiffs.
Richard C. Jones, Jr., Law Office of Marshall J. Moltz, Chicago, Ill., for defendants.
MEMORANDUM OPINION AND ORDER
ASPEN, District Judge:
Plaintiffs Bay Colony Condominium Owners Association and Bay Colony Condominium Owners Association # 2 ("the Associations") bring this action for declaratory judgment, injunctive relief and damages under the Condominium and Cooperative Abuse Relief Act of 1980 ("the Condominium Act"), 15 U.S.C. § 3601 et seq., against defendants Thomas J. Origer ("Origer") and O'Hare International Bank. The Associations seek a determination by this Court that a recreational facilities lease, under which the owners of the Bay Colony condominium units are obligated to make payments to Origer for a total of 99 years, is unconscionable and invalid. Defendants have filed a motion to dismiss the suit, claiming that the Condominium Act is unconstitutional in two respects. For the reasons set forth below, defendants' motion to dismiss is denied.
*32 I. The Commerce Clause
Defendants first contend that Congress exceeded its power under the Commerce Clause of the United States Constitution when it passed the Condominium Act.[1] Although they concede that congressional power to regulate commerce is quite broad, defendants argue that the Condominium Act cannot be applied constitutionally to the Bay Colony recreational facilities lease because the lease has no significant effect on interstate commerce.
The Supreme Court's recent discussion of the Commerce Clause in Hodel v. Virginia Surface Mining and Reclamation Ass'n, 452 U.S. 264, 276-77, 101 S.Ct. 2352, 2360, 69 L.Ed.2d 1 (1981), is instructive:
Judicial review in this area is influenced above all by the fact that the Commerce Clause is a grant of plenary authority to Congress. See National League of Cities v. Usery, supra [426 U.S. 833], at 840, 96 S.Ct. [2465], at 2468 [49 L.Ed.2d 245]; Cleveland v. United States, 329 U.S. 14, 19, 67 S.Ct. 13, 15, 91 L.Ed. 12 (1946); NLRB v. Jones & Laughlin Steel Corp., 301 U.S. 1, 37, 57 S.Ct. 615, 624, 81 L.Ed. 893 (1937). This power is "complete in itself, may be exercised to its utmost extent, and acknowledges no limitations other than are prescribed in the constitution." Gibbons v. Ogden, 9 Wheat. 1, 196, 6 L.Ed. 23 (1824). Moreover, this Court has made clear that the commerce power extends not only to "the use of channels of interstate or foreign commerce" and to "protection of the instrumentalities of interstate commerce ... or persons or things in commerce," but also to "activities affecting commerce." Perez v. United States, 402 U.S. 146, 150, 91 S.Ct. 1357, 1359, 28 L.Ed.2d 686 (1971). As we explained in Fry v. United States, 421 U.S. 542, 547, 95 S.Ct. 1792, 1795, 44 L.Ed.2d 363 (1975), "[e]ven activity that is purely intrastate in character may be regulated by Congress, where the activity, combined with like conduct by others similarly situated, affects commerce among the States or with foreign nations." See National League of Cities v. Usery, 426 U.S., at 840, 96 S.Ct., at 2468; Heart of Atlanta Motel, Inc. v. United States, supra, 379 U.S. [241], at 255, 85 S.Ct. [348], at 356 [13 L.Ed.2d 258]; Wickard v. Filburn, 317 U.S. 111, 127-128, 63 S.Ct. 82, 90, 87 L.Ed. 122 (1942); United States v. Wrightwood Dairy Co., 315 U.S. 110, 119, 62 S.Ct. 523, 526, 86 L.Ed. 726 (1942); United States v. Darby, supra, 312 U.S., [100] at 120-121, 61 S.Ct., [451] at 460 [85 L.Ed. 609].
In essence, defendants claim that the Constitution requires that a court determine whether interstate commerce is involved in each action brought under the Condominium Act. However, neither the Condominium Act itself nor the case law under the Commerce Clause supports this claim. It is true that Congress sometimes requires proof of an impact on interstate commerce as one of the substantive elements of a statutory violation. E.g., Chatham Condominium Associations v. Century Village, Inc., 597 F.2d 1002, 1008 (5th Cir.1979) (Sherman Act). But in other instances, Congress simply declares that an entire class of activities affects commerce and the Supreme Court has repeatedly confirmed Congress' power to make such a declaration. Perez v. United States, 402 U.S. 146, 151-55, 91 S.Ct. 1357, 1360-62, 28 L.Ed.2d 686 (1971); Katzenbach v. McClung, 379 U.S. 294, 302-04, 85 S.Ct. 377, 383-84, 13 L.Ed.2d 290 (1964); United States v. Darby, 312 U.S. 100, 120-21, 61 S.Ct. 451, 460, 85 L.Ed. 609 (1941). The Condominium Act falls into this latter category of statutes. Instead of requiring a judicial determination of the effects on interstate commerce in each particular case, Congress has decided to regulate a class of activities within the cooperative and condominium housing markets.
The first section of the Condominium Act includes the following congressional findings:
*33 [C]ertain long-term leasing arrangements for recreation and other condominium- or cooperative-related facilities which have been used in the formation of cooperative and condominium projects may be unconscionable; in certain situations State governments are unable to provide appropriate relief; as a result of these leases, economic and social hardships may have been imposed upon cooperative and condominium owners, which may threaten the continued use and acceptability of these forms of ownership and interfere with the interstate sale of cooperatives and condominiums; appropriate relief from these abuses requires Federal action; and
[T]here is a Federal involvement with the cooperative and condominium housing markets through the operation of Federal tax, housing, and community development laws, through the operation of federally chartered and insured financial institutions, and through other Federal activities ... the creation of many condominiums and cooperatives is undertaken by entities operating on an interstate basis.
15 U.S.C. § 3601(a)(3) and (4). Given the congressional determination that long-term recreational lease arrangements affect interstate commerce, this Court should inquire only whether that finding is rational. As the Supreme Court has explained,
The task of a court that is asked to determine whether a particular exercise of congressional power is valid under the Commerce Clause is relatively narrow. The court must defer to a congressional finding that a regulated activity affects interstate commerce, if there is any rational basis for such a finding. This established, the only remaining question for judicial inquiry is whether "the means chosen by [Congress] must be reasonably adapted to the end permitted by the Constitution." The judicial task is at an end once the court determines that Congress acted rationally in adopting a particular regulatory scheme.
Hodel v. Virginia Surface Mining and Reclamation Ass'n, 452 U.S. 264, 276, 101 S.Ct. 2352, 2360, 69 L.Ed.2d 1 (1981) (citations omitted).
There is a rational basis for Congress' finding that long-term recreational leases affect interstate commerce. As the legislative history shows, Congress received testimony from condominium unit owners, developers and Florida public officials before determining that these leases might interfere with the interstate sale of condominiums.[2] Congress also noted several connections between the cooperative and condominium housing markets and various federal laws, federally insured and chartered financial institutions and other entities operating on an interstate basis. 15 U.S.C. § 3601(a)(4). Contrary to the defendants' assertions, these connections apply logically to both new and converted condominium units. We cannot say that the means Congress chose to combat abusive leasing practices is inappropriate or unreasonable. Thus, we find that Congress acted rationally in adopting this particular regulatory scheme and did not exceed its power under the Commerce Clause in passing the Condominium Act.
II. The Due Process Clause
Defendants also contend that the Condominium Act deprives Origer of contractual rights without due process of law in violation of the Fifth Amendment of the United States. Because the Bay Colony recreational facilities lease was executed in 1973, over seven years before the Condominium Act became effective, defendants argue that the Condominium Act unconstitutionally interferes with Origer's "vested" right to payments under the lease.
We disagree. First, the Condominium Act interferes with no contractual rights, vested or otherwise. As demonstrated by *34 this case, the Condominium Act does provide for judicial review of leases entered into before the Act itself was passed. 15 U.S.C. § 3608(a)(6). A court reviewing a lease under the Condominium Act is granted wide latitude in fashioning remedies to cure any unconscionability in the lease. 15 U.S.C. § 3608(d); S.Rep. No. 736, 96th Cong., 2d Sess. 52, reprinted in 1980 U.S. Code Cong. & Ad.News 3506, 3559. However, these remedies are directed solely to unconscionable lease provisions, so there is no interference with any valid contract rights. It is axiomatic that a court may refuse to enforce a contract which was unconscionable at the time it was made. E.g., Williams v. Walker-Thomas Furniture Co., 350 F.2d 445, 449 (D.C.Cir.1965); see also U.C.C. § 2-302 (1983) (unconscionable contracts for the sale of goods). Origer's payments under the lease will thus be affected only if the Court determines that the lease is unconscionable and in such a case Origer would have no enforceable right to the payments. There can be no claim of denial of due process absent deprivation of either a liberty or property right. Webster v. Redmond, 599 F.2d 793, 801-02 (7th Cir.1979), cert. denied sub nom. Webster v. Board of Education of City of Chicago, 444 U.S. 1039, 100 S.Ct. 712, 62 L.Ed.2d 674 (1980).
Furthermore, the Condominium Act provides ample opportunity to defendants to show that the lease is not unconscionable. The statute sets forth certain characteristics which lead to a rebuttable presumption of unconscionability, but it does not purport to invalidate per se any particular lease. Rather, the Condominium Act requires a court to consider evidence proffered by all the parties to the lease before finding the lease, or any portion of it, unconscionable. 15 U.S.C. § 3608(b). Thus, before Origer's contractual relationship with the Associations is affected in the least, he will have been afforded, through summary judgment proceedings or trial, an opportunity to contest the question of whether or not the subject lease is unconscionable. Due process, thereby, will be satisfied.[3]
Accordingly, defendants' motion to dismiss is denied. It is so ordered.
NOTES
[1] The Commerce Clause grants Congress the power "[t]o regulate Commerce with foreign Nations and among the several States, and with the Indian Tribes." U.S. Const., art. I, § 8, cl. 3.
[2] Although the controversy concerning escalating long-term recreational leases has been "primarily centered within the State of Florida," Congress found that these leases exist in other states as well and have an effect on interstate commerce. See 15 U.S.C. § 3601(a)(3); S.Rep. No. 736, 96th Cong., 2d Sess. 51-52, reprinted in 1980 U.S.Code Cong. & Ad.News 3506, 3558-59.
[3] Compare the procedure under the Condominium Act with the state replevin provisions held unconstitutional in Fuentes v. Shevin, 407 U.S. 67, 92 S.Ct. 1983, 32 L.Ed.2d 556 (1972) (due process requires some type of hearing before debtor's goods are repossessed).
|
Avg Rating: 4.9
5 stars
674
4 stars
27
3 stars
6
2 stars
1
1 star
0
ผู้สอน
สิทธิพล พรรณวิไล
A full stack developer and Android GDE
A full-stack developer with more than 6 years experience on Android Application Development and more than 12 years in Mobile Application Development industry. Also has skill in Infrastucture, Service Side, Design, UI&UX, Hardware, Optimization, Cooking, Photographing, Blogging, Training, Public Speaking and do love to share things to people in the world! |
Effect of Vitamin D Supplementation on Tibial Cartilage Volume and Knee Pain Among Patients With Symptomatic Knee Osteoarthritis: A Randomized Clinical Trial.
Observational studies suggest that vitamin D supplementation is associated with benefits for knee osteoarthritis, but current trial evidence is contradictory. To compare the effects of vitamin D supplementation vs placebo on knee pain and knee cartilage volume in patients with symptomatic knee osteoarthritis and low vitamin D levels. A multicenter randomized, double-blind, placebo-controlled clinical trial in Tasmania and Victoria, Australia. Participants with symptomatic knee osteoarthritis and low 25-hydroxyvitamin D (12.5-60 nmol/L) were enrolled from June 2010 to December 2011. The trial was completed in December 2013. Participants were randomly assigned to receive monthly treatment with oral vitamin D3 (50,000 IU; n = 209) or an identical placebo (n = 204) for 2 years. Primary outcomes were change in tibial cartilage volume (assessed using magnetic resonance imaging [MRI]) and change in the Western Ontario and McMaster Universities Arthritis Index (WOMAC) pain score (0 [no pain] to 500 [worst pain]) from baseline to month 24. Secondary outcomes were cartilage defects and bone marrow lesions (assessed using MRI). Of 413 enrolled participants (mean age, 63.2 years; 50% women), 340 (82.3%) completed the study. The level of 25-hydroxyvitamin D increased more in the vitamin D group (40.6 nmol/L) than in the placebo group (6.7 nmol/L) (P < .001) over 2 years. There were no significant differences in annual change of tibial cartilage volume or WOMAC pain score. There were no significant differences in change of tibiofemoral cartilage defects or change in tibiofemoral bone marrow lesions. Adverse events (≥ 1 per patient) occurred in 56 participants in the vitamin D group and in 37 participants in the placebo group (P = .04). [table: see text]. Among patients with symptomatic knee osteoarthritis and low serum 25-hydroxyvitamin D levels, vitamin D supplementation, compared with placebo, did not result in significant differences in change in MRI-measured tibial cartilage volume or WOMAC knee pain score over 2 years. These findings do not support the use of vitamin D supplementation for preventing tibial cartilage loss or improving WOMAC knee pain in patients with knee osteoarthritis. clinicaltrials.gov Identifier: NCT01176344; anzctr.org.au Identifier: ACTRN12610000495022. |
Description
The FTD® Sweet Surprises® Bouquet was created to spread love and caring kindness wherever it might be sent! Hot pink bi-colored roses and hot pink and pale pink mini carnations pop with their blushing hues, arranged amongst the clean white petals of traditional daisies and lush greens. Presented in a clear glass vase, this gorgeous fresh flower arrangement brings a fresh excitement to your special recipient's day, whether it is sent for a special occasion, such as a birthday, or simply to let them know how much you care.
Product ID
B03-S
Approximately 14"H x 12"W
What People Are Saying
I got a "florists designed bouquet" of purple and was very impressed with the quality of the arrangement. Free local delivery and email notification was a great touch to a wonderful service. Very impressed :) |
Sunday, April 23, 2017
Dead or Alive 2: Birds (2000)
If a person were to judge the direction of Dead or Alive 2: Birds by the finale of Dead or Alive, then you wouldn’t be too
much off the mark in the outrageous tone that it uses. However, the mistake in
that line of thinking comes from believing that Dead or Alive 2 is a sequel to Dead
or Alive at all. Outside of the title, being directed by Takashi Miike, and
starring the same two leads, there is no actual story element or character that
connects the two films. There are a few thematic elements that could be seen as
carrying over, but they are some of the same elements that one sees in a lot of
Miike films. Even with no connection, Dead
or Alive 2 might just have the edge on its predecessor by embracing a lot
of the quirky elements of its story and characters and delivering a phenomenal
third act worthy of the Miike brand. It’s a strange film that doesn’t always
feel cohesive, but that doesn’t stop it from hitting a lot of amazing moments
with pizzazz.
Mizuki (Show Aikawa) has just been hired to take out another
yakuza boss and he’s going to be paid a lot of money for it. However, just
before he takes the shot, he sees another hitman (Riki Takeuchi) assassinate
the same target. It also just so happens that this other hitman is a childhood
friend that he hasn’t seen in years. This leads them to try and take the money
from the job and run, hiding on the small island they grew up on. This doesn’t
sit well with the yakuza and soon they find themselves being hunted.
Angels to some...
Like most Miike films, Dead
or Alive 2: Birds is about outcasts who find themselves at a crossroads in
their life. Thematically, the film sits well with plenty of his other yakuza
films as the two protagonists (it’s hard to call them heroes, even when they
attempt to do better things with their lives in the second half of the film)
reconnect and a sort of fate is set on course. The use of Show Aikawa and Riki
Takeuchi here is a brilliant one as the two have immense chemistry on screen
and are powerhouse actors whether it’s the more subtle moments that they use or
the more outrageous elements of their characters. Miike knows how to make that
dynamic work and it’s truly the heart and soul of why this film soars,
particularly in the third act when the yakuza finally catch up to them and a
final showdown occurs. Just the last 15 minutes of the film are some of the
best performances and dramatic (slightly comedic in tone) scenes that Miike has
ever put to film and that’s saying something.
Of course, Dead or
Alive 2 is a strange film too in true Miike fashion. The tone is at times
slightly fantastical as Miike likes to use imagery that’s not nearly as
realistic or grounded as the rest of the film. A series of assassinations
performed by our two protagonists in the third act is punctuated by wings that
sprout from their backs (the use of wings and birds is a running theme in the
film along with this visual that seems to bring in a parallel about ‘avenging
angels’ and what not) and the film is littered with moments where humor,
emotion, and immense violence are balanced. None are more impactful than a
sequence where our protagonists are performing a children’s play (with weirdly
adult moments) that’s interspliced with sequences where yakuza hitmen are
looking for them and slaughtering dozens of people in their wake. It’s moments
like these that truly raise the film above and beyond.
...hungry to others.
For fans of the series or those new to it, this release of
the film by Arrow Videos is the way to go too. The remaster of the film is
much, much better than my original DVD that I had. It also comes in a pack with
the other two films in the “franchise” so it’s a huge value too. If anything,
the price of this set is worth it just for this entry and all of the special
features, booklet, and commentary are just icing on the cinematic cake. This
set is worth the purchase even for those who are curious.
When it comes to the Dead
or Alive series, Dead or Alive 2:
Birds is easily the best one and it highlights the quirky nature that Miike
brings to a film like this while never losing the emotional grounding or
artistic elements that parallel the themes and characters that drive the plot.
It’s a film that can certainly rub some viewers the wrong way with those
visuals quirks or outrageous moments (the opening sequence where a man explains
who to start a yakuza war with cigarettes is worth the watch alone), but it’s
so well balanced and grounded that it’s hard not to love this film even when it’s
flawed.
No comments:
Post a Comment
Osaka Asian Film Festival 2018
Welcome To Blood Brothers!
Here at Blood Brothers we, cult fan brothers Eric and Matt, are dedicated to bringing reviews to some of the worlds best (and worst, depending on your taste) cult like films from around this large globe. Whether it be Horror, Science Fiction, Kung Fu, or any other cult like genre - we are your first and last stop for all your review needs. Unapologetically kvlt.
Feel free to comment on our reviews, we love to hear your thoughts on movies or the reviews as long as its meaningful and thought out. Any slanderous comments (for the sake of it) will be erased though, so be thoughtful with what you say.
All movie ratings out of are out of 5 BLOOD DROPS. Our blood drop rating is located at the end of our reviews.
Note: A very special thanks goes out to our friend Bill, who with his connections, technical support, and wizardry with photoshop has kept this website going. Many of the films reviewed here would never have been reviewed if it weren't for his abilities. THANKS BILL! We can never thank you enough! |
Integrated circuits or chips may include a large number of interconnected transistors. The transistors and other circuit elements are interconnected in various ways to provide desired circuit functions. It is usually most efficient to fabricate multiple integrated circuits on a single wafer. After processing, the integrated circuits that are fabricated on the wafer are separated and then packaged. The wafer can accommodate a fixed number of integrated circuits for a given integrated circuit size. Reducing the size of individual transistors in the integrated circuit may help to reduce the overall size of the integrated circuit. This, in turn, allows an increased number of integrated circuits or chips to be made on each wafer and reduces the cost of the integrated circuits.
Referring now to FIGS. 1 and 2, an exemplary transistor 10 includes a drain 12, a gate 14, a source 16 and a body 18 or substrate tap. For example, the transistor 10 in FIG. 1 is an NMOS transistor. In some circumstances, the body 18 is connected to the source 16 as shown in FIG. 2.
Referring now to FIG. 3, the body 18 includes a p+ region and may include a contact tap 30. The source 16 includes an n+ region and may include a contact tap 32. The drain 12 includes an n+ region and may include a contact tap 34. Additional transistors may be fabricated on one or sides of the transistor 10 as indicated by “ . . . ” in FIG. 3.
Referring now to FIG. 4, the body 18 may be repeated between sources 16 of adjacent transistors. The body 18 takes up valuable chip area and increases the size of the transistor and the integrated circuit. Additional transistors can be arranged on one or more sides of the transistor 10 as shown by “ . . . ” in FIG. 4. |
Change in binding states between catabolite activating protein and DNA induced by ligand-binding: molecular dynamics and ab initio fragment molecular orbital calculations.
The transcription mechanism of genetic information from DNA to RNA is efficiently controlled by regulatory proteins, such as catabolite activator protein (CAP), and their ligands. When cyclic AMP (cAMP) binds to CAP, the complex forms a dimer and binds specifically to DNA to activate the transcription mechanism. On the other hand, when cyclic GMP (cGMP) binds to CAP, the complex has no marked effect on the mechanism. In our previous study, based on molecular dynamics (MD) and ab initio fragment molecular orbital (FMO) methods, we elucidated which residues of CAP are important for the specific interactions between CAP and DNA in the CAP-monomer+DNA + cAMP complex. However, this monomer model for CAP cannot describe real interactions between the CAP-dimer and DNA because CAPs form a dimer before binding to DNA. Accordingly, here, we investigated stable structures and their electronic states for the CAP-dimer+DNA complex with cAMP or cGMP ligand, to clarify the influence of ligand-binding on the interactions between CAP-dimer and DNA. The MD simulations elucidated that the DNA-binding domains of CAP-dimer behave differently depending on the ligand bound to the CAP-dimer. In addition, FMO calculations revealed that the binding energy between CAP-dimer and DNA for the CAP-dimer+DNA + cAMP complex is larger than that for the CAP-dimer+DNA + cGMP complex, being consistent with experiments. It was also highlighted that the Arg185 and Lys188 residues of CAP-dimer are important for the binding between CAP-dimer and DNA. These results provide useful information for proposing new compounds that efficiently control the transcription mechanism. |
Our Results
A-level Success for SGGS
2017 Headlines Statistics:
We are placed 41st nationally (independent and state schools inclusive)
We are now 15th state school in the UK (boys and girls inclusive)
We are 9th state school in the UK (all girls)
In light of the changes to A-level this year and the uncertainty that this has brought for all students, parents and schools nationwide, Stratford Girls’ Grammar School is pleased to report its continued academic success with another set of excellent A-level exam results for 2017. We congratulate all our 112 A-level students on their tremendous achievements. Nearly half of all grades were A* or A, and over three quarters of all their grades were A*, A or B, within a 100% pass rate.
Headteacher Mrs Jacqui Cornell said: “This has been a year of great uncertainty for everyone involved – students, parents, staff and universities – so we are delighted in the light of the changes to A-levels that our students have performed so well and we are enormously proud of each and every one of them. These results reflect not only their academic ability but also their considerable hard work, determination and resilience. Our congratulations go to everyone! ”
Among the highest achievers were Hannah May and Kate Bassil, who will be taking up their places at Cambridge to read Engineering. This achievement is on the back of their success as part of the team involved in building our first car in school. Five others also obtained Oxbridge places. Over 80% of our students secured a place at their first choice universities, in an eclectic mix of modern and traditional subjects, which include Architecture, Chemical Engineering, Economics, Law, Medicine and Politics, but also Marine Technology and Naval Architecture. It is also interesting to see high-flying girls taking up other options, such as employment and apprenticeships.
- - - - - - - - - - - - - - - - - - - - - - - - -
Largest cohort to date sets new
school record for GCSE results
2017 Headlines Statistics:
Based on A*/A:
We are the top school for GCSEs in Warwickshire (source: The Times)
We are placed 41st nationally (independent and state schools inclusive)
We are now 15th state school in the UK (boys and girls inclusive)
We are 9th state school in the UK (all girls)
Across All GCSEs
A*/A and 9/7
84%
5 or more A*/C and 9/4
100%
Unreformed GCSEs
A*
50%
A*/A
85%
A*/C
100%
Reformed GCSEs in English Language, English Literature and Maths
9
22%
8
31%
9/7
83%
9/4
100%
Stratford Girls’ Grammar School are celebrating the excellent performance of their Year 11 students as they achieved 84% A*/A and 9/7 across all their GCSEs. The students achieved 83% 9-7 grades in the new English and Maths GCSEs, which includes 22% at 9 grade, and a new school record of 85% A*/A grades in the remaining unreformed GCSEs, with 50% at A* grade. With government indicating that attaining the new 9 grade would be a challenge - nationally expectations are that Grade 9 is to be achieved by 2% of entrants in English and 3% of entrants in Maths - the school is delighted to see that over one in five of its students have achieved the new 9 grade. Congratulations also go to the 31% who attained grade 8! These fantastic results continue the trend of excellent achievement and reflect the hard work and effort put in by each and every one of the Year 11 students.
Headteacher, Mrs Cornell, is thrilled for the students and everyone involved in this success. ‘These results are stunning! This is the first year group to have experienced the new, more demanding English and Maths GCSEs. As part of our rolling expansion in pupil numbers over recent years, this year’s results belong to the largest cohort that have been entered for GCSEs this far, so we are delighted to see the new school record. It has been an unsettling experience but these results show the calibre of our students and how they have risen to the challenge laid down by the Government.
Our Year 11 have maintained the Stratford Girls’ tradition of excellent results in GCSEs. The students’ success says a lot about their tenacity and resilience, as well as their determination to succeed: characteristics that we see as they come up through the school and that will serve them well as they move into the sixth form. It proves that for bright girls in Stratford and the wider Warwickshire area, Stratford Girls’ Grammar School remains a prime destination of choice. Well done to all our students and good luck as they begin their A-levels in Shottery Sixth Form!’
Of particular note, three of our Year 11 students achieved the highest attainable grades: Tolulope Atilola, Leah Bhandal and Inaam Shammoon attained three 9 grades and eight A*s across their eleven timetabled GCSEs. This is a phenomenal achievement and all three are heartily congratulated by the school. |
Former Alaska governor Sarah Palin came out strongly in favor of continued U.S. foreign aid to Israel in a Sunday interview with Judge Jeanine Pirro on Foxnews.
"You know I'm sure that there's some waste and fraud in our foreign aid we need to find efficiencies and not give to any regime that would seek to harm Americans in any sense of the word 'harm,'" Palin said, "I don't support that kind of foreign aid at all. but when it comes to Israel - NO... I stand strong with Israel and unapologetically I say that America should keep this strong democratic ally that we have there in the Middle East and allow for protections around Israel."
"Think of what this state Israel has gone through, and what they have suffered through and what they have triumphed over," she said. "It is really telling about their tenacity and their character and it's just one reason, that character, as to why it is that we want them as our friend."
In a confident, articulate appearance and what some see as one of her best interviews to date, Palin was also asked why the Obama Administration was so hesitant to call the shooting of the US airmen in Germany an act of terror. Carefully, she said: "Our president's world view certainly seems a bit different than, I believe, most Americans because... I think if you ask most Americans on the street if someone was hell bent on killing one of our military personnel yelling Allah Akbar and had terrorist ties and you can't see that clearly as a terrorist, then we've got some things quite askew in our Administration."
Regarding the situation in Libya, where dictator Muammar Qaddafi is fighting to retain control, Palin came out in favor of a US-imposed no-fly zone there.
"Yes, 41 years of Qaddafi, he's got to go," she stated. "I think what was unfortunate there in Libya was that it took our Administration so long to finally have any full-throated support for ousting Qaddafi. We finally saw the writing on the wall. But what we should have done, instead of being hesitant that perhaps he would harm the American citizens who are over there, we should have told him through strong verb[i]age, we should have said "Qaddafi, if you touch a hair on one American citizen's head, we're going to hit you, we're going to hit you hard and you're not going to be left standing. Instead we were kind of hesitant, kind of dithering, vacillating on our position it seemed and that leads to a kind of perception of weakness around the globe. I wish that we would have been stronger there with our language about Libya and now actions have to follow the language that President Obama finally did articulate."
Judge Pirro asked Palin why she thought Obama was so slow about taking sides against Qaddafi when he was relatively quick about choosing sides against Egypt's Hosni Mubarak. Palin replied with a question:
"Why was he so hesitant back with the Green movement in Iran, when freedom fighters wanted to oust Ahmadinejad and our president didn't really want to participate there, with the language at least that should have showed the support for ousting a dictator, ousting an oppressor?"
"It's tough to pinpoint why it is that President Obama (...) would seek to oust at least a quasi-ally in Mubarak who had been by our side for those 30 years... quick to oust him but quite hesitant on Qaddafi, on Ahmadinejad... that scares me." |
(1860) "In 1860 a two room school, small frame structure, was built in the space to the north side of the church. This school was for boys only and was taught by the Brothers of Holy Cross, for Notre Dame, Indiana."
-- Hist. of Diocese of Springfield, p. 182. 1860
(1876 "In 1876 Father Brady built a large eight-room school, which still serves its original purpose, when the Brothers of Holy Cross had charge of the boys...."
-- Hist. of Diocese of Springfield, p. 182. 1876
(Brother Edward to Sorin) "The school at St. Francis is discontinued and the school at Springfield reopened."
-- Provincial Archives, 1871.
1886: "Brother Lucian, Director; Attendance: 255.
1850: "Father Fitzgibbons writes Sorin that he is anxious to get Brothers." -- (Brother Edward to Sorin, 1871).
(1878) Four Brothers, Brother Cyril, Superior, director of the parish school at the Immaculate Conception; frequented by 310 boys. The present school here is splendid and well patronized in spite of misunderstanding between the pastor and the late superior.... For years the Brothers had much to suffer from want of a proper school."1878
(1866) "The parochial schools for the boys at Alton and Springfield are conducted by the Brothers of Holy Cross."
1888: House of the Brothers of Holy Cross, attached to the Church of the Immaculate Conception Bro. Remigius, Superior. 4 Brothers.
(1868) "Letter from Rev. Mr. Rinkes on the part of the Right Reverend Bishop of Alton was read in which he request Brothers for the school in Springfield." Provincial Chapter Minutes (Bro. Urban, Superior.)1868
(1870) "It seemed to be the wish of the Chapter to suspend the school in that city for one year, to give time for securing better accommodations for both pupils and Brothers."Provincial Chapter. 1870
(1876) "Brother Florian is appointed to teach at Springfield" Local Council, Sept. 22, 1876.
(1873) "Brother Gregory is Director of this place. He is a good religious and tries to do all he can to give satisfaction.... His position is a difficult one. The school house is a miserable little wooden building, not large enough for two-thirds of the scholars attending. It appears to be intended to accommodate only the small boys up to their first Communion, thus degrading the school and the teachers in the estimation for the parents. As soon as a boy is commencing to understand the various branches taught, he goes to the public schools, thus depriving the Brothers of the fruit of their labors and the reputations as teachers. In this way, they simply keep a school in preparation for the public schools, and the good they have done is soon blotted out. The pastor, I understand, has promised to build a new and spacious school house if the Brothers are allowed to return. But he appears to think as little this year of building as he did three years ago. He has a large and rich Congregation, and is nearly , if not quite, out of debt. He appears to have no energy and very little zeal for the honor and welfare of the school. Notre Dame, in my opinion, encourages him to continue in his negligence by sending Brothers there before he has a school house fit to accommodate all the boys of the parish. There are many places without Brothers where the pastors are able and willing to do everything necessary to make their labors effective.... I would advise therefore the withdrawal of the Brothers from Springfield for the above reasons.
"The Bishop was not at home when I went to Alton, but I told the Vicar General what I have written above. He acknowledged that I was right, and said that the Bishop had often urged Father Brady to build a school house. I asked him to repeat to the Bishop what I had said. Afterward I learned from Brother Gregory that Father Brady promised to build a school house, and it was on the strength of that promise that the Brothers returned."
(1869) "I, Alexis Granger, visited the school at Springfield, on the 2nd of June, 1869. Brother Urban is left alone since the departure of Brother Richard a few weeks ago. One hundred children actually attend the school. The school house is miserable and totally unfit for its use. They speak of building a new school which is very necessary. Brother lodges in the priest's house, but boards in the city...the same inconvenience as at Alton. With a suitable school three Brothers could be employed as teachers, for 300 boys could attend the school. A cook, a Brother, could live with them. I found here a set of boys quite different from those of Alton -- clean, well ordered, some of them very smart and well advanced. Their parents generally are in easy circumstances. The Brother has no trouble in collecting his dues."
-- Minutes of the Visit, 1869.
(Corby to Sorin, March 6, 1884) "Springfield is the best school we have outside, after the one in Ft. Wayne." Prov. Archives. Rev. Corby, Provincial. 1884
(1877) "Brothers have each a separate room in their house, but have a great inconvenience in regard to their board as they have to go a long way to take their meals. Meet all kinds of people as they eat. Bad influence on the young religious, filling their minds with worldly views and robbing them of that religious simplicity and humility, which are the charm of the religious life.
"Bishop Baltes says the bishopric is to be moved to Springfield within a year (May 12, 1885) and advises Sorin's Brothers not to build on church property because it will be needed for other purposes if the bishopric is moved. Asks Sorin to discuss Brothers' plans without telling of the projected move to Springfield."
(1887) "On the 22nd of September, Springfield, Illinois, had an interesting event...the 25th anniversary of the founding of the parochial schools of the Immaculate Conception. The occasion was rendered more pleasing in consequence of the presence of the two Brothers...who acted as preceptor and assistant at the start of the schools in 1862, Brothers Benjamin and Gabriel, of the Community of Holy Cross, Notre Dame. Brother Gabriel was then quite young, and assisted Brother Benjamin. Now, the latter is at the Cathedral schools: Alton; while Brother Gabriel is superior of the Immaculate Conception schools of this city. Brother Gabriel takes the place of Brother Lucian, who was removed by his superior to some other field of usefulness.... Brothers Gabriel, Onesimus, Andrew, Celsus are the teachers."
-- Church Progress -- Scholastic. Oct. 15,1887
1880: "Brother Stanislaus, the gentlemanly foreman of the 'Scholastic' office, has been for the past six weeks in Washington, attending to business connected with the University."
-- Scholastic, At Notre Dame, April 17, 1880
1887: "Brother Stanislaus left last week for Austin, Texas, whither he goes for a change in climate in the hope of recruiting his failing health. He has the best wishes of his many friends that the change may prove beneficial, and that he may be soon again with us to resume his important position in the full possession of health and strength."
-- Scholastic, Jan. 15, 1887.
1916: "Our obituary list this week includes the names of two Religious whose worth and work are noteworthy....
"Brother Stanislaus, C.S.C. (John A. Clarke) besides being a model of every Christian and religious virtue, was a man of varied talents, all of which were faithfully employed in the service of God for nearly a half century. He was one of the pioneers of shorthand in this country, and collaborated with Sir Isaac Pitman, who adopted into his system numerous improvements suggested by the Brother whom he recognized as an expert and cherished as a friend.
"An efficient teacher also of English, Spanish, etc., a ready writer, a skillful printer and pressman, a competent proofreader, Brother Stanislaus rendered service no less important than devoted wherever he was stationed. In a sense he was one of the founders of the 'Ave Maria', in whose welfare he never ceased to take the deepest interest. he will be remembered by all who were in any way associated with him as one of the best of men and most exemplary of religious."
-- Ave Maria; Rev. D. E. Hudson, : Editorial. June 24, 1916
(Ave Maria) "She (Mother Angela) had that master craftsman of his trade, Brother Stanislaus, teach the Sisters to set up type, read proof, fold and stitch the sheets by hand... and he (Father Cavanaugh) did not fail to give generous praise to the Brothers for their share in promoting the success of Our Mother's Journal. 'Similarly noble was the work of the Brothers of Holy Cross, who were willing to leave the peace of their monastery home and become wanderers over the world to secure subscribers for the Community Magazine.'"
-- Flame in the Wilderness. p. 237, McAllister.
(See "Printing, 1865, Ave Maria")
(Sorin from Brother Stanislaus; Chicago, Oct. 16, 1858: Prov. Archives) "It has been a subject of inquiry for the past six weeks to determine whether or not it has been commanded in virtue of holy obedience, to inflict corporal punishment on the children...in conscience I have to punish more of less every day...."
1870: Secretary of the 'Ave Maria'--
-- Provincial Archives. 1870
1873: "In February, 1873, the actual printing (of the Ave Maria) was turned over to the Sisters who received their first lessons from Brother Stanislaus."
-- Our Provinces -- Sr. Renata, p. 62. 1873
1880: "A leave of absence is granted Brother Stanislaus to regain his health. He will go to Washington and endeavor to obtain the assistance of Senators in the passage of our bill, now before Congress for the refunding of duty on the stained glass, amounting to over $2,300.00 and on the sanctuary lamp."
-- Local Council, Feb. 27, 1880
"I knew Brother Stanislaus very well. We were good friends. He was born in Ireland, and he and his parents settled in Baltimore, Maryland. One of his classmates was Mr. Cross, who afterwards became Archbishop of Oregon. There was a great friendship between Brother Stanislaus and the Archbishop of Oregon...."
"From the beginning the editorial supervision has been successfully in the hands of Fathers Gillespie, Lemonier, Brown, Bigelo, Brother Stanislaus."
-- On the Scholastic -- Howard.
(Brother Stanislaus and Phonography, 1914) "The Chicago Tribune of July 27th, contained a telegram from San Francisco to the effect that Mr. L. B. Gallagher, aged 20 years, had after studying stenography for only two years, written 284 words a minute and that he could make even a better record had anyone been able to read more rapidly. This dispatch recalls the fact that this young man's father, Robert Gallagher, held for many years the record (championship) of the world in stenography...Robert Gallagher was a student at Notre Dame in the eighties in a class of fifty or sixty...the teacher of this remarkable class was the venerable Brother Stanislaus, C.S.C., who this year returns to Notre Dame after an absence of twenty-eight years. Brother Stanislaus is credited by Sir Isaac Pitman, inventor of phonography, with having contributed very materially to the perfection of that famous system of shorthand" (Phonography, or writing by sound, the official name of Isaac Pitman' system of shorthand).
-- Scholastic, - editorial Sept. 26, 1914.
(Brother Stanislaus (Clarke) on his students) "Many of your readers will remember this young man's father, Robert F. Gallagher, when he studied shorthand with a class of fifty or sixty other boys at Notre Dame, among whom were the late George E. Clark, of South Bend, and his brother Matthew Clark, now of San Francisco; Reverend Doctor James A Burns, C.S.C. of the Catholic University, Washington, D. C., Neal G. Ewing, now of New York City; Professor A. C. Unsworth, etc. But many of these afterward became successful professional writers. But many became official stenographer of Supreme Court of San Francisco developed such speed and excellence as a stenographer as to entitle him to the championship of the world. This is true, although Mr. Gallagher himself never claimed the honor.
"'I have known Mr. R. F. Grant for about twenty years," wrote Mr. Ernest A. Girvin, another official supreme Court reporter of San Francisco, in the phonographic World Magazine, New York, 1900, and have watched his progress.... I have frequently seen him write 250 words a minute for five consecutive minutes on matters not familiar to him. I remember distinctly that on one occasion he wrote in my presence 309 words in a single minute. This is the fastest shorthand writing I have ever seen....'
Probably not more than two others in the world could ever approach that speed...."
-- Letter of Brother Stanislaus to the South Bend Tribune. Aug. 12, 1914. |
Gay/trans rights bill voted down in Florida
Jacksonville.com (yet another paper that doesn't make it obvious what paper they really are):
Councilman Warren Jones filed a bill in May adding sexual orientation. He later amended the bill by deleting language that gave protection based on “gender identity” and “gender expression.” Equality Florida, a group that advocates anti-discrimination laws, objected that the change watered down the bill by eliminating protection for transgender individuals and would allow discrimination based on gender stereotypes.
But the change picked up support from council members who otherwise were inclined to oppose the bill. The 10-9 vote Wednesday was against the substitute legislation put forward by Jones.
The failure to amend the bill forced a second vote on the original bill filed by Jones. The council rejected it 17-2 with only Jones and Councilwoman Denise Lee in favor.
Jacksonville.com (yet another paper that doesn't make it obvious what paper they really are):
Councilman Warren Jones filed a bill in May adding sexual orientation. He later amended the bill by deleting language that gave protection based on “gender identity” and “gender expression.” Equality Florida, a group that advocates anti-discrimination laws, objected that the change watered down the bill by eliminating protection for transgender individuals and would allow discrimination based on gender stereotypes.
But the change picked up support from council members who otherwise were inclined to oppose the bill. The 10-9 vote Wednesday was against the substitute legislation put forward by Jones.
The failure to amend the bill forced a second vote on the original bill filed by Jones. The council rejected it 17-2 with only Jones and Councilwoman Denise Lee in favor. |
Best Selling Reviews
“The artist doesn’t have time to listen to the critics. The ones who want to be writers read the reviews, the ones who want to write don’t have the time to read reviews.” – William Faulkner As an author you know that getting plenty of reviews for your book is… |
[Harmonization of testing drugs for bioequivalence: problems and possible solutions].
Problems encountered in the testing for bioequivalence of reproduced drugs (generics) are discussed in the parts incompletely resolved in domestic methodological recommendations. There are special cases when such drugs significantly vary in concentration and dosage, contain endogenous substances, exhibit intensive metabolism with a genetically polymorphous component, belong to "long-lived" compounds, and are intended for local administration. Also mentioned are problems related to insufficient sensitivity of analytical methods and some ethical aspects of investigations. |
EXTRA CRAP
Excessive force?
Man dies from excessive workout
Police force
To get a tree out of the way in Russia you need ten cops and one that can fly.
Views: 912
Mild force
For North Korean standards, that is.
Views: 1387
Idol rejected by force
American idol reject forcibly removed from studio.
Views: 779
Cops force woman to strip
Is it me or does CCTV always have the best programs? FiOS needs to pick this shit up.
Views: 1368
Brick-Force: One Million Maps Trailer
Bricks are made for building! Mankind has made beatiful constructions, but all fall short to the awesome Brick-Force community’s masterpieces! Brick-Force is a sandbox shooter where you can build the worlds and maps you’ve always dreamed of, brick by brick. |
As the title states, I have a Blackberry 8830 for sale, is in good physical condition and in perfect working order. Also comes with case in pictures and international charger. I am asking 75 shipped, or best offer. Crackhead pricing. Looking to sell very quick, so shoot me offers.
http://i40.tinypic.com/nd3lgh.jpg
http://i40.tinypic.com/2yxgqxh.jpg
BIGsherm7272
06-29-2009, 07:20 PM
ttt
BIGsherm7272
06-30-2009, 06:20 PM
bump
BIGsherm7272
06-30-2009, 06:49 PM
nvm still up for sale......first one to send 65 + pp fees to [email protected] for paypal gets it, great deal |
Related Stories
Topics
Lance Hornby is not reviewing Magic Of The 2012-13 Lockout on this year’s QMI Agency Christmas hockey book list. Not when authors Gary Bettman and Donald Fehr have been on Santa’s naughty list. But in this dark NHL season, a talented lineup of writers have been working like elves to fill the void. This has to be the largest batch of hockey books Hornby can remember in one Yuletide:
HOCKEY NIGHT IN CANADA: 60 SEASONS
By: Michael McKinley
Penguin, 318 pages, $39.00
Conveys everything that makes Saturday special, with plenty of classic photos and great bio and sidebars on Gallivan to Grapes. You can almost hear the old HNIC theme as you turn the pages.
THE BEST SEAT IN THE HOUSE
By: Jamie McLennan and Ian Mendes
Wiley, 238 pages, $24.95
McLennan has a different spin on things, well, because he’s a goalie, but who also survived a brush with death from meningitis at the peak of his career.
He recovered to play another 10 years on three continents, then became a coach and TV commentator. The self-titled Forrest Gump of the NHL shares his unusual stories, from stealing a cab in Montreal, getting one-upped by a mascot in his crease and accidentally assaulting a senior citizen.
SUDDEN DEATH
By: Leesa Culp, Gregg Drinnan and Bob Wilkie
Dundurn, 207 pages, $25.99
The tragic bus crash that killed four rising Swift Current hockey players, including the brother of Sabres’ coach Lindy Ruff, did not end in 1986.
Those who survived bear scars to this day trying to move on. Three in particular, coach Graham James and players Sheldon Kennedy and Joe Sakic went down very different paths. Co-author Wilkie was one of the 22 survivors.
CROSSING THE LINE
By: Derek Sanderson and Kevin Shea
Harper Collins, $25.95
‘Turk’ Sanderson was hockey’s first modern train wreck, but until now, few realized how bad off he was and managed to crawl away.
He has the good fortune to look back on the wild 1970s and laugh about it.
STRAIGHT SHOOTER:THE BRAD PARK STORY
By: Thom Sears and Brad Park
Wiley, 300 pages, $27.95
He came after Bobby Orr in Boston, before Brian Leetch in New York and coached Detroit just prior to it turning the corner to Cup contention.
So Park’s place in the game, particularly his impact as an offensive defenceman, is sometimes overlooked. He played 10 seasons with 50 or more points, sits 12th in career assists by defencemen and saved his best games for Moscow with Team Canada ‘72. Sears gives Park his due and lets him rap about his junior days with the Toronto Marlies, being on both sides of the bitter Bruins-Rangers rivalry and the pitfalls of NHL coaching.
J.R.
By: Jeremy Roenick and Kevin Allen
Harper Collins, 320 pages,$32.99
Jeremy Roenick is well on his way to becoming the American Don Cherry.
CONCUSSED!
By: Keith Primeau and Kerry Goulet
Overtime, 255 pages, $19.95
Head injuries can no longer be swept under the carpet — in any sport. Rugged NHLer Primeau and Canadian-born German Leaguer Goulet have crusaded for this cause. They relate their own injuries and through dialogue with experts, provide a template to players a present and future on safeguarding and treating concussion-related trauma.
NEXT GOAL WINS
By: Liam Maguire
Random House, 198 pages, $22.95
Because some of us have a curved stick where our brains should be, we enjoy Maguire’s bend on hockey trivia. In his latest collection, we discover 84 was the last NHL number to be activated, that only three players drafted first overall never played an NHL game and the 70 correlations to Bobby Orr and the No. 4 that were triggered by his 1970 Cup-winning goal.
THE WINGED WHEEL
By: Rob Simpson
Wiley, 234 pages, $34.95
A must for Wing-nuts. This coffee table book of photos details all things Wings from when the Detroit Olympia rocked,when Gordie and Terrible Ted were in their prime, up to Yzerman, Lidstrom and the return to glory of four Stanley Cups.
TALES FROM THE TORONTO MAPLE LEAFS/MONTREAL CANADIENS LOCKER ROOM
By: David Shoalts and Robert S. Lefebvre
Sports Publishing, 178/191 pages, $19.95
Both are updated versions of off-beat episodes from the NHL’s two oldest teams. The Habs have the richer history from which to pluck stories, but the most entertaining is the Leafs, especially their rogues’ gallery of players and the foibles in the Harold Ballard years. Shoalts has added some Brian Burke-Ron Wilson anecdotes.
THE GREAT ONE: THE COMPLETE WAYNE GRETZKY COLLECTION
By: Sports Illustrated
McLelland and Stewart, 336 pages, $24.99
The respected sports mag, often ripped for its lack of hockey coverage, could not get enough of the Great One in his prime. Their top writers profiled Gretzky starting in his teen years, made him a cover boy and Sportsman Of The Year.
In 1985, when the idea of a 300-point season was being raised, Gretzky told S.I.’s E.M. Swift he was at his peak and would likely last another seven to 10 years. Though No. 99 stayed until 1999, fans looking for a touchstone player today will read this and wish he had played longer.
THE GOAL OF MY LIFE
By: Paul Henderson and Roger Lajoie
McLelland and Stewart, 344 pages, $32.99
Henderson’s 40-year reflection of The Goal, his battle with life-threatening illness and how he and a hockey-loving country dealt with adversity, then and now.
1972 — STATS, LIES AND VIDEOTAPE
By: Richard Bendell, Paul Patskou and Robert MacAskill
Self published, 428 pages, $29.72
Not quite your warm and fuzzy memory of ’72, with former chartered accountant Bendell taking some new and blunt angles on the series and de-bunking some misconceptions. The team of authors, which include a film researcher, movie director and puckhead stats experts, break down all eight games with plenty of numbers and some long-forgotten quotes from commentators from both sides. If that series was war, this lengthy tome is War and Peace.
RED RISING, THE WASHINGTON CAPITALS STORY
By: Ted Starkey
ECW Press, 253 pages, $17.95
Are the Caps the best team never to win the Cup? This neatly details how Washington built its contender, but the unfinshed chapter will be how new coach Adam Oates co-exists with Alex Ovechkin.
JAMES T. SUTHERLAND, THE GRAND OLD MAN OF HOCKEY
By: Bill Fitsell
Quarry Heritage, 204 pages, $29.95
We know Kingston’s claim to fame as the cradle of hockey and that Fitsell deserves the gratitude of all fans on behalf of his projects for the Society for International Hockey Research. Here, he profiles war officer Sutherland and his quest to see Kingston get proper credit, culminating with establishing the International Hockey Hall Of Fame.
A WILD STAB FOR IT
By: Dave Bidini
ECW Press, 109 pages, $19.95
Bidini was like a lot of us who watched the ’72 series in a grade school gym. But he somehow transports himself to Moscow for a wonderful take on the people in and around Game 8. A book that fits in the palm of your hockey glove covers a lot of ice, with Bidini’s own hockey travels woven in.
A SEASON IN TIME
By: Todd Denault
Wiley, 379 pages, $32.95
One season rarely holds fan interest from training camp through the Cup presentation and resonates in memory banks 20 years on.
But 1992-93 was end to end rushes, featuring Mario Lemieux, the Montreal Canadiens’ overtime magic, Wayne Gretzky at his zenith in L.A. and of course the joyful revival of the Maple Leafs through Cliff Fletcher, Pat Burns and Doug Gilmour.
It was the 100th anniversary of the Stanley Cup and yielded 1,000 storylines, capped by a compelling playoff.
Denault gives an excellent 20-year retrospective on the players, coaches and executives who made it so special, before rampant expansion and the first of three lockouts began ruining the fan experience.
Toronto fans, still bitter about missing the Habs in the final, have to agree it was a hell of a year.
COACH, THE PAT BURNS STORY
By: Rosie DiManno
Doubleday, 336 pages, $32.95
Burns is not yet in the Hall Of Fame, but he’s still in the hearts of players and fans.
DiManno delves into the conflicted life of the coach, who began as a policeman/ detective who pinned the murder of a priest on a young man Burns once coached in minor hockey.
Behind the bench, Burns was a good fit for the lion taming role in Canada’s two most diverse hockey cultures in Montreal and Toronto. But there were lots of turmoil and personal sacrifice on the road to an eventual Stanley Cup before his premature passing.
Sponsored Links
The book on Christmas hockey reads
Lance Hornby is not reviewing Magic Of The 2012-13 Lockout on this year’s Sun Media Christmas hockey book list. Not when authors Gary Bettman and Donald Fehr have been on Santa’s naughty list. But in this dark NHL season, a talented lineup of writers have been working like elves to fill the void. This has to be the largest batch of hockey books Hornby can remember in one Yuletide:
HOCKEY NIGHT IN CANADA: 60 SEASONS
Michael McKinley
Penguin, 318 pages, $39.00
Conveys everything that makes Saturday special, with plenty of classic photos and great bio and sidebars on Gallivan to Grapes. You can almost hear the old HNIC theme as you turn the pages.
THE BEST SEAT IN THE HOUSE
Jamie McLennan and Ian Mendes
Wiley, 238 pages, $24.95
McLennan has a different spin on things, well, because he’s a goalie, but who also survived a brush with death from meningitis at the peak of his career. |
Finite element modelling of the articular disc behaviour of the temporo-mandibular joint under dynamic loads.
The proposed biodynamic model of the articular disc joint has the ability to affect directly the complete chewing mechanism process and its related muscles defining its kinematics. When subjected to stresses from the mastication muscles, the disc absorbs one part and redistributes the other to become completely distorted. To develop a realistic model of this intricate joint a CT scan and MRI images from a patient were obtained to create sections (layers) and MRI images to create an anatomical joint CAD model, and its corresponding mesh element using a finite element method. The boundary conditions are described by the external forces applied to the joint model through a decomposition of the maximum muscular force developed by the same individual. In this study, the maximum force was operating at frequencies close to the actual chewing frequency measured through a cyclic loading condition. The reaction force at the glenoid fossa was found to be around 1035 N and is directly related to the frequency of indentation. It is also shown that over the years the areas of maximum stresses are located at the lateral portion of the disc and on its posterior rim. These forces can reach 13.2 MPa after a period of 32 seconds (s) at a frequency of 0.5 Hz. An important part of this study is to highlight resilience and the areas where stresses are at their maximum. This study provides a novel approach to improve the understanding of this complex joint, as well as to assess the different pathologies associated with the disc disease that would be difficult to study otherwise. |
SUDAN
"Sudan , is the largest country in Africa, situated on the north eastern side of the continent at 4 and 21 North Latitude and 21 and 38 East longitude, comprising an area of 2.5 million km2. The Sudan is essentially a country of vast plains, such as the Amatong in the South and the Red Sea hills in the East. The country is bordered by nine countries : Egypt and Libya from the North, Chad and Central Africa from the West, Zaire, Uganda, and Kenya from the South, Ethiopia and Eritrea from the south east.
|
Bowls
Whether you are enjoying a hearty breakfast or nutritious stew, bowls are an integral element of your dinnerware collection. With this in mind, here at Dunelm we offer a range of stylish and practical bowls to meet your every need.
Start the day properly by adding your favourite cereal or porridge to one of our fantastic cereal bowls. If you are keen to offer your family and guests a healthy side dish, our salad bowls are ideal for serving up salad, bread and fruit. These versatile products will look attractive on your dinner table yet are also durable enough to be used at your summer barbeque.
You may also like to browse our extensive range of ceramic bowls, available in a multitude of styles and colours. Whilst our wide rimmed pasta bowls are perfect for dishing out generous portions, our attractive cereal bowls will give you an extra reason to smile first thing in the morning. Take a look at our full range to discover the bowls best suited to your requirements and personality. |
Saturday, February 26, 2011
The Houston Chronicle quotes a demographer, Steve Murdock, who notes looking at population projections for Texas, "It's basically over for Anglos." The story reports that two out of every three Texas children are non-Anglo (almost all Mexican origin) and that will become even more pronounced in the future. Murdock is a former U.S. Census Bureau Director and is currently the Director of the Hobby Center for the Study of Texas at Rice University. Murdock says that Texas is divided into two: an aging Anglo population and a young, almost entirely Mexican origin population. This sets up the mother of all spoils battles: spend on mostly Mexican kids, or aging Whites. The impact of this spoils battle could conceivably, if it spirals out of control, lead to a break-up of the US along racial lines, at worst. Its been predicted, before, by men who are no fringe figures.
Between 2000 and 2040, the state's public school enrollment will see a 15 percent decline in Anglo children while Hispanic children will make up a 213 percent increase, he said.
The state's largest county - Harris - will shed Anglos throughout the coming decades. By 2040, Harris County will have about 516, 000 fewer Anglos than lived in the Houston area in 2000, while the number of Hispanics will increase by 2.5 million during the same period, Murdock said. The projection assumes a net migration rate equal to one-half of 1990-2000.…B y 2040, only 20 percent of the state's public school enrollment will be Anglo, he said. Last year, non-Hispanic white children made up 33.3 percent of the state's 4.8 million public school enrollment.
Of the state's 254 counties, 79 recorded declining population during the past 20 years. All are rural. An additional 30 Texas counties, he said, would have also lost population had they not experienced Hispanic growth.
The state's future looks bleak assuming the current trend line does not change because education and income levels for Hispanics lag considerably behind Anglos, he said.
Unless the trend line changes, 30 percent of the state's labor force will not have even a high school diploma by 2040, he said. And the average household income will be about $6,500 lower than it was in 2000. That figure is not inflation adjusted so it will be worse than what it sounds.
"It's a terrible situation that you are in. I am worried," Murdock said.
Whites are defacto minorities in California, Arizona, Texas, and Nevada. In California, Hispanics outnumber Whites absolutely, while in Arizona, Texas, and Nevada about two thirds of children under 14 are Hispanic, and only about a third White. If one believes in unicorns, rainbows, and fairies (the Tinkerbell kind, not the San Francisco leather-bound kind) then this will be no problem. "Magic" will sprinkle pixie dust on Hispanic children, magically making them achieve the same educational levels, same low levels of criminal activity, same economic levels, as the White populations they are replacing. And everyone will dance around singing Kumbayah and holding hands in one giant post-racial party, happy to have conquered "Whiteness." This is the fantasy of the Puritan-Progressive elite, and post-Quakers, the cultural heirs to the New England Puritans and Pennsylvania Quakers. Who believe in a mish-mash of "elect and damned" and "be nice to others, they'll be nice to you." The latter sound advice when your neighbors are the Amish, not so sound when they are MS-13 or the Zetas.
The reality is likely to be quite different. First, flight. As noted extensively in "Albion's Seed" by David Hackett Fischer, the response of the British Borderers and their "hillbilly" descendants has been first to flee. Then fight when left with no alternative. Fleeing is easier than fighting, and all cultural groups of White people, the New England Puritans, the Virginian Cavaliers, the Mid Atlantic Quakers, and the Appalachian Backwoodsmen, do their utmost to remove themselves culturally, physically, and socially from non-Whites. No group of White people clamors to live in the Ghetto or Barrio, instead they at best in times of high real estate prices urge gentrification, to move those people out of desirable real estate. At other times Whites cluster in exclusively White areas. Appalachian folk tend towards country music, NASCAR, and rural/suburban areas noted for their lack of non-Whites. Mid-Atlantic Quakers and Post Puritan-Progressives enjoy classical music, jazz and the blues (which Blacks have fled from in panic due to White popularity), 80's music, gentrified urban settings and "hip-trendy" outposts like Asheville NC or Austin TX that are nearly exclusively White. [The Cavaliers of Virginia of course are long dead and gone, culturally.] Even the most enthusiastic proponent in Hollywood of "magical Blackness" (that Spike Lee among others complain about) do their utmost to live in lily-White areas: Malibu, Santa Monica, Brentwood, etc. Indeed, at no time has all of White America been so exclusively White, and culturally as well as physically removed from Blacks and Hispanics. You won't find any Whites not even those most enthusiastic about illegal immigration and "the end of Whiteness" watching Sabado Gigante on Univision.
So fleeing will continue, until there is nowhere to flee to, by average Whites. Upper class, more wealthy Whites have already fled to exclusive White urban zones, such as Malibu or NYC's Upper East Side. But flight is not sustainable forever, and the other notable characteristic of the Backwoods folk is their propensity to fight, often to the bitter end, when cornered and their conception of "natural liberty" is infringed upon. Indeed, as the cultural grouping of Backwoods grows, at the expense of the Mid-Atlantic and Puritan-Progressive groupings, the tendency to fight to "protect your liberty" is only going to get stronger, and tinged with pure racial identification.
Being a Puritan-Progressive, or Mid-Atlantic utopianist, takes money and security. Without money to isolate one's self from non-Whites (and those outside your cultural grouping as well) it cannot be sustained. Without physical safety, a strong and efficient police force that crushes any attempt to victimize the White Puritan-Progressive or the Mid-Atlantic Utopian elites, that cultural grouping cannot be sustained. You cannot believe in original racial sin (Whites) and redemption (making Whites minorities in their own countries to get rid of those Backwoodsmen to whom all sin accrues) during a Home Invasion. Or your kid getting beat up at school due to "Whiteness" or any myriad other violent or hostile encounters with non-Whites asserting physical dominance, control, and so on. It is easy to decry the "stupid racism of Hillbillies" in Malibu gated communities and mansions. Much harder to do it when your neighborhood is over-run with MS-13 or the Zetas, and your kids get beat up every day. Or your household income takes massive hits just for private school to keep your kids from a daily beating. Or rising fuel costs force you into daily and bitterly resented contact with hostile non-Whites.
The ascendancy of the Puritan-Progressive and Mid-Atlantic utopian ideals, of pre-destined damned and saved, and magical goodness of non-Whites, depended on constantly rising incomes to produce enough economic margin to grow and convert Whites to that cultural grouping. A sustained downward spiral pushes Whites to nationalism, high rates of physical mobility, intense personal loyalty to a few leaders, and a desire to fight along clan/family/tribal basis for "natural liberty" i.e. the ideal of being left alone, government being merely a means for others, (in this case non-Whites) to oppress ordinary people. Call this the Hillbilly way. The Hillbilly Way tends to grow (a lot) when times turn hard, for a good long spell. [It was the political genius of FDR to pull Hillbillies his way, by deporting every Mexican he could, and preventing Blacks from unionizing or even voting in the same Democratic Primary as Whites, until 1944.]
Cue the spoils fights. There will be a "stuck group" that will not be able to flee to Whitopia, and indeed the Puritan-Progressive and Mid Atlantic Utopianists (motivated by sheer hatred of "the Hillbilly Way" and Hillbillies) have done their best to encourage a "drowning of Whiteness" (and hated cultural rivals) by importing masses of non-Whites, both Mexican illegal aliens, and various non-White refugees, and settling them in places like Idaho, or Wisconsin, or Minnesota, or Maine. Whitopia is no longer so White. Setting up the fight part of flight or fight.
Will an aging White population tax itself basically out of existence, to educate and provide welfare for non-Whites who are as a matter of course, both innately hostile to them and replacing them totally? The answer is no. Nor will a non-White population tax itself, or even devote a smidgen of public funds, to support aging Whites who they both despise and know they will replace. This extends of course to the current budget struggle in California, where Jerry Brown is hinting he'll dump State workers benefits and salaries, already agreed upon, to spend the money on Hispanics: health care, education, and welfare. Even with massive tax increases, the only way to keep spending mountains of money on the California Hispanic population is by gutting the money spent on mostly White state and local government workers.
At its possible worst, this sets the stage for what Igor Panarin predicted: civil war and secession over spoils and public spending. Widely dismissed as naïve and stupid at the time, Panarin (not a fringe figure, rather a respected dean of Russia's academy for diplomats) seems prophetic. While the exact breakdown of a US split and dissolution might be argued, it cannot be dismissed out of hand. Simply because there is no example, in all of human history, of a democratic republic being multi-racial and multicultural. At best, brutal dictators who rule with the help of a favored group, by mercilessly hounding the other out-groups, provide the stability of the grave. Tito, Stalin, Mithridates, Caesar Augustus, Ghengis Khan, all come to mind. Human beings simply are not built to trust and trade resources fairly and freely across racial lines in a republic (rights of minorities and dissenters respected) and democracy (majority rule). It has never ever happened in all of human history and culture, which is considerable. Because, quite likely, the kin-based nature of human evolution has pre-disposed us to cooperate on racial/cultural lines: people who reasonably look, act, sound, and otherwise resemble distant cousins. We certainly do have many examples, as Amy Chua's "World on Fire" show, of democratic majorities constantly victimizing minorities. The difference of course is that in the US, the minorities (Whites) are likely to fight back.
Here is what the man had to say (the map at the top of the post is from the WSJ story):
He based the forecast on classified data supplied to him by FAPSI analysts, he says. He predicts that economic, financial and demographic trends will provoke a political and social crisis in the U.S. When the going gets tough, he says, wealthier states will withhold funds from the federal government and effectively secede from the union. Social unrest up to and including a civil war will follow. The U.S. will then split along ethnic lines, and foreign powers will move in.
Yes, he sounds at least half-way accurate. Financial, demographic, and economic crisis have all hit the US at the same time. Indeed the crisis are largely driven by demographic trends. Replacing Whites with non-Whites would be problematic (based on human nature) if the replacers were wealthier than Whites. Given that they are in fact much poorer and remain so, this makes conflict of some sort (hopefully only political) inevitable.
Of course, violent secession is not set in stone. But neither is it an unlikely fantasy. Fleeing Whites who were in effect ethnically cleansed out of California, Nevada, Arizona, Texas, and Florida are unlikely to be willing to transfer funds from wealthier White states such as Idaho, or South Dakota, to Texas and the rest of the "Mexico Norte" states. Money to be spent on the very people who ethnically cleansed them out of their homes in the first place. Nor is there any way to construct a "grand bargain" -- Hispanics (mostly all Mexicans) spending money to care for an aging White population in exchange for taxes spent to educate poor Mexicans and provide welfare. First, there will not be enough money to go around, the average income gap per household is about $16,000 of White vs. Hispanic in 2009 dollars according to the US Census Bureau. There has been no narrowing the gap over the last twenty years, instead it has only increased. And socially, Hispanics have had growing maladaptive behaviors to increase income: growing not decreasing levels of illegitimacy, growing not decreasing levels of drop out rates, growing not decreasing levels of Spanish only language skills. Meanwhile the burden of providing health, education, and welfare of a desperately poor population of illegal aliens and one only slightly less desperately poor (the children of illegal aliens and every descendant afterwards) increases exponentially.
There would be barely enough money to provide for White social security and other retirement issues (health care). There is without question not enough money to provide for the "Mexicanization" of much of the United States. The health care, education, and welfare needs are so great that even if no money was spent at all on elderly Whites, there would not be enough to go around. Poor people, it seems, cost a lot.
Which means conflict. This conflict can be done by more peaceful means, through political action that makes decisions stick, by forcing those without means and power to fight back to accept a fait-accompli (basically a re-run of the Trail of Tears, some form of mass deportations of the out-group), or a process that spirals out of control into violence. Given the entrenched interests that benefit from Mexicanization of America, and the sheer hatred of "Hillbillies" by Progressive-Puritans and Mid Atlantic Idealists, a good bet is on the latter. Of course, any such process is likely 15 to 25 years out, but it is highly likely at some point. A good many political analysts predicted the Civil War by 1835, and as note by Panarin, the collapse of the USSR by the 1970's. America could no more remain half-slave and half-free as it can half-Mexican-dominated and half-not-Mexican-dominated. The cultural, economic, political, and mass population conflicts in each case make some sort of total loser/total winner outcome, by whatever means, almost inevitable.
In this case, it is worth noting that the US military already remains in the views of some, dangerously isolated and quite angry at much of Establishment America. This story from Politico touches on the divide between "peacetime America" and the Wartime Military. Columbia Students shouted "racist" at a wounded, wheel-chair bound vet who spoke out for ROTC on campus, while others jeered and laughed at his injuries. Meanwhile US Defense Secretary Robert Gates worries:
A decade of constant conflict has trained a junior officer corps with exceptional leadership skills, he told the cadets, but the Army may find it difficult in the future to find inspiring work to retain its rising commanders as it fights for the money to keep large, heavy combat units in the field.
“Men and women in the prime of their professional lives, who may have been responsible for the lives of scores or hundreds of troops, or millions of dollars in assistance, or engaging or reconciling warring tribes, may find themselves in a cube all day re-formatting PowerPoint slides, preparing quarterly training briefs, or assigned an ever-expanding array of clerical duties,” Mr. Gates said. “The consequences of this terrify me.”
Hmmm … let me see now. An officer corps, almost exclusively White, Southern/Western, conservative, mirrored fairly completely down to the lowest detail of enlisted men? A feckless, and clueless national leadership intent on massively changing the way of life of pretty much everyone in the country that is also innately hostile to the Military itself? Mixed with an economic crisis, fiscal crisis, and political crisis all tracing their origins to what amounts to complete demographic replacement of Whites by Mexicans in the US, all without any vote or constitutional amendment? Where have I seen anything like this before? Add to this the de-industrialization of the North and North East, and growing move of what little manufacturing there is to Southern and Western states, and things look different than in 1860.
Naturally, and often fortunately, the future does not move in straight lines. Something is endurable, until it becomes un-endurable. Various agitators are effective, or not. Crisis that should have been foreseen, sneak up on everyone while distraction over piddling events reigns. Human error or courage, stupidity or wisdom, change events from a certainty to a new course. Sometimes even natural disasters can take a hand in shaping history. The Kamikaze originally referred to the near-miraculous typhoon that sunk the Mongol Invasion fleet that would have easily conquered Japan. The Monguls were near invincible. Save for water.
So it is possible, and hopeful, that Mexican immigration into this country slows dramatically, and is even reversed. That sudden cutbacks in welfare spending provoke a soul-searching and wrenching amount of changes in Hispanic behavior, with norms of marriage before children, educational striving, and low crime being a sudden radical shift. Anything can happen. Perhaps an early encounter, with the "aging Anglo population" getting its way with fiscal policy, can create a rapid desire for assimilation by the coming Mexican majority.
The smart bet based on Human History, however, says greed and stupidity will preclude any rational attempt to settle a division of resources and control, short of violence and brutal coercion, and America will indeed slide into the conflict envisioned by Igor Panarin. Not of course, right away. But inevitably, as the call of the trumpets at Shiloh and Bull Run and Gettysburg were heard even in 1835, so the siren call of war and conflict is being heard already. Driven by fundamental conflicts.
It is all over for Anglos in Texas. Also California, Arizona, Florida, and probably Illinois. Whites are now the functional minority, in the US. While being the target of non-Whites for resource extraction, the White to non-White gap in income being considerable and growing. Amy Chua's model of "market dominant minorities" will probably hold for Bill Gates kids, and Warren Buffett's, and perhaps even Mitt Romney's kids. But for the great rest of the average White guy, flight will soon turn into fight. Because life as basically a third class citizen in Mexico Norte is worth fighting to avoid, everything else notwithstanding. With conveniently, a great deal of military men who got battlefield training (Lee and the other Southern Commanders all had extensive experience in the Mexican-American War, the Union Officer Corps till Grant and Sherman were time-serving non-entities who had no real combat/leadership experience) and find little else to interest them. While a great deal of the current New England/Mid Atlantic elite holds them in mutual contempt and disgust.
Ultimately, a non-White America will resemble Mexico, only slightly better off. The same levels of corruption, violence, and government services will prevail. With an added feature of ethnically/racially driven violence and government discrimination. Good government, security, prosperity, all cost money. They can only be achieved, history shows us, with an ethnically and culturally unitary, large and dominant middling class that controls the government and directs its spending and aims for its own ends. There is a reason the Philippines and places like it are chaotic, violent, and poor. Despite the ability to punish and extract at times resources from Chua's "Market Dominant Minorities."
In any conflict, moreover, the initiative remains with a more unified, disciplined, experienced, and smarter opponent. Sheer numbers can at times overwhelm, but at other times provide only carnage and cannon fodder. Speed, mobility, surprise, and most critical of all, discipline under chaos tend to produce the most winners, in politics and in war. Conflict of some sort is coming, that much is certain. You cannot have population replacement, a welfare state, and legalized racial caste systems (Whites on bottom) and not have conflict in some form. Let us hope and pray the basic resource division: spend on older Whites or younger Hispanics, is settled short of violence with conclusive finality, through political means, avoids a break-up of the US, and restores a racial unity and peacefulness to America.
21 comments:
Over for Anglos--not quite. But the days of a large welfare state are clearly numbered. Mexicans are not black. Repeat that phrase a few times until it sinks in. We tend to lump all NAMs together without thinking about the subtle differences between NAM groups. Mexicans actually have a lot in common with the working class (hillbilly) whites. My white grandfather shoveled coal for a living before he became an electrician. My white uncles were bricklayers and tin-benders. We will be returning to a national economy with a lot of menial labor and a lower standard of living. We look at Mexico today and see that whiter Mexicans tend to live a very nice upper middle class life, while Mexicans who are more black or Amerindian tend to be dirt poor. This is our future as well, but how will we get there? Even as whites become a minority in the USA they still own most of the wealth, guns, and arable land. As Whiskey predicts conflict is inevitable, but whom will the whites be fighting? Not the NAMs. When cornered whites will fight other whites. As the economic situation becomes more serious a great squeezing of the white middle class will take place. The first shots will be fired in anger at people who have come to take houses, and family farms for back taxes. In light of the foreclosure crisis it is possible that these first shots have already been fired and we paid no heed. As the crisis unfolds leaders will emerge to resist the great squeeze and some desperate whites will follow those leaders. Will this lead to secession and civil war or a period of white insurgency against the still predominately white govt.? The good news is that FICA, FUTA, workman's comp, and all the other punitive taxation of labor are just about over. These taxes never made much sense, and they just won't work in an economy where most people are menial laborers. The bad news is that the republic in done for. Good news if you are white is that your descendants will still most likely own everything 50 years from now. The more interesting question is what happens to all the women and children as the great squeeze takes place. After all--my coal shoveling grandpa still managed to raise an intact family. The other topic that Whiskey blogs about, the collapse of monogamy, may be more significant than the NAM invasion. The NAM invasion can only turn the US into Mexico or Brazil and whites have it pretty good in Mexico and Brazil. The collapse of monogamy can turn the US into Zimbabwe.
I can tell you in the Northeast whites are fleeing public education in droves. The only students left in public schools are minorities and underachievers. The private schools are turning students away. We have 7 or 8 very expensive private schools in our area. When my high school senior son applied to an expensive all boys school 4 years ago the school rejected 50 applicants. This year my other son applied to the same school and 120 students were rejected. The number of applicants rises every year. The size of the student body stays the same. If the public schools were doing their job the parents would see no need to spend $50,000 to give their white son a private high school education.
"Let us hope and pray the basic resource division: spend on older Whites or younger Hispanics, is settled short of violence with conclusive finality, through political means, avoids a break-up of the US, and restores a racial unity and peacefulness to America."
My feeling is that 'a break-up of the US' is the *best* hope for racial unity and peacefulness.
"Albion's Seed" is very interesting- large portions can be read for free on Amazon. Political conflict in the US is very much a power struggle between these historical English groups and their later-arriving allies. People all across the political spectrum from communists to white nationalists like to talk about "white people" but there is no such homogenous group.
Whiskey, may I please ask which micro neighborhood here in Los Angeles you live in?
Because What I see here is very different than what you see. I see large numbers of whites in their 30's settling in areas that are NOT all white.
Let me be clear, these are middle aged people that grew up in all white neighborhoods like Malibu, Westlake Village, Lake Sherwood, etc who have decided that life in the all white neighborhoods is too boring and who have instead decided to settle in Venice.
Whiskey how much time have you spent on Abbott Kinney recently? It is filled with whites who can afford to live anywhere that they want who have chosen to live in Venice, even thought the population of Venice is very mixed.
Whiskey I think the massive decline in crime in some "mixed" areas of LA like Venice has led many whites to consider it as a home, whites who never would have considered it in the past.
So, yes in some places in America some whites are moving to exurban whiteopias. However it seems that in some other places in America, like DC, NYC, LA, Chicago whites who grew up in all white neighborhoods are moving in very large numbers to mixed neighborhoods.
I don't think this is discussed much here in the paleo - o - sphere because almost by definition, a paleo conservative is someone who IF HE CAN AFFORD IT will always choose an all white neighborhood over a neighborhood that has some nams living in it - so stories about large numbers of whites actually moving TO mixed neighborhoods just don't resonate to the people who post here.
That being said, I would like you to tell us what neighborhood you live in so that i can get a sense for where you are coming from
I am not familiar with Venice, Ca, but it seems like a cool place to live. "Venice is a district on the Westside of Los Angeles, California, United States. It is known for its canals, beaches and circus-like Ocean Front Walk, ."
Could this be an example of gentrification taking place? Whites have been moving back into the District of Columbia, and have been gentrifying trendy parts of several American cities. This tends to slowly inflate real estate prices and force lower income people out. I tend to agree with the premise that whites do not fear Hispanics as much as they tend to fear blacks. Perhaps this is because I spent a lot of time in New Mexico as a boy... If true this lack of fear and resentment means that the huge influx of hispanics will continue unabated. This migration pattern will not be resisted any more than the "great migration" of southern blacks to Detroit was resisted back in 1950. There will be fiscal and cultural consequences.
Agree with your overall conclusions, but maybe not so much with the timing. Birth rates in Latin America have tanked lately, so ten years from now there simply won't be that big a base from which to draw illegal immigrants. From what I understand, the same is true among Hispanics stateside.
However, this is still a game of last man standing. If white women produced even FEWER kids than Hispanics, the future you envision will still become a reality.
I live in Irvine but am familiar with Venice/Abbot Kinney. Its like New Orleans Uptown pre-Katrina: gentrifying as you say due to lower crime rates. It is desirable: better air quality, close to the beach, etc.
HOWEVER, it has massive problems. Lots of homeless, RVs spewing sewage on the streets, gangs (particularly closer to Lincoln Blvd you get), and so on. The Beach is a combat zone at night, but yeah Abbot Kinney is hipster doofus central (complete with gourmet food truck invasion).
"I can tell you in the Northeast whites are fleeing public education in droves."
In my area this has definitely been a noticeable trend, even though it's close to DC and thus affluent regardless of the nationwide economy. There are a number of "Friends" schools, along with elite Catholic schools & non-denominational private institutions dating from the 19th Century. Although some of the fancy SWPL preschools are struggling, private middle and high schools are still popular, and probably still raising huge sums from alumni. My own private high school raised record amounts of money while I attended (circa 2000). Class sizes went up, and our old middle school was demolished to make way for a larger building. And yet this still wasn't enough to keep up with demand. Admission became even more competitive (rising tuition did not deter applicants), and so did admission to the ivies for anyone lucky enough to get in.
More importantly, from a demographic standpoint, the racial makeup of the class was barely altered. The school remained perhaps 75-80% white, and perhaps 20% "model minority" (Indian and East Asian). IIRC we had exactly one Hispanic student the four years I was there, and about 10 blacks per graduting class. Right next to our school was a poor Black public high school, whose students sometimes attacked my classmates when they could get away with it. In other words, the two schools were basically a microcosm of the two-tier educational system developing in this country.
Unfortunately, I do not see this trend reversing itself. There will always be a core of gentrified whites who can escape to the private & religious schools, plus some whites whose school districts function tolerably well due to low levels of NAM students. Most public schools on the coasts and in the Southwest, however, will devolve into Disciplinary Boot-meets-Daycare within 5-10 years. To see what will happen to the shrinking White student bodies, take a look at the story below.
http://mydaughtersassault.blogspot.com/
(Some interesting comments, BTW, from the White posters on that blog. Since 2008 more & more Whites are mentioning unpleasant truths on the net, if not in person).
tacticalchrstn said..."But the days of a large welfare state are clearly numbered."
I agree.There is a common but hugely incorrect belief that Latinos are economically liberal. In reality nothing can be further from the truth. Latinos and also Blacks only support social welfare programs because Whitey is picking up the tab.
take a look at the countries of the world ordered by tax revenue as percentage of GDPand you'll notice that African and Latin American countries have some of the lowest tax rates in the world.low taxes == low social welfare
There you have it folks, smoking gun evidence, that Blacks and Latinos don't want to pay taxes to support social welfare. Only a white society can support it. Therefore once whites are no longer the majority social welfare will collapse in the USA.
Oddly enough one of the Left's most cherished institutions, social welfare, will collapse primarily because of an action they themselves supported, open borders and race replacement of thw white race.
You can't possibly take that map seriously, Whiskey. I mean, Russia taking Alaska? With what? China taking the western seaboard? How? More likely Mexico would do that, if they were interested.
As far as the Texas report goes, we should wait a bit to see the data hashed out before running around screaming. The numbers were released in a manner to maximize public attention. For what purpose I'm not sure. They rely on some questionable assumptions, such as continued immigration from countries that won't continue to export people for long. There's also the sensationalism of public school attendance, when we have a lot of private schools. Another thing is the amount of immigration from other states is on the increase, and that offsets Hispanic entries.
Aside from numbers, yes, Dorothy, Texas Hispanics are different from their "cousins" in California. They intermix far more readily and have a greater cultural stake in the Texas identity. They're also more European by ancestry. I'm sure you all know about Eva Longoria going on George Lopez and finding out she's 87% Euro. Well, she's not much different than about 60% of the Mexicans you'll find in South Texas. In fact, the her home congressional district just tossed Solomon Ortiz in favor the GOP candidate. The dude was a fixture, kind of like a Mexican Charlie Rangel. So there is some ideological and racial give in this situation.
None of this is to say everything's peachy. We should close the border and enforce our laws, but we don't need to run around freaking out.
YR said... "It is the nature of white man to flee rather than fight. We are descended from those who fled furthest from africa"
It was not that long ago where a 2 income household GUARANTEED a sufficient income level to buy a house in a safe neighborhood. (translation: away from NAM's) Unless you were poor white trash, you had the means to insulate yourself.
If you go back to the 1980's it was common for Hollywood to produce cheesy dysotopian sci fi movies where in the future the elites live a privilege lifestyle free of social ills. The rest unfortunately live in a hell hole. Naturally there is an "admission fee" to enter this semi-utopian city and if you couldn't afford to pay then too bad! Well folks it seems these movies have unfortunately predicted the future rather acurrately.
Unless God gifted you with a brain 1 stanadrd deviation higher than the mean IQ, (16% of the population) thereby allowing you to secure a high paying job so you can buy that $500,000 house because that's how much it's going to cost to distance yourself from Blacks and Latinos unfortunately you're going to get screwed.
It is not a happy coincidence that the rise of the angry white male as a political force is happening at a time when being middle class no longer shields you from the problems of diversity / multi-culturalism: crime, failing schools, ghetto behavior.
Polichinello is right about the map, which I have seen before on several websites. The regional divisions prove that this Russian professor is ignorant of US society. He also knows little about foreign relations. Modern nation-states (even China) lack the logistical capabilities and/or will to colonize the United States. A more plausible future will involve not conquests by nation-states but "soft" quasi-invasions by migrant colonists. Think "Camp of the Saints" with America as the main target instead of Europe. Along with street violence from domestic minority populations, also foretold in "Camp of the Saints".
Geographic divisions could potentially be as follows:
-California, Texas, and the Southwest predominantly Central American
-Pockets of strong Hispanic influence in the Southeast and midatlantic
-Blacks confined to the historical "Black Belt" in the South, and the "Rust Belt" to the North
-Whites retreating to "Whitopias" in the midwest and northwest
If the Republic ends anytime soon it won't be a group of resurgent superpowers abroad carving the US up like a pie. Rather, nonstate domestic and foreign interests will cause Federal authority to crumble. Europe, China, Japan, and the Mideast will probably be convulsed by the same forces. This will leave them unable to intervene. Whether through colonial military operations or legal unification with American regions. |
#ifndef _DTX_STM32_I2C_H_
#define _DTX_STM32_I2C_H_
#include <libopencm3/stm32/i2c.h>
#include "target/drivers/mcu/stm32/gpio.h"
#include "target/drivers/mcu/stm32/rcc.h"
static inline void _i2c_init(struct i2c_config i2c)
{
unsigned ccr;
unsigned max_trise;
rcc_periph_clock_enable(get_rcc_from_port(i2c.i2c));
i2c_peripheral_disable(i2c.i2c);
i2c_set_clock_frequency(i2c.i2c, APB1_FREQ_MHz);
if (i2c.fastmode) {
max_trise = (3 * APB1_FREQ_MHz) / 10; // APB * 300ns
i2c_set_fast_mode(i2c.i2c);
if (i2c.dutycycle == I2C_CCR_DUTY_DIV2) {
ccr = (1000000 * APB1_FREQ_MHz) / (3 * i2c.i2c_freq);
} else {
ccr = (1000000 * APB1_FREQ_MHz) / ((16 + 9) * i2c.i2c_freq);
}
} else {
max_trise = APB1_FREQ_MHz; // APB * 1000ns
i2c_set_standard_mode(i2c.i2c);
ccr = (1000000 * APB1_FREQ_MHz) / (2 * i2c.i2c_freq);
}
i2c_set_ccr(i2c.i2c, 0xfff & ccr);
i2c_set_dutycycle(i2c.i2c, i2c.dutycycle);
i2c_set_trise(i2c.i2c, max_trise + 1);
i2c_peripheral_enable(i2c.i2c);
rcc_periph_clock_enable(get_rcc_from_pin(i2c.scl_sca));
GPIO_setup_output_af(i2c.scl_sca, OTYPE_OPENDRAIN, i2c.i2c);
}
#endif // _DTX_STM32_I2C_H_
|
MVVM Light has been upgraded to .NET Standard 1.0. See here and here for updated workflow.
The problem
Netstandard libraries are meant to replace Portable Class Libraries. And they do sound pretty good. The only problem right now is that we’re in a transition phase. A bunch of NuGet packages are not updated to be netstandard compatible yet. But that can’t stop us!
The solution
The solution is basically a matter of configuring your netstandard libraries to be compatible with a certain PCL profile. But let’s not get ahead of ourselves and start from the beginning.
Project setup
For this post we’ll start from an empty solution. To create an empty solution in Visual Studio 2017 go to File > New Project. In the new project dialog, select Other Project Types > Visual Studio Solutions. That should show you the Empty Solution project template
Next, right-click the empty solution > Add > New Project and select the Class Library (.NET Standard) project template. This will be our shared, or core, project.
By default, this will be a netstandard 1.4 project. This can easily be switched to another version from the project properties. The version you should use depends on the platforms you want to target. See this link to easily choose the right version.
Now, if we would try to add the MVVM Light NuGet package we would get an error like
Package MvvmLightLibs 5.3.0 is not compatible with netstandard1.4 (.NETStandard,Version=v1.4). Package MvvmLightLibs 5.3.0 supports: - monoandroid10 (MonoAndroid,Version=v1.0) - net35 (.NETFramework,Version=v3.5) - net40 (.NETFramework,Version=v4.0) - net45 (.NETFramework,Version=v4.5) - portable-net45+win8+wp8+wpa81 (.NETPortable,Version=v0.0,Profile=Profile259) - sl5 (Silverlight,Version=v5.0) - win81 (Windows,Version=v8.1) - wp8 (WindowsPhone,Version=v8.0) - wp81 (WindowsPhone,Version=v8.1) - wpa81 (WindowsPhoneApp,Version=v8.1) - xamarinios10 (Xamarin.iOS,Version=v1.0) One or more packages are incompatible with .NETStandard,Version=v1.4. Package restore failed. Rolling back package changes for 'NetStandardDemo.Core'.
The solution for this came to me in the form of Oren and one of his amazing blog posts. .NET Standard projects can fall back to PCL profiles when needed! This cannot be done from the UI, so we’ll need to edit the XML behind the .NET Standard project. Luckily, Visual Studio 2017 allows us to edit the csproj without having to unload the project first.
Right-click the netstandard project and select Edit <projectname>.csproj
Add the following line in the ProjectGroup tag
<PackageTargetFallback> portable-net45+win8+wpa81+wp8 </PackageTargetFallback>
The complete csproj looks like this
<Project Sdk= "Microsoft.NET.Sdk" > <PropertyGroup> <TargetFramework> netstandard1.4 </TargetFramework> <PackageTargetFallback> portable-net45+win8+wpa81+wp8 </PackageTargetFallback> </PropertyGroup> </Project>
If we try to add MVVM Light again, we get a whole other message
Installing NuGet package MvvmLightLibs 5.3.0. Committing restore... Writing lock file to disk. Path: D:\Projects\NetStandardDemo\NetStandardDemo.Core\obj\project.assets.json Restore completed in 581.25 ms for D:\Projects\NetStandardDemo\NetStandardDemo.Core\NetStandardDemo.Core.csproj. Successfully installed 'CommonServiceLocator 1.3.0' to NetStandardDemo.Core Successfully installed 'MvvmLightLibs 5.3.0' to NetStandardDemo.Core Executing nuget actions took 1.89 sec
Adding a ViewModel that derives from ViewModelBase works like a charm
public class MainViewModel : ViewModelBase { }
However, the ViewModelLocator is something else. We get compile errors when adding this
public class ViewModelLocator { public ViewModelLocator () { ServiceLocator . SetLocatorProvider (() => SimpleIoc . Default ); SimpleIoc . Default . Register < MainViewModel >(); } public MainViewModel Main => ServiceLocator . Current . GetInstance < MainViewModel >(); }
This generates the following error
The type 'IServiceProvider' is defined in an assembly that is not referenced. You must add a reference to assembly 'System.ComponentModel, Version=0.0.0.0, Culture=neutral, PublicKeyToken=b03f5f7f11d50a3a'.
The problem here is that MVVM Light makes use of the ServiceLocator pattern via the CommonServiceLocator package. The SetLocatorProvider expects an object that implements IServiceProvider, and that interface lives in System.ComponentModel.
All we need to do to fix this is add the System.ComponentModel NuGet package to the project and we’re good to go!
Using the ViewModels
Now, let’s see if we can actually start using the viewmodel and the .NET Standard project. Right-click the solution and add a Xamarin platform as target. I’m using Xamarin Android for this article.
The Xamarin Android template includes one page, Main.axml. That should suffice for this demo. I’ve added a TextView to the page. The xml looks like this.
<?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android= "http://schemas.android.com/apk/res/android" android:orientation= "vertical" android:layout_width= "match_parent" android:layout_height= "match_parent" android:minWidth= "25px" android:minHeight= "25px" > <TextView android:text= "Text" android:layout_height= "wrap_content" android:id= "@+id/textViewGreeting" android:textSize= "30dp" android:layout_gravity= "center" android:layout_width= "wrap_content" /> </LinearLayout>
In the MainViewModel I’ve added a read only string property
using GalaSoft.MvvmLight ; namespace NetStandardDemo.Core.ViewModel { public class MainViewModel : ViewModelBase { public string Greeting => "Hello from .NET Standard!" ; } }
All that’s left to do is hook them up to each other. Start by referencing the Core project from the Android project. Next, we’ll need to add the MVVM Light libs project from NuGet to the Android project so that we can use the included binding framework.
The MainActivity.cs in the Android project is where all the magic will happen. Start by adding some fields and a property for the ViewModel.
private List < Binding > _bindings ; private TextView _textView ; public MainViewModel Vm => App . Locator . Main ;
As you probably can tell, we don’t have anything called App just yet. The App class is where, in XAML based applications, the app starts. It holds a reference to the ViewModelLocator that is used in every binding statement. Since we’re using Xamarin Android and not Xamarin Forms we need some way to get to the ViewModelLocator, this is where the App class comes in. Add a new class to the Core project.
public static class App { private static ViewModelLocator _locator ; public static ViewModelLocator Locator => _locator ?? ( _locator = new ViewModelLocator ()); }
Back in the MainActivity there should be an OnCreate method already there. This is the method that is executed when Android launches this activity (think of an activity as the code behind of a page in Android).
We need to do a few things in this method. First, we instantiate the list of bindings, next we will set the view of this activity to Main.axml, then we need to get a reference to the textview in Main.axml and finally we need to create the binding from the ViewModel’s Greeting property to the textview’s Text property.
protected override void OnCreate ( Bundle bundle ) { base . OnCreate ( bundle ); _bindings = new List < Binding >(); SetContentView ( Resource . Layout . Main ); _textView = FindViewById < TextView >( Resource . Id . textViewGreeting ); var binding = this . SetBinding (() => Vm . Greeting , () => _textView . Text ); _bindings . Add ( binding ); }
SetBinding is an extension method in MVVM Light used to create bindings. The overload we’re using here takes two Func parameters, the source of the binding and the target. The source is the property on the viewmodel, the target is the property of the element. Before we can use the textview in code, we need to have a reference to it. In Android this is done by searching for it by ID in the visual tree. The Activity base class contains the FindViewById method for this.
Finally, we add the newly created binding to the list of bindings. This is done so that the garbage collector won’t accidentally clean up the binding while we still need it.
That should be enough to get things going, the result should look like this:
Conclusion
In this article I’ve shown you how you can use MVVM Light on .NET Standard based projects. This will also work for other libraries that have not yet made the jump to .NET Standard.
Happy coding!
Should you run into an error that says that mscorlib is required, add the .net Core compatibility package from NuGet to your netstandard project.
Thanks for pointing it out Hermit! |
Cocoa Powder
Cocoa powder comes from cocoa beans that grow in pods on the cacao tree. shrihtrading.com offers a selection of high-quality Cocoa Powder that can be used as ingredients for many different applications.
Call for price +91 9768051170 or Email for Price [email protected] |
Since 1985, in various formats, SLANT -- an independent voice based in Richmond's Fan District -- has offered its readers original commentary on politics and popular culture, including cartoons and selected sundries. Warning: Sometimes that means satirical content. All rights are reserved.
Sunday, July 27, 2014
On Rescheduling the Ringing
To: Those who had planned to demonstrate at the Diamond todayFrom: Terry ReaAbout:A Ring Around the Diamond When: The demonstration is now scheduled to surround the Diamond with fun-loving citizens on Sunday, August 3, at 2 p.m. Why: This event will create a picture to illustrate how widespread and passionate the opposition to building a Shockoe Stadium is. That includes those who are calling for saving the Diamond. Maybe some members of City Council will notice it.
Explanation for rescheduling: When considering moving the time of the event, from today to next Sunday, I wasn’t happy about doing anything to sidetrack the momentum that had gathered. It surely went against my show biz background to not defiantly say, “The show must go on as scheduled, come hell or high water.”
But at 10 a.m. this morning, the Weather Channel said Richmond had a 75 percent chance of having rain falling at 2 p.m. and at 3 p.m. The grizzled promoter in me knew then we would be facing a greatly diminished turnout, if we went ahead with the original time, even if the weather surprisingly turned out sunny. So, like it or not, in my view it had to rescheduled. As I was the one who had established the event page on Facebook, I took the responsibility to make the call.
Of course, we now know the weather defied predictions and did turn out to be beautiful. That's life.
However, the purpose of the stunt in the first place was not to facilitate the building of an organization. No, it was to demonstrate for all to see how varied and substantial the opposition to the mayor’s plan to build a baseball stadium in Shockoe Bottom is.
That’s because some of us want to protect a historically significant
neighborhood. Others prefer pro baseball to stay put. Some of us want
the city to spend more on schools and infrastructure and less on
spectator sports. Others just don’t believe baseball in the Bottom is a
good investment.
It was conceived as a way for the unorganized opposition, neighbors with different reasons to be there, to say as one -- we’re standing on common ground to encircle the Diamond.This event was not designed to launch a freestanding political organization. So driven by the thinking that by pressing on today it would foster camaraderie, didn’t fit our mission.
This morning at 10 a.m. we had to recognize that no matter how the weather turned out four hours later -- based on the forecast of a 75 percent likelihood of rain -- too many folks had already made plans to do something else. Which meant that by going on with the stunt today, as originally planned, we would have been setting ourselves up to underachieve dramatically -- probably with the media there to report that the event was a fizzler.
Now we have a whole week to make this bump in the road work in our favor. Moreover, let’s use this extra time to invite more people to ensure that next Sunday we do encircle the Diamond with thousands of folks who will go home afterward, happy to say:
“Rather than just complain, we did something. We went out to the Boulevard to march on the sidewalk around the ballpark with a bunch of civic-minded folks. We saw some funny signs. We ran into some old friends and met some new friends. All in all, we did no harm and we had a good time.” |
###
# Do not use this file to override the deploy cookbook's default
# attributes. Instead, please use the customize.rb attributes file,
# which will keep your adjustments separate from the AWS OpsWorks
# codebase and make it easier to upgrade.
#
# However, you should not edit customize.rb directly. Instead, create
# "deploy/attributes/customize.rb" in your cookbook repository and
# put the overrides in YOUR customize.rb file.
#
# Do NOT create an 'deploy/attributes/default.rb' in your cookbooks. Doing so
# would completely override this file and might cause upgrade issues.
#
# See also: http://docs.aws.amazon.com/opsworks/latest/userguide/customizing.html
###
include_attribute "deploy::deploy"
include_attribute "deploy::customize"
|
[[["Patient" "name=ivan"]
{:query "Patient"
:where (and (param {:resourceType "Patient" :name "name"} {:value "ivan"}))}]
[["Patient" "name=ivan,nicola"]
{:query "Patient"
:where (and
(or
(param {:resourceType "Patient" :name "name"} {:value "ivan"})
(param {:resourceType "Patient" :name "name"} {:value "nicola"})))}]
[["Patient" "_page=12"]
{:query "Patient" :page 12}
]
[["Patient" "name:exact=ivan"]
{:query "Patient"
:where (and (param {:resourceType "Patient" :name "name" :modifier "exact"} {:value "ivan"}))}]
[["Patient" "birthdate=lt1980"]
{:query "Patient"
:where (and
(param {:resourceType "Patient" :name "birthdate"} {:value "1980" :prefix "lt"}))}
]
[["Patient" "_count=11"]
{:query "Patient" :count 11}]
[["Patient" "_totalMethod=exact"]
{:query "Patient" :total_method "exact"}]
[["Patient" "_totalMethod=no"]
{:query "Patient" :total_method "no"}]
[["Patient" "_totalMethod=estimated"]
{:query "Patient" :total_method "estimated"}]
[["Patient" "_page=12"]
{:query "Patient" :page 12}]
[["Patient" "careprovider:Practitioner.name=igor"]
{:query "Patient"
:joins [(chained
(param {:resourceType "Patient" :name "careprovider" :join "Practitioner"} {:value "$id"})
(param {:resourceType "Practitioner" :name "name"} {:value "igor"}))]}]
[["Patient" "careprovider:Practitioner.organization:Organization.name=hl7"]
{:query "Patient"
:joins [(chained
(param {:resourceType "Patient" :name "careprovider" :join "Practitioner"} {:value "$id"})
(param {:resourceType "Practitioner" :name "organization" :join "Organization"} {:value "$id"})
(param {:resourceType "Organization" :name "name"} {:value "hl7"}))]}]
[["Patient" "_sort:desc=name"]
{:query "Patient"
:sort [(param {:resourceType "Patient" :name "name" :modifier "desc"} {:value ""})]}]
[["Patient" "name=a%20b"]
{:query "Patient"
:where (and
(param {:resourceType "Patient" :name "name"} {:value "a b"}))}]
[["Encounter" "_include=patient"]
{:query "Encounter"
:include [(param {:resourceType "Encounter" :name "patient"} {:value "placeholder"})]}]
[["Encounter" "_include=Encounter:patient"]
{:query "Encounter"
:include [(param {:resourceType "Encounter" :name "patient"} {:value "placeholder"})]}]
[["Encounter" "_include=Encounter:patient:Patient"]
{:query "Encounter"
:include [(param {:resourceType "Encounter" :name "patient" :target "Patient"} {:value "placeholder"})]}]
[["Encounter" "_include=Encounter:patient:Patient,Encounter:organization:Organization"]
{:query "Encounter"
:include [(param {:resourceType "Encounter" :name "patient" :target "Patient"} {:value "placeholder"})
(param {:resourceType "Encounter" :name "organization" :target "Organization"} {:value "placeholder"})]}]
[["Encounter" "_include=Encounter:patient:Patient&_include=Encounter:organization:Organization"]
{:query "Encounter"
:include [(param {:resourceType "Encounter" :name "patient" :target "Patient"} {:value "placeholder"})
(param {:resourceType "Encounter" :name "organization" :target "Organization"} {:value "placeholder"})]}]
[["Patient" "_revinclude=Encounter:patient"]
{:query "Patient"
:revinclude [(param {:resourceType "Encounter" :name "patient" :target "Patient"} {:value "placeholder"})]}]
[["Encounter" "_revinclude=Encounter:patient:Patient&_revinclude=Encounter:organization:Organization"]
{:query "Encounter"
:revinclude [(param {:resourceType "Encounter" :name "patient" :target "Patient"} {:value "placeholder"})
(param {:resourceType "Encounter" :name "organization" :target "Organization"} {:value "placeholder"})]}]
[["Patient" "_elements=name,birthdate"]
{:query "Patient"
:elements ["name", "birthdate"]}]
[["Patient" "_summary=true"]
{:query "Patient" :summary true}]]
|
Domino's Ends Free Pizza for Life Deal After Too Many People Got Tattoos of Their Logo
Domino’s has some die-hard fans—maybe a little too many.
The pizza chain reportedly ended an offer taking place in Russia, which promised to grant people 100 free pizzas every year for 100 years if they got the logo tattooed in a “prominent place” on their body, according to Fox News.
Get push notifications with news, features and more.
The “unprecedented” promotion was intended to run from August 31 through October 31, but so many people shared their tattoos on social media that they had to end it after only five days.
While some people had the logo displayed on their forearm, others opted for their shin or wrist. The fans got creative with their body art by incorporating the red and blue design into slices of pizza, hearts and in one instance, a skateboard.
Although they ceased the deal, the first 350 people who were brave enough to get permanent ink for free pizza will still be awarded their lifetime supply.
RELATED VIDEO: The Secret to Homemade Stuffed Crust Pizza Is Probably in Your Refrigerator Right Now |
Q:
Plural of "roof"?
Roofs is generally used, but is rooves archaic or just wrong?
A:
Rooves is not wrong per se, but extremely uncommon nowadays. Here are the stats from the Corpus of Contemporary American English and the British National Corpus:
COCA BNC
roofs 2307 653
rooves 1 5
The Corpus of Historical American English has 6 cites for rooves, one from 1890, two from 1930, two from 1950, and one from 1980.
Merriam-Webster doesn't even mention rooves at all. The Collins English Dictionary mentions the pronunciation /ruːvz/, but not the spelling rooves. Finally, Wiktionary has these usage notes:
The plural rooves is uncommon and is usually considered incorrect.
So if you want to be on the safe side, I would recommend going with roofs, especially if your audience is American.
A:
Rooves as a plural for of roof is dated, but not incorrect. The Oxford English Dictionary lists “rooves” as an alternate to roofs, one of several outdated spellings used in the UK, and in New England as late as the 19th century.
A:
It's not stated which source Google Dictionary used but they list both roofs and rooves as correct.
|
L&M buys building on Howard Street formerly occupied by Pfizer
New London — Lawrence & Memorial Hospital will be relocating physicians currently clustered along Montauk Avenue and in the Shaw’s Cove complex to a 48,000-square-foot office building on Howard Street it purchased last week for $2.5 million.
The move of L&M physicians and some outpatient services to the vacant building at 194 Howard St. likely will not be completed until sometime early in 2014 after extensive renovations, hospital spokesman Michael O’Farrell said Thursday. L&M purchased the building, previously leased by Pfizer Inc., June 7 from downtown developer Peter Levine, doing business as Amber Howard Associates LLC of New Rochelle, N.Y.
“This is a very good sign for the economic development of the city,” Mayor Daryl Justin Finizio said in a phone interview.
Finizio said L&M’s move should help bolster efforts to promote development of the nearby Fort Trumbull area. The hospital is the region’s largest employer of New London residents, he added.
The sale of the Howard Street property for use as a medical office building brought the city $12,500 in conveyance taxes. Levine bought the building in June 1998 for $1.3 million, according to city records.
“I’m happy to have sold the building,” Levine said in a phone interview.
The building, which brings in about $105,000 in taxes to the city annually, had been on the market for sale or lease for nearly a year after Pfizer vacated the site as part of a global downsizing. It is not clear whether the property would be subject to taxation under the ownership of L&M, a nonprofit entity.
The purchase comes at a time of rapid expansion at L&M, which plans to open a new cancer treatment center in Waterford in partnership with the Dana-Farber Cancer Institute. L&M has also announced the formation of a Yale-New Haven Heart and Vascular Care Center and has added hours to its emergency pediatric services. L&M also just announced its intent to purchase of The Westerly Hospital for $69 million.
L&M currently leases a row of old houses on Montauk Avenue for use by its physicians — many of whom have occupied the buildings for decades — but would give up the properties as its doctors complete a move to renovated office space half a mile away, O’Farrell said. Surgeons at the Shaw’s Cove complex at the corner of Bank and Howard streets and physicians at L&M’s main campus would be moved to the renovated medical building as well, he said.
“The building would help us leverage operational efficiencies,” O’Farrell said. “It would also be a recruitment tool for new physicians.”
O’Farrell had no estimate on the cost of the renovations but allowed that it would be considerable.
The move is expected to “decompress” activities on the main hospital campus between Montauk and Ocean avenues, he said, clearing out about 16,000 square feet of space. Exactly which hospital functions will be moved to the Howard Street offices has not yet been determined, O’Farrell added.
The logistics of moving physicians to new quarters are being handled in-house, he said. The architect for the medical building, O’Farrell added, will be TRO Jung/Brannen of Boston. |
Students
Left, ultra-Left sweep JU elections, ABVP 2nd in Engineering
Published:21 February 2020
Radical Left group Democratic Students Federation retained all the four office bearers' post in the Engineering faculty, while 'We the Independent' (WTI) - a consolidation of pro-Maoist and other extreme Left groups - kept intact their hegemony in the science section.
Kolkata | Ultra-left and Left organisations swept the students union elections in the Jadavpur University where the vote count was held on Thursday.
Contesting for the first time, the Akhil Bharatiya Vidyarthi Parishad (AVBP), student wing of Rashtriya Swayamsevak Sangh (RSS), finished second in the Engineering faculty ahead of the Students Federation of India.
Radical Left group Democratic Students Federation retained all the four office bearers' post in the Engineering faculty, while 'We the Independent' (WTI) - a consolidation of pro-Maoist and other extreme Left groups - kept intact their hegemony in the science section.
The SFI, student wing of the Communist Party of India-Marxist (CPI-M) maintained its hold over the Arts faculty, winning all the foir office-bearer seats after a close fight with the Democratic Students Association - an extreme left group.
The ABVP trailed behind the DSF by a huge margin in the Engineering faculty, even though it finished second. The SFI took the third spot.
In the contest for the general secretary's post, the DSF got 3.320 votes, while ABVP bagged 523. In assistant general secretary (Salt Lake) and assistant general secretary (day) the DSF candidates secured 605 and 2.376 votes respectively, as against 147 and 376 votes which went to the ABVP.
The Trinamool Congress Chhatra Parishad (TMCP), affiliate of the state's ruling Trinamool Congress, fared poorly in each of the three faculties.
However, the ABVP failed to make any mark in the Arts faculty.
The union elections were held peacefully after a three-year break on Wednesday.
The elections were held for posts of 12 office bearers as also over 600 class representatives. However, majority of the posts went uncontested.
The humanities faculty has highest number of students - over 4,000. There are 2,000 students in the science faculty and 700 in the engineering faculty.
The ABVP fielded candidates for nine out of 12 office bearers of the union, adding a fresh dimension to the polls. |
# Settings related to the MongoDB variant of an OpenShift auth plugin
# The host:port for your MongoDB server
MONGO_HOST_PORT="localhost:27017"
# The user to connect to your MongoDB
MONGO_USER="openshift"
# The password to connect to your MongoDB
MONGO_PASSWORD="mooo"
# The database within your MongoDB to use for auth
MONGO_DB="openshift_broker_dev"
|
Background
==========
Herpes simplex virus type-1 (HSV-1) virions consist of an inner core with linear, double-stranded DNA that is enclosed in a capsid; an outer envelope containing various glycoproteins covers tegument proteins, which are exterior to the viral capsid \[[@B1],[@B2]\].
The lytic infection cycle of HSV-1 begins with adsorption: when the virion first attaches to, then fuses with a host cell. Both attachment and penetration take place when viral glycoproteins bind to suitable receptors on the plasma membrane of the host cell. The presence of the receptors determines the tropism of HSV-1 and places a limit on the types of cells to which it is capable of attaching, and thus, infecting \[[@B3]-[@B5]\]. Green, oolong, and black teas are produced from the same plant, *Camellia sinensis*. While the main type of flavanol in green tea extract is the catechin, that in BTE is the theaflavin, a dimer of different catechins, which includes: theaflavin (TF-1), theaflavin-3-monogallate (TF-2A), theaflavin-3\'-monogallate (TF-2B) and theaflavin-3,3\'-digallate (TF-3) \[[@B6],[@B7]\]. Since green tea is not fermented, it contains a relatively high amount of catechins as compared to black tea; fermentation causes the catechins to polymerize, which produces the theaflavins and thearubigens found in black tea, but absent in green tea \[[@B6]\].
The benefits of tea are often attributed to its antioxidant properties, which in turn have been ascribed to catechins, since green tea extract has been found to have more antioxidant activity than black tea extract \[[@B7]\]. However, recent studies have shown that concentrated theaflavin extracts made from black tea can be just as effective as catechins; it is believed that the high number of hydroxyl (OH) groups of theaflavins, which have been shown to protect cells against oxidative damage, is responsible for its antioxidative properties \[[@B8],[@B9]\]. Additionally, it has been found that theaflavins are capable of inhibiting certain types of cancer \[[@B10]\], as well as inhibiting viruses, including bovine rotavirus and bovine coronavirus \[[@B11]\], HIV-1 \[[@B12],[@B13]\], and three different subtypes of influenza strains \[[@B14]\].
While it has been shown that HSV-1 can be inhibited by compounds in green tea extract and a variety of other polyphenolic compounds \[[@B15]\], the purpose of this study was to determine if black tea extract with a concentrated amount of theaflavins (≥ 80%) (BTE) could also inhibit HSV-1. Since theaflavins in BTE are composed of a dimer structure formed from catechin monomers found in green tea, which have been found to inhibit HSV-1 \[[@B15]\], it is reasonable to infer that theaflavins in BTE may also produce similar results based on structural similarities. Despite the fact that theaflavin molecules are larger than catechins, larger polyphenolic compounds such as tannins have been shown to inhibit other viruses \[[@B16],[@B17]\], indicating that the size of the molecule may not necessarily be a factor required for viral inhibition. Rather, the large amount of hydroxyl groups on these polyphenolic compounds seem to be the one common structural component among these various, natural viral inhibitors; thus, BTE, with high concentrations of theaflavins, may be an effective inhibitor of HSV-1.
Methods
=======
Cells
-----
Human epithelial (A549) cells \[American Type Culture Collection (ATCC), Manassas, VA, USA\] were cultured until confluent in 1X Ham\'s F-12K nutrient media, Kaighn\'s modification with 2 mM L-glutamine, supplemented to contain 10% fetal bovine serum (FBS) (Biowest, Miami, FL, USA) and 1 μg/mL gentamicin at 37°C and 5% CO~2~.
Vero cells \[ATCC (Manassas, VA)\] were cultured until confluent in Dulbecco Modified Eagle Medium (DMEM) with 5% FBS and 1μg/mL gentamicin at 37°C and 5% CO~2~.
HSV-1 UL-46 virus maintenance
-----------------------------
A recombinant strain of HSV-1, GHSV-UL46, which contains the sequence for green fluorescent protein (GFP) fused to the tegument protein pUL46, was used for all experiments \[[@B18]\] (ATCC, Manassas, VA, USA). Passage of virus was performed in T-25 flasks and cells were allowed to reach complete cytopathic effect (CPE). The media was then collected, centrifuged, and the supernatant containing virus kept in cryogenic vials at −80°C.
Preparation of black Tea extract (BTE)
--------------------------------------
Black tea extract ≥ 80% theaflavins (BTE) (10 mg) (Sigma-Aldrich, Saint Louis, MO, USA) was dissolved in 1 mL of 10% FBS-media to produce a stock concentration of 14 mM BTE solution. Ten-fold dilutions (1.4 mM -- 0.014 nM) of stock were stored in microcentrifuge tubes at 4°C.
BTE cytotoxicity
----------------
### Observation of cell morphology
Cell morphology was assessed using an Accu-Scope 3002 microscope by comparing treated and untreated samples. A549 and Vero cells were plated in 6-well plates, grown for 24 h, and then different concentrations of BTE (14 mM to 0.014 nM) were added to the wells. After 1 h the BTE was removed by aspiration and the cells were washed with PBS. Fresh media was added to the wells, and cells were examined at 400X for morphological changes after an additional 48 hour incubation at 37° and 5% CO~2~.
Cell viability assays
---------------------
A549 and Vero cells were plated in 6-well plates, and after 24 hours, different concentrations of BTE were added to each well. After one hour, the BTE was aspirated and the cells were washed with PBS, and cells, including control groups, were incubated with media for 24 hours at 37° and 5% CO~2~. Cells were then stained with trypan blue and counted using a hemocytometer.
Cell proliferation assay
------------------------
A549 and Vero cell suspensions (100 μL) were transferred to separate wells of a 96-well plate. To each well that contained a sample, 10 μL of cell proliferation reagent WST-1 (Roche Diagnostics, Indianapolis, IN, USA) was added; the plate was gently rocked, then placed in an incubator at 37°C and 5% CO~2~ for 30 minutes. The absorbance level for each well was measured at 450 nm in a microplate reader.
Viral inhibition
----------------
### Virus inactivation assay
100 μL of BTE solutions were mixed with 100 μL of HSV-1 in microcentrifuge tubes and incubated at 37°C and 5% CO~2~ for 1 hour. Then, 200 μL of each mixture was added to a separate well on a 6-well plate containing Vero cells, from which the media had been aspirated. The plates were incubated at 37°C and 5% CO~2~ for 1 hour and rocked every 15 minutes. After 1 hour, any unabsorbed virus was aspirated and 2.5 mL of 5% FBS-media was added to each well of Vero cells, and incubated at 37°C and 5% CO~2~ for 48 hours; then media from each well was harvested and used to infect fresh monolayers of Vero cells (70 - 80% confluent). Plates were incubated for 48 hours at 37°C and 5% CO~2~ and monitored for cytopathic effect. Virus titers were determined by plaque assays.
Cell-treated extracts
---------------------
A549 and Vero cells were plated in 6-well plates with 2.5 mL of cell suspension added to each well and incubated at 37°C and 5% CO~2~ until 80% confluent. The media was aspirated, and cells in each well were treated with 100 μL of one of the 10 concentrations of BTE solution. Plates were rocked and kept in an incubator at 37°C and 5% CO~2~ for 15 minutes. Unabsorbed solution was aspirated and 100 μL of virus was added to each well. The cells were incubated at 37°C and 5% CO~2~ for 1 hour and rocked every 15 minutes. After 1 hour, any unabsorbed virus was aspirated and 2.5 mL of 10% FBS-media was added to each well. The plates were incubated at 37°C and 5% CO~2~ for 48 hours, then media from each well was harvested and stored at −80°C.
Virus-treated extracts
----------------------
To obtain media with virions from Vero and A549 cells that had been infected with virus particles treated with BTE solutions, 100 μL of undiluted HSV-1 was mixed with 100 μL of BTE solution in a microcentrifuge tube for each of the 10 concentrations of BTE solution. The mixtures remained at room temperature for 15 minutes. Then, 200 μL of each mixture was added to a separate well on a 6-well plate containing A549 and Vero cells, respectively, from which the media had been aspirated. The plates were incubated at 37°C and 5% CO~2~ for 1 hour and rocked every 15 minutes. After 1 hour, any unabsorbed virus was aspirated and 2.5 mL of 10% FBS-media was added to each well of A549 cells, and incubated at 37°C and 5% CO~2~ for 48 hours, then media from each well was harvested and stored at −80°C.
Viral titer determination using plaque assay
--------------------------------------------
Ten-fold serial dilutions of cell-treated and virus-treated extracts of HSV-1 were prepared prior to infection. Confluent A549 and Vero cell monolayers were then infected with different dilutions of 100 μL HSV-1 and allowed to adsorb for 1 hour at 37 °C and 5% CO~2~. Unabsorbed viruses were aspirated, and plates were then overlaid with a nutrient medium-containing agar and incubated at 37°C and 5% CO~2~ for 3 days. Plaques were visualized by staining cells with crystal violet and counting within 50 hours. The plaque assay was carried out in triplicate.
Plaque reduction assay
----------------------
Experimental wells of 6-well plates containing confluent monolayers of A549 and Vero cells were infected with virus suspensions to produce 20--30 plaques per well. After 1 h incubation at 37 °C and 5% CO~2~, unabsorbed virions were aspirated. BTE solution (1.4 mM, 0.14 mM, 14 μM, and 0.14 μM, respectively) was then added to the appropriate wells, followed by nutrient medium-containing agar; the plates were incubated at 37°C and 5% CO~2~ for 3 days. Plaques were counted as described above.
Virus adsorption assay
----------------------
Equal volumes (100 μL) of BTE solution and a virus suspension, containing virus to yield 20--30 plaques per well, were placed in microcentrifuge tubes, and the mixtures were incubated at 37°C for 1 h. The samples were then placed on monolayers of A549 and Vero cells in 6-well plates and the virus was allowed to adsorb in the presence of the extract. Unabsorbed solutions were aspirated, and nutrient medium-containing agar was then added to each of the wells, and the plates were incubated at 37°C and 5% CO~2~ for 3 days. Adsorption efficiency was assessed by counting plaques, as described above.
Virus attachment assay
----------------------
BTE solution was added to wells of 6-well plates containing monolayers of A549 and Vero cells, and the plates were incubated at 4°C for 1 h. Extract solutions were then removed and virus suspensions containing virus to yield 20--30 plaques per well were added to each of the wells. Plates were incubated at 4°C for 2 h to allow attachment, then monolayers were rinsed 3 times with cold PBS; unabsorbed solutions were aspirated. Nutrient medium-containing agar was then added to each of the wells and the plates were incubated at 37°C and 5% CO~2~ for 3 days. Plaques were counted as described above.
Virus penetration assay
-----------------------
Virus suspensions were prepared on ice to produce 20--30 plaques per well on monolayers of A549 and Vero cells in 6-well plates. Virus suspensions were placed on cells, and plates were incubated at 4°C for 2 h to allow attachment. BTE solution was then added to the wells at room temperature and plates were incubated at 37°C for 10 minutes to allow penetration. Unattached virions were then washed off with PBS (pH = 3), and unabsorbed solutions were aspirated. Nutrient medium-containing agar was then added to each of the wells and the plates were incubated at 37°C and 5% CO~2~ for 3 days. Plaques were counted as described above.
Fluorescent microscopy
----------------------
To visualize the effect that the BTE solution had on viral propagation, A549 and Vero cells were plated in 6-well plates. First, 100 μL of GHSV-UL46 was mixed with 100 μL of BTE solution in a microcentrifuge tube. The mixtures remained at room temperature for 15 minutes. Then, 200 μL of each mixture was added to a separate well on a 6-well plate that contained confluent cells. The cells were incubated at 37°C and 5% CO~2~ for 1 hour and rocked every 15 minutes. Any unabsorbed solution was aspirated from the cells and 2.5 mL of FBS-media was added to each well. The plates were incubated at 37°C and 5% CO~2~. Cells were observed with a fluorescent microscope, at 400X magnification every 6 hours post-infection for 24 hours.
DNA extraction and quantification
---------------------------------
DNA was extracted from infected A549 and Vero cells that contained either 10% FBS-media or 5% FBS-media, respectively or equal volumes HSV-1 virus treated in a microcentrifuge tube with either 1.4 mM BTE solution or 10% FBS-media (A549 cells), or one of the following HSV-1/BTE lysates: 0.14 mM, 14 μM, 1.4 μM, and 0.14 μM concentrations (Vero cells). Cells were incubated for 12 hours at 37°C and 5% CO~2~. The DNA from each of the five groups of cells was extracted with the Qiagen DNeasy® Blood & Tissue Kit (Qiagen Sciences, Germantown, MD, USA), following the manufacturer's protocol. To quantify the total amount of DNA in both the extracted DNA and PCR products, a NanoDrop ND-1000 Spectrophotometer with accompanying computer software (NanoDrop Technologies Incorporated, Wilmington, DE, USA) was utilized, following the manufacturer's protocol.
Primer design and polymerase chain reaction (PCR) amplification of viral genes
------------------------------------------------------------------------------
Three sets of primers were designed to prime different regions of the HSV-1 genome based on published sequences: HSV-1 US6 (encoding glycoprotein D), HSV-1 GFP \[[@B19]\], and HSV-1 UL46 (encoding VP11/VP12) genes. The sequence, melting temperature (T~m~) and size of amplicons of forward and reverse primers are listed in Table [1](#T1){ref-type="table"}. DNA (100 ng) extracted from treated HSV-1 infected Vero and A549 cells was added to each PCR reaction. Standard PCR amplification was performed in 25 μL reactions with an initial denaturation at 95°C for 2 minutes followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 1 minute and extension at 72°C for 30 seconds followed by a final extension period at 72°C for 10 minutes. Confirmation of the correct amplicon size was determined by 1% agarose gel electrophoresis and ethidium bromide staining.
######
**The sequence, T**~**m**~**and amplicon size of the designed primers used in PCR**
**Primers** **Target genes** **Nucleotide sequence (5′ to 3′)** **T**~**m**~**(°C)** **Amplicon (nt)**
------------- -------------------------- ------------------------------------ ---------------------- -------------------
gD1F HSV-1 US6 AGACGTCCGGAAACAACCCTACAA 64.6 752
gD1R ACACAATTCCGCAAATGACCAGGG 64.6
GFPF HSV-1 GFP TGACCCTGAAGTTCATCTGCACCA 64.6 717
GFPR AACTCCAGCAGGACCATGTGAT 62.7
VP1F HSV-1 UL46 ACCAAGCCTTGATGCTCAACTCCA 64.6 957
VP1R ACAACACGGTTCCCGAGAGTTTGA 64.6
Results
=======
Black tea extract concentrations up to 14 mM have no significant effect on cell morphology
------------------------------------------------------------------------------------------
A549 and Vero cells were exposed to ten-fold dilutions of BTE, from 14 mM to 0.014 nM. No significant changes in morphology, as determined by phase contrast microscopy, were observed at any tested concentration of BTE in A549 cells (data not shown). However, slight changes in morphology were observed for Vero cells at the highest concentration (data not shown). Vero cells appeared to tolerate 1-hour exposure to BTE up to 1.4 mM (data not shown).
BTE does not reduce cell viability
----------------------------------
The cell viability was quantitatively determined by using trypan blue and hemocytometer direct cell count to detect the effect of BTE on A549 cells (Figure [1](#F1){ref-type="fig"}). The viability of the BTE-treated cells was similar to the positive control group treated with 10% FBS-media. As the concentration of BTE increased, the percentage of cell death did not increase. The tested concentrations of BTE, from 14 mM to 0.014 nM, did not appear to be cytotoxic to A549 cells. One unexplained deviation from the group was the 14 mM BTE, which had a significantly higher percentage of live cells compared to any other group; these results were comparable for Vero cells (data not shown). This BTE concentration, therefore, was not used in the inhibition studies.
{#F1}
Cell proliferation and viability assay indicates that BTE is not toxic to A549 and Vero cells
---------------------------------------------------------------------------------------------
To confirm the findings established by the trypan blue assay, an assay using WST-1 reagent was conducted. In this assay, only live cells can reduce WST-1, which is light red, to formazan, which is dark red; thus, the higher absorbance level is indicated by a darker color, which correlates to the number of living cells. Overall, the findings with the WST-1 assay for both A549 cells (Figure [2](#F2){ref-type="fig"}) and Vero cells (data not shown) paralleled those found for the trypan blue assay.
{#F2}
Black tea extracts reduce HSV-1 viral titers
--------------------------------------------
To visually observe the cytopathic effect (CPE) that HSV-1 had on A549 and Vero cells and to determine if BTE could inhibit HSV-1, either by reducing or preventing the observable CPE, treated and untreated cells infected with HSV-1 were observed at 400X magnification using phase contrast microscopy. Clear differences between each group were seen 12 hours and 24 hours post-infection (data not shown).
Plaque assays were conducted to test the effect of BTE on HSV-1. Titers determined by plaque assays of viral extracts in A549 and Vero cells are reported in Table [2](#T2){ref-type="table"}. Treatment with BTE resulted in significantly reduced viral titers, as compared to untreated groups. Treatment of virions with various concentrations of BTE for one hour resulted in significantly reduced viral titers, as compared to untreated virus.
######
Viral titers obtained from HSV-1 infected cultured cells treated with different BTE concentrations
**BTE Concentration** **Viral Titer (PFU/mL)**
----------------------- --------------------------
0 mM 8.0 x 10^6\ a^
2.5 x 10^6\ b^
0.14 μM 4.6 x 10^5\ c^
1.4 μM 3.4 x 10^5\ b^
6.0 x 10^4\ c^
14 μM 3.0 x 10^5\ b^
1.6 x 10^4\ c^
1.4 mM 0 ^a^
2.2 x 10^2\ c^
14 mM 0 ^a,\ c^
^a^ A549 cells ^b^ Vero cells ^c^ 1 hr treatment
Fluorescent microscopy confirms the effectiveness of BTE in inhibiting HSV-1 propagation
----------------------------------------------------------------------------------------
To confirm the findings of phase contrast microcopy and the plaque assay, fluorescent microscopy (400×) was employed to visually examine progeny virions in cells that were exposed to HSV-1 treated with 1.4 mM of BTE. For A549 samples, at 12 hours post-infection, there was a pronounced fluorescence from cells infected with untreated HSV-1 (Figure [3](#F3){ref-type="fig"}A), yet no viral fluorescence was detected from either the control (cells treated with 10% FBS-media) (data not shown) or cells inoculated with HSV-1 treated with BTE (Figure [3](#F3){ref-type="fig"}B). At 24 hours post-infection, there was still a significant amount of fluorescence from cells infected with untreated HSV-1 (Figure [3](#F3){ref-type="fig"}C), but only a small amount of fluorescence from cells inoculated with HSV-1 treated with BTE (Figure [3](#F3){ref-type="fig"}D). For Vero cells infected with untreated HSV-1, there was a significant amount of fluorescence 36 hours post-infection; Vero cells infected with increasingly higher concentrations of BTE showed decreasing levels of fluorescence (Figure [4](#F4){ref-type="fig"}).
{#F3}
{#F4}
PCR amplification of BTE-treated HSV-1 infected A549 and Vero cells indicates that the replication of viral genes for glycoprotein D, GFP, and VP11/12 is reduced following treatment of HSV-1 with higher concentrations of BTE.
To determine if treatment with BTE interfered with the production of viral genomes, PCR was used to compare the relative levels of total DNA produced by infection with BTE-treated and untreated HSV-1. There was approximately a 75% reduction in the concentration of DNA in cells following treatment with 1.4 mM BTE (Table [3](#T3){ref-type="table"}). Gel electrophoresis of the PCR products from DNA (extracted from HSV-1 infected A549 cells) resulted in visible bands on the gel corresponding to viral genes for glycoprotein D (gD), GFP and pUL46, apparent for untreated HSV-1 and HSV-1 treated with 1.4 mM BTE; however, the former had a higher intensity than the latter (Figure [5](#F5){ref-type="fig"}A). Sequence-specific primers were also used to amplify the viral DNA (extracted from HSV-1 infected Vero cells) encoding viral GFP at 12 hours post-infection for untreated HSV-1 or HSV-1 treated with varying concentrations of BTE (Figure [5](#F5){ref-type="fig"}B). The intensity of viral DNA products obtained after infection with untreated HSV-1 (column 2), was greater than that of HSV-1 treated with 0.14 μM, 1.4 μM, or 0.14 mM BTE (columns 3 -- 5). Subsequent experiments focused on how higher concentrations of BTE affected HSV-1 infectivity.
######
Quantification of DNA from Infected A549 Cells
**A549 Sample** **Total DNA (ng/μL)**
------------------- -----------------------
Mock-Infected 240.7 ± 10.8
Untreated HSV-1 391.7 ± 4.0
BTE Treated HSV-1 278.2 ± 10.2
Values represent ± SD of the average of three samples (data not shown). The concentration of BTE was 1.4 mM.
{#F5}
BTE inhibited viral adsorption in A549 and Vero cells through the combined effects of preventing viral attachment and penetration
---------------------------------------------------------------------------------------------------------------------------------
To determine if treatment with BTE interfered with viral adsorption in A549 and Vero cells, either in part or in whole, four assays were performed and compared to an untreated sample infected by HSV-1. In the plaque reduction assay a slight reduction in plaques was observed in the BTE treated group (Figure [6](#F6){ref-type="fig"}A), possibly due to the inhibitory effects of BTE previously mentioned. The virus adsorption assay (Figure [6](#F6){ref-type="fig"}B) showed a reduced number of plaques in the BTE treated sample, indicating that some part of adsorption was affected. Two additional assays were performed to further assess which aspect of viral adsorption was affected. The virus attachment assay displayed a significant reduction in the plaques formed in the BTE treated group (Figure [6](#F6){ref-type="fig"}C), while the penetration assay showed a similar reduction in plaque formation in the BTE treated group (Figure [6](#F6){ref-type="fig"}D).
{#F6}
Discussion
==========
The leading consumed beverage worldwide, after water, is tea. For over 50 centuries, tea has been recognized for its medicinal uses as an herbal treatment of multiple ailments that range from simple indigestion to atherosclerosis \[[@B7],[@B19]\]. Theaflavins, polyphenols found mainly in black teas, are natural antioxidants and viral inhibitors. As such, black tea extracts may be useful in future pharmaceutical developments \[[@B20]\].
One concern for human health is HSV-1. Infections caused by this herpesvirus are estimated to affect anywhere from 45% - 98% of the world population, and up to 40% of these infected individuals are subject to recurrent outbreaks that most often result in infectious lesions and ulcerations of the skin. While treatments, such as the drug acyclovir, are in use today, most rely on the presence of a viral protein, thymidine kinase, to inhibit viral replication; mutant viral strains lacking this enzyme are still infectious but do not respond to the available medications. In addition, current treatments can have detrimental side effects and often require frequent doses that can be expensive \[[@B16],[@B21],[@B22]\]. Thus, alternative, lower cost treatments to HSV-1 infections are necessary to alleviate the symptoms of infected individuals.
Black tea extracts have previously been found to block the production of free radicals and inhibit the growth of cancerous cells, as well as exhibit cytotoxic effects against immortalized cells \[[@B23]\]. The purpose of this study was to assess the antiviral qualities of a black tea extract and determine its lowest inhibitory concentration against HSV-1. This hypothesis stems from the findings that black tea compounds have been shown to inhibit some viruses \[[@B11]-[@B14]\]. In addition, a green tea catechin, EGCG, has already been shown to inhibit HSV-1 \[[@B15],[@B24]\]; it is suggested that this compound binds to glycoproteins on the envelope of the virus, thereby preventing viral entry into the host cell \[[@B24]\]. Since black tea theaflavins are merely polymers of green tea catechins \[[@B6]\], it is possible that the former may also inhibit HSV-1, though through a different mechanism. In addition, the flavanols in black tea may be more stable than those in green tea. Although the stability of green tea catechins is pH dependent, EGCG and EGC were less stable than EC and ECG, regardless of pH \[[@B25]\]. Theaflavins, however, were reported to be more stable at pH 7 than EGC and EGCG \[[@B26]\]. The increased stability of theaflavins at neutral pH could make these black tea compounds a more feasible option for the design of an antiviral therapeutic agent than EGCG.
Inhibition was measured visually, through observations that utilized both phase contrast and fluorescent microscopy, as well as quantitatively, by determining viral titers with the plaque assay method and viral DNA concentrations with samples extracted from infected cells. Phase contrast microscopy and plaque assays demonstrated that BTE significantly inhibited the infectious cycle of HSV-1, consistent with findings of previous studies \[[@B11]-[@B14]\]. These experiments demonstrated that non-cytotoxic concentrations of BTE can effectively inhibit the infectious cycle of HSV-1 in cultured cells. Similarly, treatment with BTE for one hour significantly reduced viral titers but did not inactivate the virions. Fluorescent microscopy revealed that treatment of HSV-1 virions with higher concentrations of BTE interfered with the infectious cycle of the virus in cultured A549 and Vero cells. Specifically, PCR and gel electrophoresis indicated that higher concentrations of viral DNA are produced in untreated HSV-1 infections, as compared to lower viral DNA concentrations from BTE-treated HSV-1. Also, a direct relationship between the increased BTE concentration and reduced intensity of samples containing viral GFP suggests that there is a significant reduction in viral genome replication in BTE-treated HSV-1 infected A549 and Vero cell cultures. Additional plaque assays indicated that both the attachment and penetration processes of HSV-1 adsorption in A549 cells and Vero cells are inhibited by BTE concentrations of 1.4 mM and 14 μM. Experimental results taken a whole indicate that BTE at non-cytotoxic concentrations can inhibit viral propagation by limiting the viral processes of replication and adsorption.
It has been reported that treatment of HSV-1 with TF-3 for 1 h completely inactivated the virus \[[@B27]\]. The effect of treatment of HSV-1 with BTE for 1 h was dose dependent. Our results indicate that the virus is not inactivated following 1 h treatment with BTE; therefore, the action of TF-3 alone may not explain the efficacy of BTE. Treatment with 1.4 mM BTE caused a reduction in the amount of HSV-1 genome synthesized 12 h after infection at this concentration and a lower viral count. BTE has been reported to lack cytotoxic effects on cultured cells, consistent with our findings \[[@B10]\]. Therefore, BTE concentrations up to 1.4 mM can be used to treat cells infected by HSV-1 and study its inhibitory effects. Data presented here indicate that BTE can be safely applied to cells at the concentrations tested. The lower cost of BTE, as compared to pure theaflavins, make it attractive for consideration as a safe and effective as an antiviral agent.
Conclusions
===========
BTE, consisting primarily of theaflavins, at concentrations of 0.14 μM and higher reduce or block the production of infectious HSV-1 virions in cultured A549 and Vero cells, thus inhibiting the infectivity of the virus by interfering in the attachment and penetration, as well as the DNA replication of HSV-1 particles. These findings indicate that BTE enriched with theaflavins has the potential to be developed as a safe therapeutic antiviral agent to prevent the spread of HSV-1.
Competing interests
===================
The authors declare that they have no competing interests.
Authors' contributions
======================
SDA and AC designed the study. SDA supervised AC, SDR, and DT in the laboratory. SDA and AC drafted the manuscript. AC conducted all experiments using A549 cells. SDA, SDR and DT conducted experiments using Vero cells. All authors read and approved the final manuscript.
Pre-publication history
=======================
The pre-publication history for this paper can be accessed here:
<http://www.biomedcentral.com/1472-6882/13/139/prepub>
Acknowledgements
================
This research was funded in part by the Science Honors Innovation Program (SHIP) at Montclair State University.
|
I don't care about how Lil Wayne is doing Because I don't have emotional ties to celebrities who I've never met and who don't even know I exist.
113 shares |
Marketpress - add custom input fields to checkout page
Hi!
My client needs some custom fields added to the checkout process that they require from everyone who buys a certain item on their sites.
Any tips on how would I go about adding these to Marketpress? Is there a way to add them for only certain products or certain categories? If not, then I can just add them as optional fields to the general checkout page.
You can add your form fields there via a plugin, and save the data by tying into thedo_action( 'mp_shipping_process' );
fields. You can save wherever you want, though the easiest is to add it to the $_SESSION['mp_shipping_info'] array and it will be saved to the generated order where it can be retrieved later on.
Ultimately though, these things require developer skills to accomplish and you'll likely want to take a look at seeking developer assistance through the job board.https://premium.wpmudev.org/wpmu-jobs/
How do you rate me?
Thank you for rating your experience!
We’re thrilled to hear you had a great experience with . Would you like to leave a comment about your experience?
Thanks for voting on your experience with , we’d love to get some feedback please.
Ohh no! We’re really sorry to hear you didn’t have a pleasant experience with , we’re always looking at how we can improve and would appreciate you provide some further feedback here please.
Type your feedback here
it's great that you had a positive one. Based on your experience in this ticket would you please be kind enough to rate us externally on: |
Ninger purchased high-quality bond paper from Crane & Company, Dalton, Mass., the company that still makes the paper for the United States Treasury. Then he would cut the paper to the same size as the notes he was copying and place the cut paper in a weak coffee solution. After soaking the paper and placing it dry on top of the real note he was about to counterfeit, he placed both on a sheet of glass.
With both pieces stuck together, Ninger could easily trace the details of the underlying bill. After the bill had been traced, Ninger went over the now-dry bond paper with a camel's hair brush, coloring the bills and even duplicating the look of the blue and red threads embedded in the paper.
Ninger went a step further than most. He would not try to duplicate the intricate details, but would only give the beholder an impression of the intricacy. For instance, the lattice-work on the reverse of the $100 bill's ''watermelon'' designs could not fool a sharp investigator from the Secret Service. But Ninger's work was so good that it usually went undiscovered until reaching the Treasury. Curiously, Ninger omitted any reference to the Bureau of Engraving and Printing on any of his counterfeits.
Ninger was arrested in 1896, after 14 years of success. His error was laying one of his notes on a wet bar before passing it to the saloon-keeper. The bill's new owner noticed that ink was staining his hands and called the police.
Ninger was sentenced to six years imprisonment. But his trial generated controversy. Supporters urged that Ninger be acquitted because his bills were works of art, indeed works of the then-new Impressionism. And the counterfeit bills fetched many more times their face value as collector's items than as currency. Ninger supported that view. |
Subsets and Splits