conversations
listlengths 2
2
|
---|
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Endothelial nitric oxide synthase produces superoxide under physiological conditions leading to hydrogen peroxide (H(2)O(2)) -dependent dilations to acetylcholine in isolated mouse cerebral arteries. The purpose of this study was to investigate whether H(2)O(2) was involved in flow-mediated dilation (FMD).', 'Cerebral arteries were isolated from 12+/-2-week-old C57Bl/6 male mice. FMD (0 to 10 microL/min, 2-microL step increase at constant internal pressure) was induced in vessels preconstricted with phenylephrine (30 micromol/L). Simultaneously to diameter acquisition, H(2)O(2) or nitric oxide production was detected by the fluorescent dyes CMH(2)CFDA or 4,5-diaminofluorescein diacetate, respectively. Results are expressed as mean+/-SEM of 6 to 8 mice.', 'FMD (at 10 microL/min, 25+/-3% of maximal diameter) was prevented (P<0.05) by endothelium removal (6+/-1%) or endothelial nitric oxide synthase inhibition with N-nitro-L-arginine (11+/-1%) but not by the specific nitric oxide scavenger 2-phenyl-4,4,5,5-tetramethyl-imidazoline-1-oxyl3-oxide (24+/-3%). Addition of PEG-catalase and silver diethyl dithio-carbamate (superoxide dismutase inhibitor) reduced (P<0.05) FMD to 10+/-2% and 15+/-1%, respectively. Simultaneously to FMD, H(2)O(2)-associated rise in fluorescence (+133+/-19 a.u.) was prevented by N-nitro-L-arginine, PEG-catalase, and silver diethyl dithio-carbamate (+55+/-10, +64+/-4, and +50+/-10 a.u., respectively; P<0.05). Inhibition of FMD by PEG-catalase was fully restored by the addition of tetrahydrobiopterin, a cofactor of endothelial nitric oxide synthase (23+/-3%); this functional reversal in dilation was associated with the simultaneous increase in nitric oxide-associated fluorescence (+418+/-58 a.u., P<0.05), which was prevented by 2-phenyl-4,4,5,5-tetramethyl-imidazoline-1-oxyl3-oxide (+93+/-26 a.u.). Akt inhibition with triciribine prevented FMD and H(2)O(2)-associated rise in fluorescence (3+/-1% and +23+/-4% a.u., respectively; P<0.05), but not acetylcholine-induced dilation.']\nQuestion: Is flow-induced dilation mediated by Akt-dependent activation of endothelial nitric oxide synthase-derived hydrogen peroxide in mouse cerebral arteries?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Vibrio cholerae is the causative agent of cholera. Extensive studies reveal that complicated regulatory cascades regulate expression of virulence genes, the products of which are required for V. cholerae to colonize and cause disease. In this study, we investigated the expression of the key virulence regulator ToxR under different conditions.', 'We found that compared to that of wild type grown to stationary phase, the toxR expression was lower in an aphB mutant strain. AphB has been previously shown to be a key virulence regulator that is required to activate the expression of tcpP. When expressed constitutively, AphB is able to activate the toxR promoter. Furthermore, gel shift analysis indicates that AphB binds toxR promoter region directly. We also characterize the effect of AphB on the levels of the outer membrane porins OmpT and OmpU, which are known to be regulated by ToxR.']\nQuestion: Does virulence regulator AphB enhance toxR transcription in Vibrio cholerae?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Fatty acid ethyl esters are ethanol metabolites inducing sustained, toxic elevations of the acinar cytosolic free calcium ion concentration ([Ca(2+)](C)) implicated in pancreatitis. We sought to define the mechanisms of this elevation.', 'Isolated mouse pancreatic acinar cells were loaded with fluorescent dyes for confocal microscopy to measure [Ca(2+)](C) (Fluo 4, Fura Red), endoplasmic reticulum calcium ion concentration ([Ca(2+)](ER), Mg Fluo 4), mitochondrial membrane potential (TMRM), ADP:ATP ratio (Mg Green), and NADH autofluorescence in response to palmitoleic acid ethyl ester and palmitoleic acid (10-100 micromol/L). Whole-cell patch clamp was used to measure the calcium-activated chloride current and apply ethanol metabolites and/or ATP intracellularly.', 'Intracellular delivery of ester induced oscillatory increases of [Ca(2+)](C) and calcium-activated currents, inhibited acutely by caffeine (20 mmol/L), but not atropine, indicating involvement of inositol trisphosphate receptor channels. The stronger effect of extracellular ester or acid caused depletion of [Ca(2+)](ER), not prevented by caffeine, but associated with depleted ATP, depleted NADH autofluorescence, and depolarized mitochondria, suggesting calcium-ATPase pump failure because of lack of ATP. Intracellular ATP abolished the sustained rise in [Ca(2+)](C), although oscillatory signals persisted that were prevented by caffeine. Inhibition of ester hydrolysis markedly reduced its calcium-releasing effect and consequent toxicity.']\nQuestion: Do fatty acid ethyl esters cause pancreatic calcium toxicity via inositol trisphosphate receptors and loss of ATP synthesis?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Trophoblasts lack expression of all classic major histocompatibility complex (MHC) antigens. Determination of the mechanism involved could provide insight into selective gene suppression and allograft tolerance. Suppression of class II expression in trophoblasts is secondary to dominant negative trans-acting factors that suppress class II transactivator (CIITA) transcription. We recently described a trophoblast-derived noncoding RNA (TncRNA) that suppresses class II expression. We examined the effects of TncRNA on the CIITA promoter, CIITA, and MHC class II expression.', 'HeLa clones stably transfected with TncRNA were analyzed for MHC class II and CIITA expression by fluorescence-activated cell sorting, Northern blots, and quantitative polymerase chain reaction. Activity and functional dissection of CIITA promoter IV (pIV) was assessed by transient co-transfection of promoter-reporter constructs. Methylation of pIV was assessed by Southern blots, fluorescence-activated cell sorting, and quantitative polymerase chain reaction.', 'TncRNA suppressed interferon-gamma-induced human leukocyte antigen-DR and CIITA expression in HeLa cells. The mechanism involves inhibition of CIITA pIV through a defined inhibitory domain on the promoter. The mechanism does not involve methylation of the promoter.']\nQuestion: Is class II transactivator promoter activity suppressed through regulation by a trophoblast noncoding RNA?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Despite improved survival for the patients with diffuse large B-cell lymphoma (DLBCL), the prognosis after relapse is poor. The aim was to identify molecular events that contribute to relapse and treatment resistance in DLBCL.', 'We analysed 51 prospectively collected pretreatment tumour samples from clinically high risk patients treated in a Nordic phase II study with dose-dense chemoimmunotherapy and central nervous system prophylaxis with high resolution array comparative genomic hybridization (aCGH) and gene expression microarrays. Major finding was validated at the protein level immunohistochemically in a trial specific tissue microarray series of 70, and in an independent validation series of 146 patients.', 'We identified 31 genes whose expression changes were strongly associated with copy number aberrations. In addition, gains of chromosomes 2p15 and 18q12.2 were associated with unfavourable survival. The 2p15 aberration harboured COMMD1 gene, whose expression had a significant adverse prognostic impact on survival. Immunohistochemical analysis of COMMD1 expression in two series confirmed the association of COMMD1 expression with poor prognosis.']\nQuestion: Is deregulation of COMMD1 associated with poor prognosis in diffuse large B-cell lymphoma?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['A retrospective evaluation was oerformed to determine whether the intensity of p53, p21 or p16 expression predicts response to preoperative chemoradiotherapy in locally advanced gastric carcinoma.', 'Thirty-six patients (cT2-4 or N+) were studied. Preoperative treatment consisted of 30-45Gy of radiation with continuous 5-fluorouracil and weekly cisplatin. Expression of p53, p21 and p16 in pretreatment biopsies was assessed by immunohistochemistry. Level of expression was determined from the intensity and extent of staining. Tumor downstaging was defined as a reduction of at least one T-stage level and/or finding of intense tumor regression in histopathologic examination.', 'Seventeen patients responded to chemoradiation: 8 patients had pathologic complete response, 9 patients were downstaged. The multivariate analysis showed no significant influence of p53 (p = 0.76), p21 (p = 0.10) nor p16 (p = 0.70) expression upon tumor response. Response was found in 52% of patients with low, and in 40% of patients with high p53 staining (p = 0.21); in 54% of patients with low, and in 30% of patients with high p21 staining (p = 0.14); and in 48% of patients with low, and in 43% of patients with high p16 staining (p = 0.32).']\nQuestion: Does expression of p53 , p21 and p16 correlate with response to preoperative chemoradiation in gastric carcinoma?\nAnswer:",
"role": "user"
},
{
"content": " no",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Estimation of nutritional needs in burn patients is difficult. In 24 severely burned patients, we measured CO2 production and O2 consumption continuously during their period of mechanical ventilation.', 'Patients with extensive burns were placed on a continuous metabolic monitor (CMM) (Puritan Bennett Co., Kingwood, TX), and metabolic expenditure was recorded each 24 hours. High protein enteral feedings were started within several hours of admission, and administration rates were adjusted to meet daily caloric demands as determined by the CMM. Full-thickness wounds were excised as early as patient condition permitted, and wounds were closed with autograft, allograft, or TransCyte (Advanced Tissue Sciences Inc., La Jolla, CA). Daily 24-hour caloric needs as measured by CMM were compared with baseline caloric needs predicted by the Harris-Benedict equation and also compared with actual daily caloric intake. Patients were removed from study when they were off continuous mechanical ventilation.', 'A total of 24 patients were studied, with a mean age of 46 years and a 44% total body burn size (partial- and full-thickness). All full-thickness burns were completely excised by a mean of 6.5 days postburn. Mean daily energy expenditures remained elevated through the duration of the study period (42 days), with a mean elevation of 184.9% of baseline as predicted by Harris-Benedict equation. Patients received enteral feedings, which met 99.4% of actual caloric needs as predicted by CMM during the study period.']\nQuestion: Do enteral nutritional support and wound excision and closure prevent postburn hypermetabolism as measured by continuous metabolic monitoring?\nAnswer:",
"role": "user"
},
{
"content": " no",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Previous studies have demonstrated that raised preoperative neutrophil to lymphocyte ratio (NLR) is associated with poor prognosis in colorectal cancer (CRC). The aim of this study was to assess whether preoperative NLR could predict patients at risk of recurrence of CRC.', 'All consecutive patients who underwent surgical resection for CRC over a 2-year period at our institution were analysed. Demographic data including CRC recurrence were prospectively collected from our institutional cancer database. CRC recurrence was diagnosed on radiological and endoscopic histopathological data. Preoperative NLR was calculated on baseline blood results, with a value >5 being a poor prognostic factor. Parametric survival analysis was used to identify risk factors for CRC recurrence. Hazard ratios (HRs) were calculated for gender, CRC stage using Jass score, preoperative NLR and CRC site. P < 0.05 was considered statistically significant.', 'In all, 297 patients (157 men) underwent CRC resection at a median age of 70 years (range 23-93); 164 patients had colon cancer, 111 rectal cancer and 22 recto-sigmoid cancer. The distribution by stage of CRC was 30.2% for stage 1, 23.8% for stage 2, 19.5% for stage 3 and 26.5% for stage 4. Over a median follow-up period of 3.35 (0.1-8) years, 59 (19.8%) patients had recurrent CRC. Multivariate analysis revealed CRC stage (HR 8.69, 95% CI 3.85-19.6, P < 0.0001) and NLR >5 (HR 1.81, 95% CI 1.07-3.07, P = 0.028) to be significant and independent risk factors predictive of recurrent CRC.']\nQuestion: Is preoperative neutrophil to lymphocyte ratio > 5 a prognostic factor for recurrent colorectal cancer?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Urinary trypsin inhibitor (UTI) inhibits the inflammatory response and protects against ischemia-reperfusion (I/R) injury. The inflammatory response is mediated by nuclear factor-kappa B (NF-kappaB) and its related target genes and products such as vascular endothelial cell adhesion molecule and CXC chemokines. We aimed to assess the roles of those mediators in a UTI-treated mouse model of hepatic I/R injury.', 'Treatment group 1 (UTI given 5 minutes prior to liver ischemia), treatment group 2 (UTI given 5 minutes after the anhepatic phase) and a control group were investigated. Blood and liver samples were obtained and compared at 1, 3, 6 and 24 hours after reperfusion.', 'Attenuation of pathological hepatocellular damage was greater in the treatment groups than in the control group (P<0.05). Compared with the control group, the UTI treatment groups showed significantly lower serum alanine aminotransferase and aspartate aminotransferase levels, decreased myeloperoxidase activity, and reduced NF-kappaB activation. Also downregulated was the expression of tumor necrosis factor-alpha, cytokine-induced neutrophil chemoattractant, and macrophage inflammatory protein-2 at the mRNA level. P-selectin protein and intercellular adhesion molecule-1 protein expression were also downregulated. In addition, the treatment group 1 showed a better protective effect against I/R injury than the treatment group 2.']\nQuestion: Does urinary trypsin inhibitor attenuate hepatic ischemia-reperfusion injury by reducing nuclear factor-kappa B activation?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['A direct relationship between body mass index (BMI), visceral adipose tissue, insulin levels and growth hormone-binding protein (GHBP) activity has consistently been reported. It was recently described that GHBP directly depends on serum leptin levels. Since leptin co-varies with insulin secretion and/or sensitivity, we aimed to study the influence of these variables on plasma GHBP activity.', 'In order to isolate the effects of obesity per se from those of insulin secretion, three groups of subjects were prospectively studied: 14 lean, 10 obese and nine obese subjects with glucose intolerance.', 'The percentage of body fat was measured through bioelectric impedance. Insulin sensitivity and secretion were determined through a frequently sampled intravenous glucose tolerance test with minimal model analysis. Serum leptin was measured by radioimmunoassay. GHBP activity was determined by the high performance liquid chromatography-gel filtration method.', 'Plasma GHBP activity was found to correlate with BMI (r = 0. 65, P < 0.0001), fat mass (r = 0.51, P = 0.003), waist circumference (r = 0.64, P < 0.0001), waist-to-hip ratio (r = 0.42, P = 0.01), insulin sensitivity (SI, r = - 0.61, P = 0.0001), insulin secretion (expressed as the acute insulin response to intravenous glucose, AIRg) (r = 0.48, P = 0.006) and leptin concentration (r = 0.49, P = 0.004). The associations with SI (r = - 0.42, P = 0.02) and AIRg (r = 0.38, P = 0.03) persisted even after controlling for fat mass. Since insulin secretion and insulin sensitivity usually covary in glucose tolerant subjects (an increased insulin secretion is necessary to compensate a decreased insulin sensitivity), we constructed a multiple linear regression to predict GHBP activity. In this model, SI (P = 0.005), AIRg (P = 0.02) and SD score-leptin (P = 0.03) independently contributed to 34, 10 and 8% of the variability in serum GHBP activity.']\nQuestion: Do insulin sensitivity and secretion influence the relationship between growth hormone-binding-protein and leptin?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Excess childhood weight is associated with cardiovascular disease (CVD) in adulthood. Whether this is mediated through adult body mass index (BMI) and associated risk factors such as metabolic derangements remains unclear. The aim was to examine whether childhood BMI velocity (Δkg\\xa0m(-2) per year) was associated with adult CVD mortality and to examine how adult BMI and cardiometabolic risk factors contribute to the association.', 'Subjects were 1924 Icelanders born between 1921 and 1935 and living in Reykjavik when recruited into a longitudinal study from 1967 to 1991. From ages 8-13 years, BMI velocity was calculated to quantify the association between childhood growth and adult CVD mortality. Deaths from recruitment to 31 December 2009 were extracted from the national register. There were 202 CVD deaths among men and 90 CVD deaths among women (mean follow-up: 25.9 years). Faster BMI velocity from ages 8-13 years was associated with CVD mortality when comparing those in the highest versus lowest tertile with corresponding hazard ratio (HR) (95% confidence interval (CI)): 1.49 (1.03, 2.15) among men and 2.32 (1.32, 4.08) among women after adjustment for mid-life BMI and CVD risk factors. Faster childhood BMI velocity was associated with elevated CVD risk factors among men at mid-life but these associations were less pronounced among women.']\nQuestion: Is faster increase in body mass index between ages 8 and 13 associated with risk factors for cardiovascular morbidity and mortality?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['The tumor suppressor gene PTEN, mutated in 40-50% of patients with brain tumors, especially those with glioblastomas, maps to chromosome 10q23.3 and encodes a dual-specificity phosphatase. PTEN exerts its effects partly via inhibition of protein tyrosine kinase B (Akt/Protein Kinase B), which is involved in the phosphatidylinositol (PtdIns) 3-kinase (PI3K)-mediated cell-survival pathway. The naturally occurring bioflavonoid Quercetin (Qu) shares structural homology with the commercially available selective PI3K inhibitor, LY 294002 (LY). Here, the effects of Qu on the Akt/PKB pathway were evaluated.', 'The human breast carcinoma cell lines, HCC1937, with homozygous deletion of the PTEN gene, and T47D, with intact PTEN, were time-treated with Qu or LY and analyzed for activated levels of Akt by measuring phospho-Akt (p-Akt) levels using immunoblotting analysis. To detect p-Akt, the T47D cells were treated with EGF prior to treatment with or without Qu or LY Cell proliferation after 24-h treatment with Qu or LY was quantified by the 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay.', 'Treatment with Qu (25 microM) for 0.5, 1 and 3 h completely suppressed constitutively activated Akt/PKB phosphorylation at Ser-473 in HCC1937 cells. Pre-exposing T47D cells to Qu (25 microM) or LY (10 microM) abrogated EGF-induced Akt/PKB phosphorylation at Ser-473. Both Qu (100 microM) and LY (50 microM) treatments for 24 h significantly decreased cell proliferation, as shown by the MTT assay.']\nQuestion: Is the antiproliferative effect of Quercetin in cancer cells mediated via inhibition of the PI3K-Akt/PKB pathway?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Inflammation may play a role in the development and progression of many cancers, including prostate cancer. We sought to test whether histological inflammation within prostate cancer was associated with more aggressive disease.', 'The slides of prostatectomy specimens were reviewed by a board-certified pathologist on 287 men from a Veterans Affairs Medical Center treated with radical prostatectomy from 1992 to 2004. The area with the greatest tumor burden was scored in a blinded manner for the degree of inflammation: absent, mild, or marked. We used logistic and Cox proportional hazards regression analysis to examine whether categorically coded inflammation score was associated with adverse pathology and biochemical progression, respectively.', 'No inflammation was found in 49 men (17%), while 153 (53%) and 85 (30%) had mild and marked inflammation. During a median follow-up of 77 months, biochemical recurrence occurred among 126 (44%) men. On multivariate analysis, more inflammation was associated with greater risk of positive margins, capsular penetration, and seminal vesicle invasion (all p < 0.05). Marked inflammation was associated with increased PSA recurrence risk when adjusting for preoperative features only (HR 2.08, 95% CI 1.02-4.24), but not after adjusting for pathologic features.']\nQuestion: Is intratumoral inflammation associated with more aggressive prostate cancer?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['The objective of this study was to examine the associations between baseline electroencephalogram (EEG)-assessed brain oscillations and subsequent response to four neuromodulatory treatments. Based on available research, we hypothesized that baseline theta oscillations would prospectively predict response to hypnotic analgesia. Analyses involving other oscillations and the other treatments (meditation, neurofeedback, and both active and sham transcranial direct current stimulation) were viewed as exploratory, given the lack of previous research examining brain oscillations as predictors of response to these other treatments.', 'Randomized controlled study of single sessions of four neuromodulatory pain treatments and a control procedure.', 'Thirty individuals with spinal cord injury and chronic pain had their EEG recorded before each session of four active treatments (hypnosis, meditation, EEG biofeedback, transcranial direct current stimulation) and a control procedure (sham transcranial direct stimulation).', 'As hypothesized, more presession theta power was associated with greater response to hypnotic analgesia. In exploratory analyses, we found that less baseline alpha power predicted pain reduction with meditation.']\nQuestion: Does baseline brain activity predict response to neuromodulatory pain treatment?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['The mitotic rate is an important prognostic criterion in patients with thin melanoma ≤ 1 mm.', 'The aim of this study was to investigate the reproducibility of the mitotic rate in thin melanoma in hematoxylin-eosin (H&E) stain and compare it with the detection of mitotic figures by immunohistochemistry.', 'The number of mitoses stated in the routine diagnostic report in 190 pT1 melanomas was compared with the number gained from re-evaluation of H&E sections and the number detected after staining with the mitotic marker, phosphohistone H3 (PHH3). Two different approaches were used for choosing the \"hot spot\" for evaluation (dermal vs epidermal/dermal).', 'Comparing routine H&E-stained slides with re-evaluation slides, the number of mitotic figures was slightly variable. However, findings did not result in a change of the tumor stage. In 34% of the tumors with dermal mitotic figures on H&E, mitoses could not be found in the corresponding PHH3 slide anymore. In 4% of the cases, stage relevant mitoses could only be found by PHH3 immunohistochemistry.']\nQuestion: Does detection of mitotic figures in thin melanomas -- immunohistochemistry replace the careful search for mitotic figures in hematoxylin-eosin stain?\nAnswer:",
"role": "user"
},
{
"content": " no",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Aquaporins (AQPs) are the water-channels that play important roles in brain water homeostasis and in cerebral edema induced by brain injury. In this study we investigated the relationship between AQPs and a neuroprotective agent curcumin that was effective in the treatment of brain edema in mice with intracerebral hemorrhage (ICH).', 'ICH was induced in mice by autologous blood infusion. The mice immediately received curcumin (75, 150, 300 mg/kg, ip). The Rotarod test scores, brain water content and brain expression of AQPs were measured post ICH. Cultured primary mouse astrocytes were used for in vitro experiments. The expression of AQP1, AQP4 and AQP9 and NF-κB p65 were detected using Western blotting or immunochemistry staining.', 'Curcumin administration dose-dependently reduced the cerebral edema at d 3 post ICH, and significantly attenuated the neurological deficits at d 5 post ICH. Furthermore, curcumin dose-dependently decreased the gene and protein expression of AQP4 and AQP9, but not AQP1 post ICH. Treatment of the cultured astrocytes with Fe(2+) (10-100 μmol/L) dose-dependently increased the expression and nuclear translocation of NF-κB p65 and the expression of AQP4 and AQP9, which were partly blocked by co-treatment with curcumin (20 μmol/L) or the NF-κB inhibitor PDTC (10 μmol/L).']\nQuestion: Does curcumin attenuate brain edema in mice with intracerebral hemorrhage through inhibition of AQP4 and AQP9 expression?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: [\"Studies have shown that older drivers have high death rates and lower rates of involvement in crashes that kill others; but most studies have not considered drivers' responsibility for their crashes, and many have considered only one particular measure of risk.\", 'This study examines risks that drivers of various ages pose to themselves and to others on per-driver, per-trip, and per-mile bases, taking responsibility for crashes into account, using United States fatal crash data from 1999 through 2003 and travel estimates from 2001.', 'Relative to other age groups, drivers aged 85 and older face the highest risk of their own death, whereas teens pose the greatest risk to passengers, occupants of other vehicles, and non-motorists.']\nQuestion: Do risks older drivers pose to themselves and to other road users?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Genesis of novel gene regulatory modules is largely responsible for morphological and functional evolution. De novo generation of novel cis-regulatory elements (CREs) is much rarer than genomic events that alter existing CREs such as transposition, promoter switching or co-option. Only one case of de novo generation has been reported to date, in fish and without involvement of phenotype alteration. Yet, this event likely occurs in other animals and helps drive genetic/phenotypic variation.', 'Using a porcine model of spontaneous hearing loss not previously characterized we performed gene mapping and mutation screening to determine the genetic foundation of the phenotype. We identified a mutation in the non-regulatory region of the melanocyte-specific promoter of microphthalmia-associated transcription factor (MITF) gene that generated a novel silencer. The consequent elimination of expression of the MITF-M isoform led to early degeneration of the intermediate cells of the cochlear stria vascularis and profound hearing loss, as well as depigmentation, all of which resemble the typical phenotype of Waardenburg syndrome in humans. The mutation exclusively affected MITF-M and no other isoforms. The essential function of Mitf-m in hearing development was further validated using a knock-out mouse model.']\nQuestion: Does a de novo silencer cause elimination of MITF-M expression and profound hearing loss in pigs?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['One stage exchange of a chronically infected total knee arthroplasty (TKA) is recommended in selected cases only. However, there is little evidence regarding the usefulness of selection criteria. The goal of this retrospective study was to compare the results of two concomitant cohorts of patients with chronically infected TKA: one treated with a routine one-stage exchange (study group) and one treated with one-stage exchange in selected cases only (control group). The hypoyhesis tested was that the failure rate and repeat surgery rate were higher in the study group than in the control group.', 'One hundred and thirty one cases were selected: 54 in the study group and 77 in the control group. There were 63 men and 68 women with a mean age of 70years. All patients were followed up for a minimal period of time of two years or until death or recurrence of infection.', 'Twenty five cases had a recurrence of infection: 9/54 in the study group and 16/77 in the control group (NS). The survival rate for being free of infection after four years was 85% in the study group and 78% in the control group (NS). The repeat surgery rate was significantly higher in the control group.']\nQuestion: Does patient selection improve the success rate of infected TKA one stage exchange?\nAnswer:",
"role": "user"
},
{
"content": " no",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['To assess effects of heme on messenger RNA (mRNA) and microRNA (miRNA) profiles of liver cells derived from humans.', 'We exposed human hepatoma cell line Huh-7 cells to excess iron protoporphyrin (heme) (10 μmol/L) or induced heme deficiency by addition of 4, 6-dioxoheptanoic acid (500 μmol/L), a potent inhibitor of aminolevulinic acid dehydratase, for 6 h or 24 h. We harvested total RNA from the cells and performed both mRNA and miRNA array analyses, with use of Affymetrix chips, reagents, and instruments (human genome U133 plus 2.0 and miRNA 2.0 arrays). We assessed changes and their significance and interrelationships with Target Scan, Pathway Studios, and Ingenuity software.', 'Changes in mRNA levels were most numerous and striking at 6 h after heme treatment but were similar and still numerous at 24 h. After 6 h of heme exposure, the increase in heme oxygenase 1 gene expression was 60-fold by mRNA and 88-fold by quantitative reverse transcription-polymerase chain reaction. We found striking changes, especially up-regulation by heme of nuclear erythroid-2 related factor-mediated oxidative stress responses, protein ubiquitination, glucocorticoid signaling, P53 signaling, and changes in RNAs that regulate intermediary metabolism. Fewer mRNAs were down-regulated by heme, and the fold decreases were less exuberant than were the increases. Notable decreases after 24 h of heme exposure were patatin-like phospholipase domain-containing protein 3 (-6.5-fold), neuronal PAS domain protein 2 (-1.93-fold), and protoporphyrinogen oxidase (-1.7-fold).']\nQuestion: Does heme status affect human hepatic messenger RNA and microRNA expression?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['To evaluate associations between polysomnographic variables in obstructive sleep apnea (OSA) and a variety of psychological responses (including depressive symptoms) as assessed by the Minnesota Multiphasic Personality Inventory (MMPI).', 'Cross-sectional.', 'University sleep disorders center.', 'One-hundred seventy eight consecutive clinical OSA patients.', 'Not applicable.', 'Patients completed the MPI prior to overnight diagnostic polysomnography. Fifty-eight percent demonstrated at least one MMPI elevation (mean = 1.8 elevations), with Depression (D) elevated for 32%, Hypochondriasis (Hs) for 30%, and Hysteria (Hy) for 21%. Thirty-eight percent demonstrated two or more elevations, with several variations of Hs-D and Hs-D-Hy configurations evident. \"Conversion V\" profiles were fairly rare, and a large number of miscellaneous configurations occurred once. Significant correlations were detected between several MMPI scale scores and total sleep time, the apnea-hypopnea index (AHI) during REM, and particularly arterial oxygen saturation, even when partialling out variance related to body mass index (BMI). In contract, D scores were not correlated with any polysomnographic parameters. Based upon MMPI configuration, the sample was subdivided into the following seven profile groups: Nonelevated (n = 74); Single D (n = 11); Single non-D (n = 25); Combined D plus (a) HS or HY (n = 7), (b) Hs and Hy (n = 10), or (c) other (n = 29); and Multiple non-D (n = 22). Multivariate analysis controlling for age and gender indicated higher AHI in the Single non-D, Combined D plus other, and Multiple non-D groups, compared to the Single D group. Also, there was lower average oxygen saturation in the Multiple non-D group, compared to Single D, Single non-D, and Nonelevated groups. The Combined D plus HS and/or Hy groups did not differ from each other or from other groups, even when merged. The Multiple non-D findings were unattributable to any specific scale or overall number of elevations.']\nQuestion: Does mMPI correlate of sleep and respiratory disturbance in obstructive sleep apnea?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Evaluate the age-dependency of ciliary beat frequency (CBF) in biopsies after ciliogenesis in culture.', 'Retrospective analysis of CBF and ciliary ultrastructure in biopsies and after ciliogenesis from 203 individuals, aged 3 months to 74 years.', 'All patients with successful culture were included. Ciliogenesis was obtained using the sequential monolayer-suspension culture technique for dissociated nasal epithelial cells. CBF was measured using computerized microscope photometry. Secondary ultrastructural abnormalities were evaluated in transmission electron microscopy.', 'There was no correlation between age and CBF, in either the biopsies (7.0 +/- 2.6 Hz; n = 113) or after ciliogenesis in culture (8.1 +/- 1.3 Hz; n = 203). Even in individuals older than 70 years, CBF was normal in bioptic material (6.7 +/- 1.7 Hz) and after ciliogenesis in culture (7.9 +/- 1.0 Hz). Also, in individuals less than 1 year of age CBF was normal in biopsies as well as after ciliogenesis. CBF correlated inversely with the percentage of secondary ultrastructural abnormalities in the biopsies as seen with transmission electron microscopy: 8.1 +/- 1.8 Hz when ciliary ultrastructure was normal and 3.5 +/- 3.3 Hz in cases of severe secondary ciliary dyskinesia. After ciliogenesis in culture, ciliary ultrastructure was always normal, as was CBF.']\nQuestion: Is nasal ciliary beat frequency age independent?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['The aim of our feasibility study was to examine the acceptability and utility of \"Dance Dance Revolution\" (DDR) (Konami of America, Redwood City, CA)) to increase physical fitness in 8-11-year-old black and Hispanic youth.', 'Twenty-eight 4(th) and 5(th) grade children attending an afterschool program participated. Outcomes included physical activity, physical fitness, use of home DDR, survey of safety and acceptability, anthropometrics, and fasting metabolic profile measured at baseline, 12 weeks, and 30 weeks.', 'At 12 weeks, physical fitness (maximum O2 uptake [VO2max]) increased by 4.9±9.9 percent and was sustained through 30 weeks, when the VO2max was 105.0±9.9 percent (range, 93.0-133.9 percent) of baseline values. Absolute VO2max increased by 2.97±4.99\\u2009mL/kg/minute (95% confidence interval 0.75-5.19, P=0.013). Participants maintained an average of 1.12 hours/day of increased movement to music. Trends suggested increased total moderate-vigorous physical activity, decreased light activity, and a modest increase in sedentary screen time. There were no significant changes in body mass index, fasting lipids, or glucose. Participants and parents approved of the activity.']\nQuestion: Does pilot Study of an Active Screen Time Game correlate with Improved Physical Fitness in Minority Elementary School Youth?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Students with early-starting conduct problems often do poorly in school; they are disproportionately placed in restrictive educational placements outside of mainstream classrooms. Although intended to benefit students, research suggests that restrictive placements may exacerbate the maladjustment of youth with conduct problems. Mixed findings, small samples, and flawed designs limit the utility of existing research.', 'This study examined the impact of restrictive educational placements on three adolescent outcomes (high school noncompletion, conduct disorder, depressive symptoms) in a sample of 861 students with early-starting conduct problems followed longitudinally from kindergarten (age 5-6). Causal modeling with propensity scores was used to adjust for confounding factors associated with restrictive placements. Analyses explored the timing of placement (elementary vs. secondary school) and moderation of impact by initial problem severity.', 'Restrictive educational placement in secondary school (but not in elementary school) was iatrogenic, increasing the risk of high school noncompletion and the severity of adolescent conduct disorder. Negative effects were amplified for students with conduct problem behavior with less cognitive impairment.']\nQuestion: Do restrictive educational placements increase adolescent risks for students with early-starting conduct problems?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['The present study examined the effect of acute administration of endocannabinoid receptor CB1 ligand ∆-9-tetrahydrocannabinol (THC) on intracellular signalling in the brain and retrieval from two different memory systems in the zebrafish (Danio rerio).', 'First, fish were treated with THC and changes in the phosphorylation level of mitogen-activated protein (MAP) kinases Akt and Erk in the brain were determined 1 h after drug treatment. Next, animals of a second group learned in a two-alternative choice paradigm to discriminate between two colours, whereas a third group solved a spatial cognition task in an open-field maze by use of an ego-allocentric strategy. After memory acquisition and consolidation, animals were pharmacologically treated using the treatment regime as in the first group and then tested again for memory retrieval.', 'We found an enhanced Erk but not Akt phosphorylation suggesting that THC treatment specifically activated Erk signalling in the zebrafish telencephalon. While CB1 agonist THC did not affect behavioural performance of animals in the colour discrimination paradigm, spatial memory was significantly impaired. The effect of THC on spatial learning is probably specific, since neither motor activity nor anxiety-related behaviour was influenced by the drug treatment. That indicates a striking influence of the endocannabinoid system (ECS) on spatial cognition in zebrafish.']\nQuestion: Does acute administration of THC impair spatial but not associative memory function in zebrafish?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Routinely available assays of adrenal function measure serum total cortisol (TC) and not the biologically active free cortisol (FC). However, there are few data on FC levels during surgical stress and in response to standard pharmacological tests.', 'Our objective was to evaluate TC and FC levels in different states of physical stress.', 'We conducted a prospective observational study in a university hospital.', 'We measured TC and FC levels in 64 patients: group A, 17 healthy controls without stress; group B, 23 medical patients with moderate stress; and group C, 24 surgical patients undergoing coronary bypass grafting. Cortisol levels in group C were measured basally and at several time points thereafter and were compared with responsivity to a pharmacological dose of ACTH. FC was measured using equilibrium dialysis.', 'In group C patients after extubation, the relative increase above basal FC was higher than the increase in TC levels (399 +/- 266 vs. 247 +/- 132% of initial values, respectively; mean +/- sd; P = 0.02) and then fell more markedly, FC levels falling to 67 +/- 49% and TC levels to 79 +/- 36% (P = 0.04). After ACTH stimulation, TC levels increased to 680 +/- 168 nmol/liter, which was similar to the increase with major stress (811 +/- 268 nmol/liter). In contrast, FC levels increased to 55 +/- 16 nmol/liter after ACTH stimulation but significantly greater with surgical stress to 108 +/- 56 nmol/liter (P < 0.001).']\nQuestion: Does measurement of serum free cortisol show discordant responsivity to stress and dynamic evaluation?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Primary pulmonary hypertension (PPH), resulting from occlusion of small pulmonary arteries, is a devastating condition. Mutations of the bone morphogenetic protein receptor type II gene (BMPR2), a component of the transforming growth factor beta (TGF-beta) family which plays a key role in cell growth, have recently been identified as causing familial PPH. We have searched for BMPR2 gene mutations in sporadic PPH patients to determine whether the same genetic defect underlies the more common form of the disorder.', 'We investigated 50 unrelated patients, with a clinical diagnosis of PPH and no identifiable family history of pulmonary hypertension, by direct sequencing of the entire coding region and intron/exon boundaries of the BMPR2 gene. DNA from available parent pairs (n=5) was used to assess the occurrence of spontaneous (de novo) mutations contributing to sporadic PPH.', 'We found a total of 11 different heterozygous germline mutations of the BMPR2 gene in 13 of the 50 PPH patients studied, including missense (n=3), nonsense (n=3), and frameshift (n=5) mutations each predicted to alter the cell signalling response to specific ligands. Parental analysis showed three occurrences of paternal transmission and two of de novo mutation of the BMPR2 gene in sporadic PPH.']\nQuestion: Is sporadic primary pulmonary hypertension associated with germline mutations of the gene encoding BMPR-II , a receptor member of the TGF-beta family?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['The overall survival of patients with hepatocellular carcinoma (HCC) remains poor, and the molecular mechanisms underlying HCC progression and aggressiveness are unclear. Here, we report that increased expression of p28(GANK) (Gankyrin, PSMD10, or p28) in human HCC predicts poor survival and disease recurrence after surgery. Patients with HCC who have large tumors, with vascular invasion and intrahepatic or distant metastasis, expressed high levels of p28(GANK) . Invasive tumors overexpressing p28(GANK) were featured by active epithelial-mesenchymal transition (EMT), and exhibited increased angiogenesis associated with vascular endothelial growth factor overexpression, whereas silencing p28(GANK) expression attenuated EMT and motility/invasion of tumor cells. The p28(GANK) activates phosphoinositide 3-kinase (PI3K)-V-akt Murine Thymoma Viral Oncogene Homolog (AKT)-hypoxia-inducible factor 1α (HIF-1α) signaling to promote TWIST1, vascular endothelial growth factor, and metalloproteinase 2 expression. Suppression of the PI3K-AKT-HIF-1α pathway interfered with p28(GANK) -mediated EMT and invasion. Consistently, we detected a significant correlation between p28(GANK) expression and p-AKT levels in a cohort of HCC biopsies, and the combination of these two parameters is a more powerful predictor of poor prognosis.']\nQuestion: Does p28GANK overexpression accelerate hepatocellular carcinoma invasiveness and metastasis via phosphoinositol 3-kinase/AKT/hypoxia-inducible factor-1α pathways?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['To analyze the structure, specificity, and in vivo pathogenetic potential of 2 human anticardiolipin (aCL) monoclonal antibodies (MAb).', 'Human aCL IgG MAb were generated from hybridized Epstein-Barr virus-induced B cell lines from a healthy subject (MAb 519) and from a patient with primary antiphospholipid syndrome (MAb 516). Studies of antigen-binding specificity and analysis of Ig V-gene mutations were carried out. The MAb were independently injected into mated female BALB/c mice, and their effect on pregnancy outcome was compared with that of MAb 57, a highly mutated and antigen-selected human IgG1lambda rabies virus antibody.', 'Both MAb 519 and MAb 516 utilized minimally mutated V(H)DJ(H) and VkappaJkappa gene segments and bound cardiolipin and other anionic phospholipids in the absence of beta2-glycoprotein I (beta2-GPI). The mice injected with aCL MAb displayed a significantly higher rate of fetal resorption and a significant reduction in fetal and placental weight as compared with those injected with MAb 57. These findings were accompanied by a finding of placental human IgG deposition and necrosis in the aCL MAb-treated animals.']\nQuestion: Do human anticardiolipin monoclonal autoantibodies cause placental necrosis and fetal loss in BALB/c mice?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Mesenchymal progenitor cells (MPCs) are found in articular cartilage from normal controls and patients with osteoarthritis (OA). Nevertheless, the molecular mechanisms of the proliferation and differentiation of these cells remain unclear. In this study, we aimed to determine the involvement of Wnt/β-catenin signaling in regulating the proliferation and differentiation of MPCs.', 'MPCs were isolated from the articular cartilage of normal and OA patients. Cells were sorted by immunomagnetic cell separation. Cell proliferation capacity was evaluated using the MTT assay. Toluidine blue staining and immunostaining with anti-collagen II or anti-aggrecan antibodies were used to determine the chondrogenic differentiation capabilities of MPCs. The mRNA and protein expression of target genes were examined by quantitative real-time polymerase chain reaction and Western blotting, respectively. Knock-down of p53 expression was achieved with RNA interference.', 'Most cells isolated from the normal and OA patients were CD105(+) and CD166(+) positive (Normal subjects: CD105(+)/CD166(+), 94.6% ± 1.1%; OA: CD105(+)/CD166(+), 93.5% ± 1.1%). MPCs derived from OA subjects exhibited decreased differentiation capabilities and enhanced Wnt/β-catenin activity. Inhibition of Wnt/β-catenin signaling promoted proliferation and differentiation, whereas activation of this pathway by treatment with rWnt3a protein decreased the proliferation and differentiation of normal MPCs. Additionally, Wnt/β-catenin signaling positively regulated p53 expression, and silencing of p53 increased proliferation and differentiation of MPCs.']\nQuestion: Does wnt/β-catenin signaling regulate the proliferation and differentiation of mesenchymal progenitor cells through the p53 pathway?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['To evaluate the potential role of Nimesulide, a selective COX-2 inhibitor, in proliferation and apoptosis of gastric adenocarcinoma cells SGC7901.', 'Cell counts and MTT assay were used to quantify the influence of Nimesulide in the proliferation of SGC7901 cells. Transmission electron microscopy and flow cytometry were used to observe the induction of Nimesulide the apoptosis of SGC7901 cells and influence in the distribution of cell cycle. The expression of P27(kip1) protein was observed by immunocytochemical staining.', 'SGC-7901 Cells treated with Nimesulide at various concentrations exhibited a profound dose- and time-dependent reduction in the proliferation rate over the 72 h test period. The highest survival rate of the cells was 78.7 %, but the lowest being 22.7 %. Nimesulide induced apoptosis of the cells in a dose-dependent and non-linear manner and increased the proportion of cells in the G(0)/G(1) phase and decreased the proportion in the S and G(2)/M phase of the cell cycle. Meanwhile, Nimesulide could up-regulate the expression of P27(kip1) protein.']\nQuestion: Does nimesulide inhibit proliferation via induction of apoptosis and cell cycle arrest in human gastric adenocarcinoma cell line?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: [\"Parkinson's disease, affecting at least 1% of population older than 65 years, is the most common neurodegenerative movement disorder. Up to now, no evidence has demonstrated that biochemical changes in CSF occur preceding the onset of Parkinson's symptoms. In this study, we tested the hypothesis that biochemical changes in CSF precede behavioral deficits in Parkinsonian animals.\", \"We infused different doses of 6-OHDA into the MFB of rats bilaterally and examined the animals' movement behaviors, biochemical alterations in CSF, and dopaminergic neuronal number in the SNpc 1 week later.\", 'Our results indicated that animals with over 70% dopaminergic neuronal loss in the SNpc exhibited behavioral bradykinesia and rigidity, and a decrease of HVA in CSF. In contrast, animals with about 42% dopaminergic neuronal loss in the SNpc showed normal movement behaviors, but displayed a drastic decline of HVA in CSF. Furthermore, the number of dopaminergic neurons in the SNpc was positively correlated with the HVA level in CSF.']\nQuestion: Does biochemical alteration in cerebrospinal fluid precede behavioral deficits in Parkinsonian rats induced by 6-hydroxydopamine?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['We previously demonstrated that the lifespan of primary human keratinocytes could be extended indefinitely by culture in the presence of the Rho kinase (ROCK) inhibitor Y-27632. This technique has proven to be very useful in diverse areas of basic and clinical research.', 'In this follow-up study we determine whether the continual presence of Y-27632 is required for sustained proliferation. We also test whether different ROCK inhibitors can be used for this technique and whether it can also promote indefinite proliferation of animal keratinocytes. We measure keratinocyte gene expression, proliferation, behaviour and lifespan in the presence and absence of Y-27632.', 'We demonstrate that the extension of lifespan observed by culture of keratinocytes in the presence of fibroblast feeders and a ROCK inhibitor is reversible and that cells senesce gradually when the inhibitor is removed from the medium. Conversely, keratinocytes that are close to the end of their replicative life span can be revived by ROCK inhibition. We demonstrate that different inhibitors of ROCK can also efficiently extend the lifespan of human keratinocytes and that ROCK inhibition extends the lifespan of animal keratinocytes derived from mouse and bovine epithelia. Gene expression analysis of human epidermal keratinocytes cells grown in the presence of Y-27632 demonstrates that ROCK inhibition primarily inhibits keratinocyte differentiation. Live-imaging of keratinocytes cultured with ROCK inhibitors show that the effect of ROCK inhibition on cellular proliferation is immediate and ROCK inhibited cells proliferate rapidly without differentiation or stratification.']\nQuestion: Is the effect of Rho kinase inhibition on long-term keratinocyte proliferation rapid and conditional?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['The CC chemokine ligand-20 (CCL-20)/macrophage inflammatory protein-3α has been seen as one of the most important chemokines and played a key role in atherogenesis, but the mechanism that underlies the regulation of CCL-20 has not been established clearly yet. The aim of this study was to investigate the influence of salvianolic acid A (SAA) on the expression of CCL-20 in macrophages and ApoE-deficient (ApoE) mice.', 'The expression of CCL-20 was detected both at protein and messenger RNA levels in RAW264.7 cells. We validated the result in ApoE mice that were intraperitoneally injected with SAA. Phosphorylation of p38 mitogen-activated protein kinase was detected with Western blot, and inhibitor of p38 was used to investigate the mechanism of regulation of CCL-20. Hematoxylin and eosin and Oil-Red-O staining were used to evaluate the atherosclerotic lesions and lipid accumulation in ApoE mice. Immunohistochemical analysis was used to detect the expressions of CCL-20 and CCR6 in the atherosclerotic lesions. Immunofluorescent analysis was used to certify the origination of CCL-20.', 'Recombinant tumor necrosis factor-α (TNF-α) upregulated CCL-20 production in dose- and time-dependent manners in RAW264.7 cells. The activity of TNF-α-induced CCL-20 production seemed to be significantly suppressed by SAA. Using p38 mitogen-activated protein kinase inhibitor, we found that p38 mediated the effects of TNF-α- and SAA-induced CCL-20 expression changes. In addition, immunohistochemical analysis of aortic root of ApoE mice also demonstrated that the expressions of CCL-20 and CCR6 were both downregulated significantly with SAA treatment. Furthermore, treatment of SAA inhibited the progression of the atherosclerotic plaques and lipid accumulation.']\nQuestion: Does salvianolic acid A suppress CCL-20 expression in TNF-α-treated macrophages and ApoE-deficient mice?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Hepatocellular carcinoma (HCC) <2 cm in diameter has a favorable prognosis. Therefore surgical resection of small HCC is associated with good outcomes. However, the predisposing factors of prognosis following resection of HCC remain ill-defined. The aims of the present study were to identify the clinicopathologic characteristics and outcomes of patients with small HCC and analyze the predisposing factors for tumor recurrence after surgery.', 'We retrospectively reviewed 180 patients with small HCC who underwent hepatectomy between 2006 and 2010. Independent predictors of tumor recurrence were identified with Cox regression analysis.', 'The 1-year, 3-year, and 5-year disease-free survival rates and overall survival rates were 83.7, 68.0, 65.3, and 98.9, 96.5, 92.7 %, respectively. Multivariate analysis reported that protein induced by the vitamin K antagonist-II (PIVKA-II) ≥ 200 mAU/mL, alkaline phosphatase (ALP) ≥ 80 IU/mL, and microvascular invasion were important predisposing factors for tumor recurrence. Elevated serum PIVKA-II level was associated with microvascular invasion in small HCC, which was a powerful predisposing factor.']\nQuestion: Is protein induced by vitamin K antagonist-II ( PIVKA-II ) a reliable prognostic factor in small hepatocellular carcinoma?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Atherosclerosis is the underlying cause of the majority of myocardial infarctions and ischemic strokes. Carotid intima-media thickness (IMT) is a surrogate measure of atherosclerotic cardiovascular disease. Left ventricular (LV) function can be accurately assessed by 2D speckle-tracking strain echocardiography (2D-STE). The aim of this study was to assess the relationship between carotid IMT and LV dysfunction assessed by strain echocardiography in patients with coronary artery disease (CAD).', 'Thirty-one patients with symptoms of CAD were examined with coronary angiography, cardiac echocardiography and carotid ultrasound. Layer-specific longitudinal strains were assessed from endo-, mid- and epicardium by 2D-STE. LV global longitudinal strain (LVGLS) was averaged from 16 longitudinal LV segments in all 3 layers. LVGLS results were compared with coronary angiography findings in a receiver operating curve (ROC) to determine the cut-off for normal and pathological strain values. The calculated optimal strain value was compared to maximal carotid IMT measurements.', 'The ROC analysis for strain versus coronary angiography was: area under curve (AUC)=0.91 (95% CI 0.80 - 1.0), cut-off value for endocardial LVGLS: -16.7%. Further analyses showed that increased carotid IMT correlated with low absolute strain values (p=0.006) also when adjusted for hypertension, smoking, hyperlipidemia, diabetes and BMI (p=0.02).']\nQuestion: Is carotid artery intima-media thickness closely related to impaired left ventricular function in patients with coronary artery disease : a single-centre , blinded , non-randomized study?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Vascular endothelium is a major organ involved in hyperglycaemia and is affected by plasma asymmetric dimethylarginine (ADMA). ADMA is an endogenous, competitive inhibitor of nitric oxide synthase and is induced by inflammatory cytokines of tumour necrosis factor (TNF)-alpha in vitro. We hypothesized that a tight glycaemic control may restore endothelial function in patients with type-2 diabetes mellitus (DM), in association with modulation of TNF-alpha and/or reduction of ADMA level.', 'In 24 patients with type-2 DM, the flow-mediated, endothelium-dependent dilation (FMD: %) of brachial arteries during reactive hyperaemia was determined by a high-resolution ultrasound method. Blood samples for glucose, cholesterol, TNF-alpha, and ADMA analyses were also collected from these patients after fasting. No significant glycaemic or FMD changes were observed in 10 patients receiving the conventional therapy. In 14 patients who were hospitalized and intensively treated, there was a significant decrease in glucose level after the treatment [from 190+/-55 to 117+/-21 (mean+/-SD) mg/dL, P<0.01]. After the intensive control of glucose level, FMD increased significantly (from 2.5+/-0.9 to 7.2+/-3.0%), accompanied by a significant (P<0.01) decrease in TNF-alpha (from 29+/-16 to 11+/-9 pg/dL) and ADMA (from 4.8+/-1.5 to 3.5+/-1.1 microM/L) levels. The changes in FMD after treatment correlated inversely with those in TNF-alpha (R=-0.711, P<0.01) and ADMA (R=-0.717, P<0.01) levels.']\nQuestion: Is intensive treatment of risk factors in patients with type-2 diabetes mellitus associated with improvement of endothelial function coupled with a reduction in the levels of plasma asymmetric dimethylarginine and endogenous inhibitor of nitric oxide synthase?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['To evaluate the feasibility of implementing 3 specific prompting methods among students in the first and fourth grades (mean age = 7.2 and 10.1 years, respectively), to validate recall accuracy of first- and fourth-grade students against observation, to develop a single measure of inaccuracy that cumulated errors in reporting food items and amounts without allowing underreporting and overreporting to cancel each other, and to establish information regarding the measure of inaccuracy for use in future studies.', 'Children were interviewed the morning after they were observed eating lunch provided by the school. Interviews included free recall, nonsuggestive prompted recall, and specific prompted recall (either preference, food category, or visual).', 'Ninety-six children (48 students per grade) were studied--32 per the specific prompting method--stratified by grade, sex, and ethnicity (African-American or white). Specific prompting method was randomly assigned to children within strata.', \"Food items were categorized and weighted as: combination entree = 2, condiments = 1/3, and other = 1. To calculate inaccuracy of recall, absolute differences between amounts reported and observed eaten were calculated for each item and then multiplied by each item's weight; these values were then summed across all items for each child. Inaccuracy of recall was determined before specific prompting and after specific prompting and for the difference (inaccuracy after specific prompting minus inaccuracy before specific prompting).\", 'Before specific prompting, median inaccuracy was 2.7 servings for the 48 first-grade students and 1.7 servings for the 48 fourth-grade students. The median difference in inaccuracy from before to after specific prompting was 0 for both grades. Specific prompting increased recall accuracy for 9 first-graders and 12 fourth-graders, but decreased recall accuracy for 21 first-graders and 7 fourth-graders, and did not change recall accuracy for 18 first-graders and 29 fourth-graders. Among children whose recall accuracy increased after specific prompting, 5 first-graders and 8 fourth-graders received prompting for food category.']\nQuestion: Do prompting methods affect the accuracy of children 's school lunch recalls?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Current craniospinal irradiation (CSI) protocols do not include the parotid gland as an organ at risk, potentially leading to late effects of xerostomia and secondary parotid malignancies. We analyzed the effect of CSI treatment parameters on parotid dose.', 'We retrospectively reviewed 50 consecutive patients treated with CSI to an intracranial dose >26 Gy. Parotid dose was compared to a Radiation Therapy Oncology Group (RTOG) dose constraint (at least 1 parotid with mean dose <26 Gy). The effects of CSI dose (≤24 Gy vs 24 Gy), volumetric-modulated arc therapy (VMAT) versus 3-dimensional (3D) CSI technique, boost dose (≤24 Gy vs 24 Gy), supratentorial versus infratentorial boost location, intensity-modulated radiation therapy (IMRT)-based versus 3D boost technique, supine versus prone position, and age on parotid dose were analyzed using multivariate regression analysis.', 'The RTOG parotid dose constraint was exceeded in 22 (44%) of 50 patients. On multivariate regression analysis, lower CSI dose and VMAT CSI technique were associated with reduced parotid dose for the CSI fields. For the boost fields, lower boost dose and supratentorial boost location were associated with lower parotid dose. All 5 patients who underwent VMAT CSI met dose constraints. Furthermore, for infratentorial lesions with a total (CSI plus boost) dose prescription dose >50 Gy (n = 24), 11 of 16 patients who received low-dose CSI (18-23.4 Gy) were able to meet dose constraints, when compared to only 2 of 8 patients who received high dose CSI (36 Gy).']\nQuestion: Is the Parotid Gland an Underrecognized Organ at Risk for Craniospinal Irradiation?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Complete androgen blockade (CAB) does not prolong overall survival (OS) in patients with castration refractory prostate cancer (CRPC). Although there is variable clinical benefit with second-line hormone manipulation, we do not know which patients might benefit the most.', 'To identify clinical predictors of benefit of complete androgen blockade.', 'We reviewed the records for 54 patients who received treatment with CAB in the setting of disease progression despite castration. We evaluated progression-free survival (PFS) and OS according to PSA at diagnosis, Gleason scores, age, testosterone level, and duration of prior disease control during castration in first line treatment.', 'Among 54 patients who received CAB, the median PFS was 9 months (CI 4.3-13.7) and OS was 36 months (CI 24-48). We did not find an effect of PSA at diagnosis (p = 0.32), Gleason score (p = 0.91), age (p = 0.69) or disease control during castration (p = 0.87) on PFS or OS. Thirty-four patients subsequently received chemotherapy, with a mean OS of 21 months (CI 16.4-25.5, median not reached).']\nQuestion: Does complete androgen blockade safely allow for delay of cytotoxic chemotherapy in castration refractory prostate cancer?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: [\"The correction of soft tissue contour defects and dermal atrophy is a growing area driven by medical and aesthetic need. Deterioration of the skin's appearance occurs as a result of age and trauma, such as surgery, infections, and acne. Typically, imperfections are treated with volume-correcting fillers. This study evaluated allogeneic human dermal fibroblasts (HDFs) for the treatment of nasolabial folds as an alternative strategy to improve the structure, texture, and quality of the skin.\", 'In this phase IIa study, a suspension of allogeneic HDF (2 × 10(6) cells/mL or 2 × 10(7) cells/mL) was injected intradermally along the nasolabial fold; line severity was assessed using a photographic scale.', 'Mean investigator satisfaction was 7.4 (range 4.7-9.5) at 12 weeks and 7.6 (range 4.4-9.8) at 24 weeks. Subject satisfaction scores were 7.0 (range 0.1-10.0) at 12 weeks and 7.8 (range 1.5-10.0) at 24 weeks. All patients experienced adverse events, the majority of which were deemed treatment related. Most were mild to moderate in severity and resolved completely.']\nQuestion: Does a phase IIa open-label dose-escalation pilot study using allogeneic human dermal fibroblasts for nasolabial fold?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Chronic inflammation can affect the normal cell homeostasis and metabolism by rendering the cells susceptible to genomic instability that may lead to uncontrolled cellular growth and proliferation ensuing tumorigenesis. The causal agents for inflammation may be pathogenic infections like microbial agents ranging from viruses to bacteria. These infections lead to DNA damage or disruption of normal cell metabolism and alter the genome integrity.', 'In this review, we have highlighted the role of recurrent infections in tumor microenvironment can lead to recruitment of pro-inflammatory cells, cytokines and growth factors to the site of inflammation. This makes the environment rich in cytokines, chemokines, DNA-damaging agents (ROS, RNS) and growth factors which activate DNA damage response pathway and help in sustained proliferation of the tumor cells. In any inflammatory response, the production of cytokines and related signaling molecules is self-regulating and limiting. But in case of neoplastic risk, deregulation of these factors may lead to abnormalities and related pathogenesis.']\nQuestion: Is prolonged inflammatory microenvironment crucial for pro-neoplastic growth and genome instability : a detailed review?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Infection of a transplanted kidney with the polyomavirus, BK, is associated with poor allograft survival.', 'In an attempt to prevent this transplant complication, we studied 144 consecutive transplant recipients for the presence of BK infection with plasma and urine PCR testing at 1, 2, 3, 6 and 12 months. Viruria alone was followed by serial studies. If plasma PCR became positive at >2.6 log copies, mycophenolate was reduced until there was no detectable plasma viral load.', 'Urine PCR was positive in 34 (24%), while plasma PCR turned positive in 22 cases (15%). No patients developed viremia with <6.8 log copies in the urine. Viremia resolved within 3 months or less in 20 of 22 patients after reduction of immunosuppression. Surveillance biopsies at 2 and 6 months revealed no BK nephropathy. Eight patients had acute rejection during reduced immunosuppression; however, all of these reversed with pulse steroids. Patient and graft survival at 1 year was 99 and 98%, respectively. Use of the cell-mediated immunity assay (ImmuKnow, Columbia, Md., USA) was not useful in identifying infected patients.']\nQuestion: Does surveillance and modification of immunosuppression minimize BK virus nephropathy?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Cardiovascular magnetic resonance (CMR) can provide quantitative data of the myocardial tissue utilizing high spatial and temporal resolution along with exquisite tissue contrast. Previous studies have correlated myocardial scar tissue with the occurrence of ventricular arrhythmia. This study was conducted to evaluate whether characterization of myocardial infarction by CMR can predict cardiovascular events in patients with ischemic cardiomyopathy (ICM).', 'We consecutively studied 86 patients with ICM (LVEF < 50%, mean LVEF: 26 +/- 12%) with CMR before revascularization or medication therapy +/- implantable cardiac defibrillator, determined the amount of myocardial scar, and followed for development of cardiovascular events. Thirty-three patients (38%) had cardiovascular events (mean follow-up: 20 +/- 16 months). Patients who developed cardiovascular events had larger scar volume and scar percentage of the myocardium than those who did not develop cardiovascular events (16.8 +/- 12.4 cm3 vs. 11.7 +/- 12.6 cm3, p = 0.023 and 10.2 +/- 6.9% vs. 7.2 +/- 6.7%, p = 0.037, respectively). There were no significant differences in LVEDV, LVESV and LVEF between the patients with and without cardiovascular events (231 +/- 76 ml vs. 230 +/- 88 ml; 180 +/- 73 ml vs. 175 +/- 90 ml; and 25 +/- 10% vs. 27 +/- 13%, respectively).']\nQuestion: Does quantitative characterization of myocardial infarction by cardiovascular magnetic resonance predict future cardiovascular events in patients with ischemic cardiomyopathy?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['To investigate the effect of shank muscle stimulation on ankle joint excursion during passive and functional electrical stimulation (FES) leg cycling.', 'Within-subject comparisons.', 'Laboratory setting.', 'Well-trained FES cyclists (N=7) with chronic spinal cord injuries.', 'Two experimental sessions were performed on an isokinetic FES cycle ergometer with a pedal boot that allowed the ankle to plantarflex and dorsiflex during cycling. During the first session, the optimal stimulation timings to induce plantarflexion and dorsiflexion were investigated by systematically altering the stimulation angles of the shank muscles (tibialis anterior [TA] and triceps surae [TS]). During the second session, TA and TS stimulation was included with standard FES cycling (quadriceps, hamstrings, and gluteals) for 6 subjects.', 'Ankle, knee, and hip movements were analyzed using 2-dimensional video.', 'The ankle excursions during passive cycling were 19°±6°. TA and TS stimulation increased ankle joint excursion up to 33°±10° and 27°±7°, respectively. Compared with passive cycling, ankle joint excursion was not significantly increased during standard FES cycling (24°±7°). TA and TS stimulation significantly increased the ankle excursion when applied during standard FES cycling (41°±4°).']\nQuestion: Does stimulation of shank muscles during functional electrical stimulation cycling increase ankle excursion in individuals with spinal cord injury?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Transgenic mice overexpressing angiopoietin-related growth factor (AGF) exhibit enhanced angiogenesis, suggesting that AGF may be a useful drug target in ischemic disease. Our goal was to determine whether AGF enhances blood flow in a mouse hind-limb ischemia model and to define molecular mechanisms underlying AGF signaling in endothelial cells.', 'Intramuscular injection of adenovirus harboring AGF into the ischemic limb increased AGF production, which increased blood flow through induction of angiogenesis and arteriogenesis, thereby reducing the necessity for limb amputation. In vitro analysis showed that exposing human umbilical venous endothelial cells to AGF increased nitric oxide (NO) production through activation of an ERK1/2-endothelial NO synthetase (eNOS) signaling pathway. AGF-stimulated eNOS phosphorylation, NO production, and endothelial cell migration were all abolished by specific MEK1/2 inhibitors. Moreover, AGF did not restore blood flow to ischemic hind-limbs of either mice receiving NOS inhibitor L-NAME or eNOS knockout mice.']\nQuestion: Does angiopoietin-related growth factor enhance blood flow via activation of the ERK1/2-eNOS-NO pathway in a mouse hind-limb ischemia model?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Accelerometers are useful tools for biologists seeking to gain a deeper understanding of the daily behavior of cryptic species. We describe how we used GPS and tri-axial accelerometer (sampling at 64\\xa0Hz) collars to monitor behaviors of free-ranging pumas (Puma concolor), which are difficult or impossible to observe in the wild. We attached collars to twelve pumas in the Santa Cruz Mountains, CA from 2010-2012. By implementing Random Forest models, we classified behaviors in wild pumas based on training data from observations and measurements of captive puma behavior.', 'We applied these models to accelerometer data collected from wild pumas and identified mobile and non-mobile behaviors in captive animals with an accuracy rate greater than 96%. Accuracy remained above 95% even after downsampling our accelerometer data to 16 Hz. We were further able to predict low-acceleration movement behavior (e.g. walking) and high-acceleration movement behavior (e.g. running) with 93.8% and 92% accuracy, respectively. We had difficulty predicting non-movement behaviors such as feeding and grooming due to the small size of our training dataset. Lastly, we used model-predicted and field-verified predation events to quantify acceleration characteristics of puma attacks on large prey.']\nQuestion: Are movement , resting , and attack behaviors of wild pumas revealed by tri-axial accelerometer measurements?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs.', 'To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation.', 'Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA).', 'Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues.']\nQuestion: Does silodosin inhibit noradrenaline-activated transcription factors Elk1 and SRF in human prostate smooth muscle?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Saturated free fatty acids induce hepatocyte lipoapoptosis, a key pathologic feature of non-alcoholic steatohepatitis. The saturated free fatty acid palmitate induces hepatocyte lipoapoptosis via an endoplasmic reticulum stress pathway resulting in c-Jun-N-terminal (JNK) activation. Glycogen synthase kinase (GSK)-3 is a serine/threonine kinase which may also promote JNK activation. Thus, our aim was to determine if GSK-3 inhibition suppresses palmitate induced JNK activation and lipoapoptosis.', 'For these studies, we employed mouse primary hepatocytes, Huh-7 and Hep3B cell lines.', 'Palmitate-induced GSK-3 activation was identified by phosphorylation of its substrate glycogen synthase. GSK-3 pharmacologic inhibition, by GSK-3 inhibitor IX and enzastaurin, significantly reduced PA-mediated lipoapoptosis. More importantly, Huh-7 cells, in which either GSK-3α or GSK-3β isoforms were stably and selectively knocked down by shRNA, displayed resistance to palmitate-induced cytotoxicity. GSK-3 pharmacological inhibitors and shRNA-targeted knockdown of GSK-3α or GSK-3β also suppressed JNK activation by palmitate. JNK activation, in part, promotes lipoapotosis by inducing expression of the pro-apoptotic effector p53-upregulated modulator of apoptosis (PUMA). Consistent with this concept, GSK-3 pharmacologic inhibition also reduced PUMA cellular protein levels during exposure to palmitate. On the other hand, the GSK-3 inhibitors did not prevent PA induction of ER stress.']\nQuestion: Does glycogen synthase kinase-3 ( GSK-3 ) inhibition attenuate hepatocyte lipoapoptosis?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['The signal transducers and activators of transcription (STATs) are cytoplasmic transcription factors mediating acute-phase response (APR) of the human angiotensinogen (hAGT) gene in hepatocytes. The mechanisms of how STAT3 activates target genes are unknown. Here we analyzed the biochemistry of STAT3 activation by interleukin (IL)-6 in hepatocellular carcinoma HepG2 and Balb/C mice.', 'Immunoprecipitation-Western assays and Matrix Assisted Laser Desorption-Time of Flight mass spectrometry determined sites of STAT3 acetylation by the 300-kilodalton target of E1A (p300) co-activator. The subcellular localization of acetylation-deficient STAT3 molecules were studied by microscopic imaging, effects on DNA binding measured by gel shift and chromatin immunoprecipitation (ChIP) assays, and gene transactivation by Northern blot and reporter assays.', 'Two Lys residues at amino acids 49 and 87 in the STAT3 NH2 terminus are acetylated by p300. Lys-to-Arg point mutations (STAT3 K49R/K87R) had no effect on inducible DNA binding, but blocked p300-mediated acetyl(Ac)-STAT3 formation and abrogated IL-6-induced hAGT activation. Although STAT3 K49R/K87R rapidly translocated into the nucleus, it did not bind p300 and had delayed cytoplasmic redistribution. ChIP assays show IL-6-inducible acetylated STAT3 and p300 binding to the native hAGT promoter. Activation of the APR in mice induces nuclear Tyr phosphorylated and acetylated STAT3 in hepatic nuclei. We also observed that STAT3 interacts with histone deacetylases (HDACs), specifically HDAC 1, that down-regulate IL-6-induced hAGT transactivation.']\nQuestion: Is sTAT3 NH2-terminal acetylation activated by the hepatic acute-phase response and required for IL-6 induction of angiotensinogen?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Cell migration is necessary for numerous physiological cell processes. Although either inflammatory or hypoxic stimuli of certain dose and duration have positive influence on cell migration, their combination has not been shown to result in a synergistic effect.', 'In this study, we investigated combined effects of hypoxia and low-dose inflammatory stimulus (one-tenth of that of a previously used concentration) on migration of human bone marrow-derived mesenchymal stem cells (BMMSCs).', 'Our results from real-time PCR, Western blot analysis and an immunofluorescence assay, showed that dual stimulation up-regulated CXCR4 expression. Based on tablet scratch experimentation and transwell assay, the dual stimuli exhibited greater positive effects on cell migration than a single inflammatory or hypoxic stimulus. When effects of various pre-treatments on cell proliferation, differentiation and immunosuppression were screened, cells subjected to the hypoxic stimulus or dual stimuli had increased cell proliferation, while short-term inflammatory stimulus and/or hypoxic stimulus had no negative effect on cell differentiation and immunosuppression.']\nQuestion: Do hypoxia and low-dose inflammatory stimulus synergistically enhance bone marrow mesenchymal stem cell migration?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['The bradykinin potentiating peptides (BPPs) are oligopeptides found in different animal venoms. BPPs isolated from Bothrops jararaca venom were the first natural inhibitors described for somatic angiotensin I-converting enzyme (ACE). They were used in the structural modeling for captopril development, a classical ACE inhibitor widely used to treat human hypertension.', 'We evaluated the effect of BPP-5a on cardiovascular parameters of conscious Wistar (WTs) and spontaneously hypertensive rats (SHRs).', 'In SHR, BPP-5a showed potent cardiovascular effects, at doses ranging from 0.47 to 710 nmol/kg. The maximal changes in mean arterial pressure (MAP) and heart rate (HR) were found at the dose of 2.37 nmol/kg (Δ MAP: -38 ± 4 mmHg, p < 0.01; Δ HR: -71 ± 17 bpm, p < 0.05). Reductions in MAP and HR occurred throughout 6 hours of post-injection period. In contrast to active site-directed ACE inhibitors, no ACE inhibition, evaluated by the Ang I pressor effect, or bradykinin potentiation was observed during the antihypertensive effect of the pentapeptide. In vitro assays showed no effects of BPP-5a upon argininosuccinate synthetase and B(1), B(2), AT(1), AT(2) or Mas receptors. Ex vivo assays showed that BPP-5a induced endothelium-dependent vasorelaxation in isolated aortic rings of SHRs and WTs.']\nQuestion: Does bPP-5a produce a potent and long-lasting NO-dependent antihypertensive effect?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Type 1 diabetes is caused by an aberrant response against pancreatic β cells. Intestinal K cells are glucose-responsive endocrine cells that might be engineered to secrete insulin. We generated diabetes-prone non-obese diabetic (NOD) mice that express insulin, via a transgene, in K cells. We assessed the effects on immunogenicity and diabetes development.', 'Diabetes incidence and glucose homeostasis were assessed in NOD mice that expressed mouse preproinsulin II from a transgene in K cells and nontransgenic NOD mice (controls); pancreas and duodenum tissues were collected and analyzed by histology. We evaluated T\\xa0cell responses to insulin, levels of circulating autoantibodies against insulin, and the percentage of circulating antigen-specific T cells. Inflammation of mesenteric and pancreatic lymph node cells was also evaluated.', 'The transgenic mice tended to have lower blood levels of glucose than control mice, associated with increased plasma levels of immunoreactive insulin and proinsulin. Fewer transgenic mice developed diabetes than controls. In analyses of pancreas and intestine tissues from the transgenic mice, insulin-producing K\\xa0cells were not affected by the immune response and the mice had reduced destruction of endogenous β cells. Fewer transgenic mice were positive for insulin autoantibodies compared with controls. Cells isolated from mesenteric lymph nodes of the transgenic mice had significantly lower rates of proliferation and T cells from transgenic mice tended to secrete lower levels of inflammatory cytokines than from controls. At 15 weeks, transgenic mice had fewer peripheral CD8(+) T cells specific for NRP-V7 than control mice.']\nQuestion: Do insulin-producing intestinal K cells protect nonobese diabetic mice from autoimmune diabetes?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['To examine the association of employment and work schedule with shorter DNA telomeres, a marker of cellular ageing and disease risk factor, and consider whether differences were related to health, behaviours and sociodemographic factors, or varied by stress levels or menopausal status.', 'This cross-sectional analysis of 608 women aged 35-74 in the Sister Study examined determinants of relative telomere length (rTL) measured by quantitative PCR in leucocyte DNA. Age-adjusted regression models estimated base pair (bp) rTL differences for current and lifetime schedule characteristics (ie, part-time, full-time or overtime hours; multiple jobs; irregular hours; shiftwork; work at night). Covariates included race, smoking, perceived stress, sleep, physical activity, health and menopausal status, education, marital status, live births, children under 18, measured body mass index and urinary stress hormones.', 'Compared with non-employed women with moderate or substantial past work histories (n=190), those currently working full-time (n=247; median 40 h/week) had a shorter rTL, an age-adjusted difference of -329 bp (95% CI -110 to -548). Longer-duration full-time work was also associated with shorter rTL (age-adjusted difference of -472 bp, 95% CI -786 to -158 for 20+ vs 1-5 years). Findings were not explained by health and demographic covariates. However, rTL differences for working at least full-time were greater in women with higher stress and epinephrine levels.']\nQuestion: Are employment and work schedule related to telomere length in women?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['To evaluate colorectal cancer risk among patients with sporadic duodenal neoplasia using a case-control protocol.', 'Cases were 35 patients referred for the management of sporadic duodenal adenoma and who underwent colonoscopy. Colonoscopy findings among cases were compared with those from a control group matched for age and sex (two controls per case) without duodenal adenoma. Colonoscopy findings were categorized as adenoma, advanced adenoma, cancer or advanced neoplasia. The two groups were compared using the chi-squared test. Odds ratio and 95% confidence intervals were calculated.', 'Colorectal adenoma was present in 31% of cases vs. 24% of controls, advanced neoplasia in 29% vs. 4%, advanced adenoma in 23% vs. 3% and adenocarcinoma in 6% vs. 1%. The relative risks of advanced colorectal adenoma and advanced colorectal neoplasia in cases were 10.1 (95% CI: 1.8-100.1, P = 0.003) and 8.9 (95% CI: 2.1-53.3, P = 0.001), respectively.']\nQuestion: Are patients with sporadic duodenal adenoma a high-risk group for advanced colorectal neoplasia : results of a case-control study?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['The clinical utility of intimal hyperplasia detected by intravascular ultrasonography in predicting cardiac events in heart transplant recipients with cardiac allograft vasculopathy has not been previously investigated.', 'Intravascular ultrasonographic examination of 74 consecutive heart transplant recipients, including 62 men and 12 women with a mean age of 51 +/- 10 years (range 22 to 68 years), was performed at the time of annual angiography. Two groups of study patients were identified: group I consisted of patients with minimal, mild, or moderate intimal thickness by intravascular ultrasonography, whereas group II patients had severe intimal thickness.', 'Patient characteristics were similar in both groups except for higher serum triglycerides (220 +/- 95 versus 165 +/- 79 mg/dl), more advanced donor age (28 +/- 11 versus 23 +/- 6 years) and greater duration of follow-up after transplantation (3.3 +/- 1.4 versus 1.8 +/- 1.2 years) in group II patients with severe intimal thickening (p < 0.01). Cardiac events were defined as the occurrence of sudden death, myocardial infarction, or the need for coronary revascularization via percutaneous or surgical intervention. One cardiac event occurred in group I patients (sudden death), whereas seven events were noted in the group II patients (p = 0.006). Cardiac events in the group of patients with severe intimal thickening included four patients with sudden cardiac death and three patients who underwent percutaneous revascularization procedures involving directional coronary atherectomy. Angiograms were normal in 62% of patients who had cardiac events.']\nQuestion: Does presence of severe intimal thickening by intravascular ultrasonography predict cardiac events in cardiac allograft vasculopathy?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['A proportion of patients receiving infliximab have antibodies toward infliximab (ATI), which are associated with increased risk of infusion reaction and reduced response to treatment. We studied the association of infliximab concentration at treatment initiation and development of ATI as well as the association of the presence of ATI and maintenance of infliximab.', 'All patients with rheumatoid arthritis (RA) or spondyloarthritis (SpA) receiving infliximab beginning in December 2005 were retrospectively followed until January 2009 or until infliximab discontinuation. Trough serum infliximab and ATI concentrations were measured at each visit. The patients were separated into two groups: ATI(pos) if ATI were detected at least once during the follow-up period and ATI(neg) otherwise. Repeated measures analysis of variance was used to study the association of infliximab concentration at treatment initiation and the development of ATI. Maintenance of infliximab in the two groups was studied by using Kaplan-Meier curves.', 'We included 108 patients: 17 with RA and 91 with SpA. ATI were detected in 21 patients (19%). The median time to ATI detection after initiation of infliximab was 3.7 months (1.7 to 26.0 months). For both RA and SpA patients, trough infliximab concentration during the initiation period was significantly lower for ATI(pos) than ATI(neg) patients. RA patients showed maintenance of infliximab at a median of 19.5 months (5.0 to 31.0 months) and 12.0 months (2.0 to 24.0 months) for ATI(neg) and ATI(pos) groups, respectively (P = 0.08). SpA patients showed infliximab maintenance at a median of 16.0 months (3.0 to 34.0 months) and 9.5 months (3.0 to 39.0 months) for ATI(neg) and ATI(pos) groups, respectively (P = 0.20). Among SpA patients, those who were being treated concomitantly with methotrexate had a lower risk of developing ATI than patients not taking methotrexate (0 of 14 patients (0%) vs. 25 of 77 patients (32%); P = 0.03).']\nQuestion: Are antibodies toward infliximab associated with low infliximab concentration at treatment initiation and poor infliximab maintenance in rheumatic diseases?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Postural control requires numerous inputs interacting across multiple temporospatial scales. This organization, evidenced by the \"complexity\" contained within standing postural sway fluctuations, enables diverse system functionality. Age-related reduction of foot-sole somatosensation reduces standing postural sway complexity and diminishes the functionality of the postural control system. Sub-sensory vibrations applied to the foot soles reduce the speed and magnitude of sway and improve mobility in older adults. We thus hypothesized that these vibration-induced improvements to the functionality of the postural control system are associated with an increase in the standing postural sway complexity.', 'Twelve healthy older adults aged 74\\u2009±\\u20098\\xa0years completed three visits to test the effects of foot sole vibrations at 0\\xa0% (i.e., no vibration), 70 and 85\\xa0% of the sensory threshold. Postural sway was assessed during eyes-open and eyes-closed standing. The complexity of sway time-series was quantified using multiscale entropy. The timed up-and-go (TUG) was completed to assess mobility.', 'When standing without vibration, participants with lower foot sole vibratory thresholds (better sensation) had greater mediolateral (ML) sway complexity (r (2)\\u2009=\\u20090.49, p\\u2009<\\u20090.001), and those with greater ML sway complexity had faster TUG times (better mobility) (r (2)\\u2009=\\u20090.38, p\\u2009<\\u20090.001). Foot sole vibrations at 70 and 85\\xa0% of sensory threshold increased ML sway complexity during eyes-open and eyes-closed standing (p\\u2009<\\u20090.0001). Importantly, these vibration-induced increases in complexity correlated with improvements in the TUG test of mobility (r (2)\\u2009=\\u20090.15\\u2009~\\u20090.42, p\\u2009<\\u20090.001\\u2009~\\u20090.03).']\nQuestion: Does sub-sensory vibratory noise augment the physiologic complexity of postural control in older adults?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['The embryological origin of the utricle is thought to be a remnant of the fused caudal ends of the müllerian ducts (MDs). Others propose that the urogenital sinus (UGS) contributes either partially or totally to the development of this structure. Using immunohistochemical probes, we provide strong evidence that the utricle is of UGS origin only.', 'Human fetal prostates, gestational ages 9 to 24 weeks, were serially cross-sectioned. Representative sections were stained with antibodies to p63 (basal cell marker), vimentin (mesoderm marker), uroplakins (marker for urothelium) Pax-2 (expressed in ductal and mesenchyme of urogenital system including the MDs and wolffian ducts) and Ki67 (proliferation). Apoptosis was detected with the TUNEL assay.', 'By 9 weeks there was weak expression of p63 in the basal layer of the UGS. At 11 weeks there was increased staining of p63 in the UGS and some p63 staining of the fused MDs, which expressed Pax-2 at this time. At 14 to 15 weeks as the MDs were undergoing apoptosis, there was an ingrowth of uroplakin-expressing UGS epithelium into the periurethral stroma, which formed a plate of p63 positive cells just beneath the UGS that was Ki67 positive. The remaining caudal MD epithelium was p63 negative and expressed vimentin and Pax-2. By 17 weeks the plate of p63 positive cells elongated forming the utricle that remained p63 positive but Pax-2 and vimentin negative.']\nQuestion: Is the prostatic utricle a Müllerian duct remnant : immunohistochemical evidence for a distinct urogenital sinus origin?\nAnswer:",
"role": "user"
},
{
"content": " no",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['HIV/AIDS is a worldwide threat to human health with mortality, prevalence, and incidence rates varying widely. We evaluated the association between the global HIV/AIDS epidemic and national socioeconomic development.', 'We obtained global age-standardized HIV/AIDS mortality, prevalence, and incidence rates from World Health Statistics Report of the World Health Organization. The human development indexes (HDIs) of 141 countries were obtained from a Human Development Report. Countries were divided into 4 groups according to the HDI distribution. We explored the association between HIV/AIDS epidemic and HDI information using Spearman correlation analysis, regression analysis, and the Kruskal-Wallis test.', 'HIV/AIDS mortality, prevalence, and incidence rates were inversely correlated with national HDI (r = -0.675, -0.519, and -0.398, respectively; P < .001), as well as the 4 indicators of HDI (ie, life expectancy at birth, mean years of schooling, expected years of schooling, and gross national income per capita). Low HDI countries had higher HIV/AIDS mortality, prevalence, and incidence rates than that of medium, high, and very high HDI countries. Quantile regression results indicated that HDI had a greater negative effect on the HIV/AIDS epidemic in countries with more severe HIV/AIDS epidemic.']\nQuestion: Are national HIV/AIDS mortality , prevalence , and incidence rates associated with the Human Development Index?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Maternal diabetes is associated with numerous adverse effects in fetal and neonatal organs, including the lungs.', 'To investigate the effects of intrauterine hyperglycemia on neonatal lung biological signaling, we performed a microarray analysis in the lungs of four 14-day-old rat pups born to a hyperglycemic dam and in four age mate control pup lungs.', 'Total RNA was isolated and cDNA was hybridized to the Illumina Sentrix® RatRef-12 BeadChip. A total of 22,000 genes were analyzed for expression profiles and functional gene clustering. Ten selected genes differentially expressed in microarray were additionally analyzed by the real-time polymerase chain reaction.', 'Two hundred twenty-seven genes were differentially expressed in neonatal rat lungs exposed to intrauterine hyperglycemia when compared to normoglycemic controls (fold change > 1.2, p < 0.001). Functional clustering analysis revealed increased expression in signaling pathways involved with extracellular matrix regulation. The most significantly downregulated functions were cell proliferation, extracellular region, cell adhesion and reactive oxygen species metabolism.']\nQuestion: Does maternal hyperglycemia modify extracellular matrix signaling pathways in neonatal rat lung?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Excessive alcohol drinking continues to be an important health problem. Recent studies from our laboratory and others have demonstrated that animal models of ethanol dependence and relapse can contribute to understanding factors that contribute to excessive drinking. In this study, we tested the hypothesis that the amount and duration of ethanol exposure is critical for promoting the escalation in drinking by mice given access to ethanol in a limited access paradigm.', 'We used several methods of chronic intermittent ethanol exposure in male C57BL/6J mice that would vary in the amount and duration of exposure to ethanol as indicated by blood ethanol concentrations (BEC). After establishing baseline drinking in the mice using a 2 hours, 2 bottle choice drinking paradigm, each study involved alternating between periods of ethanol exposure and periods of limited access to ethanol (1 cycle) for a total of 3 cycles. In Study 1, mice were allowed extended access (16 hours) to ethanol for oral consumption or remained in the home cage. In Study 2, the ethanol exposure consisted of intragastric gavage of increasing doses of ethanol or isocaloric sucrose as the control. Study 3 compared intragastric gavage combined with pyrazole, an alcohol dehydrogenase inhibitor, with vapor inhalation of ethanol using procedures known to lead to increased drinking in mice. Finally, Study 4 was a retrospective review of several studies conducted in our laboratory using inhalation procedures. The retrospective review encompassed a range of postvapor chamber BEC values and ethanol intakes that would allow a relationship between increased drinking and BEC to be examined.', 'Allowing mice to drink for longer periods of time did not cause increased drinking in subsequent limited access sessions. Likewise, gastric intubation of ethanol which produced high BEC (>300 mg/dl) with or without pyrazole did not increase drinking. Only the vapor inhalation procedure, which was associated with sustained BEC above 175 mg/dl for the entire exposure period resulted in increased drinking. The retrospective study provided further evidence that sustained BEC levels above 175 mg/dl was critical to the escalation in drinking.']\nQuestion: Is intensity and duration of chronic ethanol exposure critical for subsequent escalation of voluntary ethanol drinking in mice?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['F-box and WD repeat domain-containing 7 (FBXW7) is a cell cycle regulatory gene whose protein product ubiquitinates positive cell cycle regulators such as c-Myc, cyclin E, and c-Jun, thereby acting as a tumour-suppressor gene. This study focused on microRNA-223 (miR-223), which is a candidate regulator of FBXW7 mRNA. The aim of this study was to clarify the clinical significance of miR-223 and FBXW7 in oesophageal squamous cell carcinoma (ESCC) patients, and to elucidate the mechanism by which FBXW7 is regulated by miR-223.', 'The expression levels of miR-223 and the expression of FBXW7 protein was examined using 109 resected specimens to determine the clinicopathological significance. We also investigated the role of miR-223 in the regulation of FBXW7 expression in ESCC cell lines in an in vitro analysis.', 'We found that miR-223 expression was significantly higher in cancerous tissues than in the corresponding normal tissues. There was a significant inverse relationship between the expression levels of miR-223 and FBXW7 protein. Moreover, patients with high miR-223 expression demonstrated a significantly poorer prognosis than those with low expression. On the basis of a series of gain-of-function and loss-of-function studies in vitro, we identified FBXW7 as a functional downstream target of miR-223.']\nQuestion: Does overexpression of microRNA-223 regulate the ubiquitin ligase FBXW7 in oesophageal squamous cell carcinoma?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Extremes in body weight are a relative contraindication to cardiac transplantation.', 'We retrospectively reviewed 474 consecutive adult patients (377 male, 97 female, mean age 50.3+/-12.2 years), who received 444 primary and 30 heart retransplants between January of 1992 and January of 1999. Of these, 68 cachectic (body mass index [BMI]<20 kg/m2), 113 overweight (BMI=>27-30 kg/m2), and 55 morbidly obese (BMI>30 kg/m2) patients were compared with 238 normal-weight recipients (BMI=20-27 kg/m2). We evaluated the influence of pretransplant BMI on morbidity and mortality after cardiac transplantation. Kaplan-Meier survival distribution and Cox proportional hazards model were used for statistical analyses.', 'Morbidly obese as well as cachectic recipients demonstrated nearly twice the 5-year mortality of normal-weight or overweight recipients (53% vs. 27%, respectively, P=0.001). An increase in mortality was seen at 30 days for morbidly obese and cachectic recipients (12.7% and 17.7%, respectively) versus a 30-day mortality rate of 7.6% in normal-weight recipients. Morbidly obese recipients experienced a shorter time to high-grade acute rejection (P=0.004) as well as an increased annual high-grade rejection frequency when compared with normal-weight recipients (P=0.001). By multivariable analysis, the incidence of transplant-related coronary artery disease (TCAD) was not increased in morbidly obese patients but cachectic patients had a significantly lower incidence of TCAD (P=0.05). Cachectic patients receiving oversized donor hearts had a significantly higher postoperative mortality (P=0.02).']\nQuestion: Are pretransplant cachexia and morbid obesity predictors of increased mortality after heart transplantation?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Despite the consistent association between cholesteryl ester transfer protein (CETP) gene variation and plasma HDL-C, huge controversy still rages on its association with coronary heart disease (CHD). We investigated the association between the CETP-TaqIB polymorphism, HDL-C and incident CHD in a Mediterranean population.', 'A nested case-control study among participants of the Spanish EPIC cohort was performed. 41,440 healthy individuals (30-69 years) were followed up over a 10-year period, incident CHD cases being identified. We analyzed 557 confirmed CHD cases and 1180 healthy controls.', 'Despite B2B2 subjects having the highest HDL-C concentrations and B1B1, the lowest (P<0.001), no protective effect of the B2 allele against CHD incidence was observed. Thus, in comparison with B1B1 subjects, the adjusted CHD risk of B1B2 was OR: 1.00, 95% CI: 0.80-1.26; P=0.982, and that of B2B2 was OR: 1.16, 95% CI: 0.84-1.61; P=0.374. These results did not change after adjustment for HDL-C. No significant interaction between alcohol consumption and the CETP-TaqIB polymorphism in determining HDL-C was found. However, a different effect of this polymorphism on CHD risk in drinkers and non-drinkers was observed. In non-drinkers, the B2B2 genotype was associated with a non-significant lower CHD risk, whereas in drinkers it was associated with a greater risk (OR: 1.55, 95% CI: 1.05-2.29; P=0.026). We also observed that in diabetics (11% cases and 7.4% controls), the B2 allele was significantly associated with higher CHD risk.']\nQuestion: Is common cholesteryl ester transfer protein gene variation related to high-density lipoprotein cholesterol associated with decreased coronary heart disease risk after a 10-year follow-up in a Mediterranean cohort : Modulation by alcohol consumption?\nAnswer:",
"role": "user"
},
{
"content": " no",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['It has been shown that antigen presentation by resting B cells can induce tolerance to intravenously administered protein antigens, but the role of resting B cells in the induction of oral tolerance is unclear.', 'Mice continuously treated since birth with rabbit anti-mouse IgM serum for 5 weeks were depleted of B cells. When 4 weeks old, B cell-depleted mice drank 10% chicken egg white (EW) for 5 days. Ten weeks later, they were immunized with 10 microgram of ovalbumin in alum and their T helper 2 (Th2) immune responses were tested.', 'Th2 cell-mediated IgE and IgG1 antibody responses and spleen cell production of IL-4 and IL-5 were suppressed by prior EW feeding during anti-IgM treatment. When anti-IgM-treated spleen cells collected 1 week after EW ingestion were transferred to naïve recipients, active suppression of Th2 immune responses was also demonstrated.']\nQuestion: Are resting B cells antigen-presenting cells in the induction of oral tolerance of specific Th2 immune responses in mice?\nAnswer:",
"role": "user"
},
{
"content": " no",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Death in dialysis patients results mainly from cardiovascular and cerebrovascular diseases. To our knowledge, no prospective study has compared the rates of mortality or cardiovascular events between patients with and without atrial fibrillation (AF) at the time of dialysis initiation.', 'This study included 1,516 patients who were initiated into dialysis between October 2011 and August 2013. Rates of mortality and cardiovascular events were compared between patients with and without AF, and between AF patients with and without warfarin (WF) treatment.', 'The study comprised 1,025 men and 491 women with a mean age of 67.5 ± 13.1. Of these patients, 93 had AF, while 1,423 did not; 22.6% of the former group and 9.7% of the latter group died by March 2014 (p < 0.01). Cardiovascular events occurred in 34.4% of patients with AF and 15.1% of patients without (p < 0.01). Even after adjustments for various factors, AF remained an independent risk factor for mortality (hazard ratio (HR) 1.873, 95% CI 1.168-3.002, p < 0.01). It was also an independent risk factor for cardiovascular events (HR 1.872, 95% CI 1.262-2.778, p < 0.01). No difference in any parameter was noted between the groups that did and did not receive WF treatment.']\nQuestion: Does presence of Atrial Fibrillation at the Time of Dialysis Initiation be Associated with Mortality and Cardiovascular Events?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Foreign body (FB) ingestion is a common problem presenting to the emergency department (ED). The standard treatment, removal by endoscopy, is well established. However, some patients may refuse this invasive procedure due to their fear of an uncomfortable or painful experience. Obtaining hard evidence of potential complications of not having the FB removed by endoscopy would be helpful in convincing patients to have the procedure.', 'The aim of this study was to identify the risk factors for developing complications after FB ingestion.', \"The study was conducted over a period of 1 year (April 1, 2006 through March 31, 2007) at a referral medical center. Potential risk factors for developing complications (e.g., age, gender, type of FB, positive finding on radiography) were retrospectively evaluated in patients presenting with esophageal FBs and analyzed using chi-squared or Fisher's exact test and logistic regression.\", 'A total of 225 patients were included. Fish bones were found to be the most common FBs (73.4%). The most commonly affected site was the oropharynx (64.5%). The complication rate was 9.7%. Risk factors for complications after FB ingestion were: 1) time interval over 24 h between FB ingestion and presenting to the ED; 2) a positive radiographic finding; 3) age > 50 years.']\nQuestion: Is risk factors for complications after a foreign body retained in the esophagus?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['We investigated whether the plasma level of 25-hydroxyvitamin D (25-OHD) after a diagnosis of colorectal cancer (CRC) influences survival outcome.', 'We prospectively studied 1,598 patients with stage I to III CRC. We sought association between plasma 25-OHD and stage-specific survival and tested for interaction between 25-OHD level and variation at the vitamin D receptor (VDR) gene locus. Blood was sampled postoperatively, and plasma was assayed for 25-OHD by liquid chromatography-tandem mass spectrometry. VDR polymorphisms (rs1544410, rs10735810, rs7975232, rs11568820) were genotyped, and haplotypes were inferred by using BEAGLE software. We tested for association between survival and 25-OHD, VDR genotype/haplotype, and after applying a VDR genotype-25-OHD interaction term. We conducted Kaplan-Meier survival analysis and used Cox proportional hazards models to estimate adjusted hazard ratios (HRs).', 'We found strong associations between plasma 25-OHD concentration and CRC-specific (P = .008) and all-cause mortality (P = .003). Adjusted HRs were 0.68 (95% CI, 0.50 to 0.90) and 0.70 (95% CI, 0.55 to 0.89), respectively (highest v lowest 25-OHD tertile), particularly in stage II disease (HR, 0.44; P = .004 for CRC-specific mortality). We detected gene-environment interactions between 25-OHD concentration and rs11568820 genotype for CRC-specific (P = .008) and all-cause (P = .022) mortality, number of protective alleles (P = .004 and P = .018, respectively), and GAGC haplotype at the VDR locus for all-cause mortality (P = .008).']\nQuestion: Does plasma vitamin D concentration influence survival outcome after a diagnosis of colorectal cancer?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['To investigate whether superoxide mediates angiotensin (Ang) II-induced vasoconstriction.', 'Human coronary arteries (HCAs), porcine femoral arteries (PFA) and porcine coronary arteries (PCAs) were mounted in organ baths and concentration-response curves to Ang II, the nitric oxide (NO) donor S-nitroso-N-acetylpenicillamine (SNAP) and the NAD(P)H oxidase substrate NADH were constructed in the absence and presence of superoxide inhibiting and activating drugs. Extracellular superoxide was measured using cytochrome c reduction.', 'Ang II constricted both HCAs and PFAs. In HCAs, the NAD(P)H inhibitors diphenyleneiodonium (DPI) and apocynin, and the xanthine oxidase (XO) inhibitor allopurinol, but not the superoxide dismutase (SOD) mimetic tempol or the SOD inhibitor diethyldithiocarbamate (DETCA), reduced this constriction. Catalase potentiated Ang II in HCAs, indicating a vasodilator role for H2O2. DPI, tempol and SOD did not affect Ang II in PFAs. DPI, apocynin and allopurinol relaxed preconstricted HCAs. Although the relaxant effects of the NO donor SNAP in PCAs was reduced by DETCA, indicating that superoxide-induced constrictions depend on NO inactivation, the apocynin-induced relaxations were NO independent. Moreover, NADH relaxed all vessels, and this effect was blocked by KCl but not DPI or NO removal. Xanthine plus XO also relaxed HCAs and PCAs. Incubation of human or porcine arteries with Ang II or NADH did not result in detectable increases of extracellular superoxide within 1 h.']\nQuestion: Does superoxide mediate the acute vasoconstrictor effects of angiotensin II : a study in human and porcine arteries?\nAnswer:",
"role": "user"
},
{
"content": " no",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Cyclooxygenase (COX) is a rate-limiting enzyme in prostaglandins synthesis which exists in two isoforms, COX-1 and COX-2. Over-expression of COX-2 was considered to increase the proliferation and enhance the invasiveness of breast cancer cells. It was suggested that genetic variations in COX-2 could influence its expression. Herein, the present study was aimed to investigate the associations between two mostly studied functional polymorphisms (-765\\xa0G\\u2009>\\u2009C and 8473 C\\u2009>\\u2009T) in COX-2 and breast cancer risk in Chinese Han women.', 'In the hospital-based case-control study, 465 breast cancer patients and 799 cancer-free controls were genotyped for the COX-2 -765\\xa0G\\u2009>\\u2009C and 8473 C\\u2009>\\u2009T polymorphisms using TaqMan assay. We estimated odds ratios (ORs) and 95% confidence intervals (95% CIs) using the logistic regression.', 'Compared with the wild genotype of -765\\xa0G\\u2009>\\u2009C, we found a statistically significant increased risk of breast cancer associated with the variant genotypes [GC/CC vs. GG: OR\\u2009=\\u20091.56, 95% CI\\u2009=\\u20091.11-2.21]. In the stratified analysis, the increased risk was more predominant among the subgroups of younger subjects (OR\\u2009=\\u20091.61, 95% CI\\u2009=\\u20091.00-2.61). Furthermore, the variant genotypes were associated with large tumor size (OR\\u2009=\\u20093.01, 95% CI\\u2009=\\u20091.47-6.12). No significant association was observed for the 8473 C\\u2009>\\u2009T polymorphism.']\nQuestion: Is functional promoter -765 G > C variant in COX-2 gene associated with the susceptibility of breast cancer in Chinese Han women?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['As a part of the Finnish Cardiovascular Study, we tested the hypothesis that T-wave alternans (TWA) predicts mortality in a general population of patients referred for a clinical exercise test.', 'A total of 1037 consecutive patients (mean age+/-SD of 58+/-13 years, 673 men and 364 women) with a clinically indicated exercise test and with technically successful electrocardiographic (ECG) data during a bicycle ergometer test were included in the study. Digital ECGs were recorded and TWA was analysed continuously with the time-domain modified moving average method. The maximum TWA value at heart rate (HR)<125 b.p.m. was derived and its capacity to stratify risk for all-cause death, cardiovascular death, and sudden cardiac death (SCD) was tested. During a follow-up of 44+/-7 months (mean+/-SD), 59 patients died; 34 were due to cardiovascular causes and 20 were due to SCD. In multivariate analysis after adjustment for age, sex, use of beta-blockers, functional class, maximal HR during exercise, previous myocardial infarction, and other common coronary risk factors, the relative risk of TWA>or=65 microV for SCD was 7.4 (95% CI, 2.8-19.4; P<0.001), for cardiovascular mortality 6.0 (95% CI, 2.8-12.8; P<0.001), and for all-cause mortality 3.3 (95% CI, 1.8-6.3; P=0.001).']\nQuestion: Does t-wave alternans predict mortality in a population undergoing a clinically indicated exercise test?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Sorafenib, a broad tyrosine kinase inhibitor, is the only approved systemic therapy for advanced hepatocellular carcinoma (HCC) but provides limited survival benefits. Recently, immunotherapy has emerged as a promising treatment strategy, but its role remains unclear in HCCs, which are associated with decreased cytotoxic CD8(+) T-lymphocyte infiltration in both murine and human tumors. Moreover, in mouse models after sorafenib treatment intratumoral hypoxia is increased and may fuel evasive resistance. Using orthotopic HCC models, we now show that increased hypoxia after sorafenib treatment promotes immunosuppression, characterized by increased intratumoral expression of the immune checkpoint inhibitor programmed death ligand-1 and accumulation of T-regulatory cells and M2-type macrophages. We also show that the recruitment of immunosuppressive cells is mediated in part by hypoxia-induced up-regulation of stromal cell-derived 1 alpha. Inhibition of the stromal cell-derived 1 alpha receptor (C-X-C receptor type 4 or CXCR4) using AMD3100 prevented the polarization toward an immunosuppressive microenvironment after sorafenib treatment, inhibited tumor growth, reduced lung metastasis, and improved survival. However, the combination of AMD3100 and sorafenib did not significantly change cytotoxic CD8(+) T-lymphocyte infiltration into HCC tumors and did not modify their activation status. In separate experiments, antibody blockade of the programmed death ligand-1 receptor programmed death receptor-1 (PD-1) showed antitumor effects in treatment-naive tumors in orthotopic (grafted and genetically engineered) models of HCC. However, anti-PD-1 antibody treatment had additional antitumor activity only when combined with sorafenib and AMD3100 and not when combined with sorafenib alone.']\nQuestion: Does cXCR4 inhibition in tumor microenvironment facilitate anti-programmed death receptor-1 immunotherapy in sorafenib-treated hepatocellular carcinoma in mice?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['A noninvasive, objective, reproducible, and quantitative Aspergillus-specific surrogate marker is needed for a more accurate assessment of the outcome of invasive aspergillosis (IA) in patients with a hematologic disorder. The quantitative serum galactomannan index (GMI) assay seems to fulfill the requirements of surrogacy for outcome evaluation.', 'Kappa statistics were used to determine the strength of correlation between GMI outcome and clinical outcome (survival or death), autopsy data, and response outcome of IA in 70 adults with prolonged neutropenia. All patients underwent serial GMI monitoring until discharge or death.', 'The overall correlation between GMI and clinical outcome was good at 6 weeks (kappa=0.5882; 95% confidence interval [95% CI], 0.4023-0.7741) and was excellent at 12 weeks (kappa=0.8857; 95% CI, 0.7766-0.9948). Concordance with autopsy findings was perfect (kappa=1). At 6 weeks, the correlation between GMI and response outcome (favorable or unfavorable) was excellent (kappa=0.7523; 95% CI, 0.5803-0.9243). Survival was significantly better in patients who became GMI-negative (P<.0001).']\nQuestion: Does galactomannan serve as a surrogate endpoint for outcome of pulmonary invasive aspergillosis in neutropenic hematology patients?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['To evaluate the retroperitoneoscopic ureterolithotomy in the treatment of ureteral calculi and the need for double-J catheter to reduce the procedure-related complications.', 'We conducted a retrospective study with 47 patients submitted to retroperitoneoscopic ureterolithotomy, of which 31 were selected and divided into two groups: Group 1, whose patients did not have double-J catheter placement, and Group 2, who underwent perioperative double-J catheter implantation. Data collected comprised pre-and post-operative excretory urography, operative time, postoperative analgesia, length of hospital stay and catheter removal.', 'The groups were similar as for age and gender, degree of dilation of the urinary tract, position and average size of the calculi (Group 1 = 15.5 ± 6.6 mm, Group 2 = 16.3 ± 6.1 mm). Operative time was also not significantly different (Group 1 = 130 ± 40.3 min, Group 2 = 136.3 ± 49.3 min). Group 1 had six patients (37.5%) with early (four cases of urinary fistula) and late complications (one case of stenosis of the ureter, one case of functional exclusion of the operated kidney), while Group 2 had no complications. This difference was statistically significant (p = 0.011).']\nQuestion: Does the use of double-J catheter decrease complications of retroperitoneoscopic ureterolithotomy?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['The purpose of this study was to determine the role of smooth muscle cell-derived hypoxia-inducible factor-1α (Hif-1α) in the pathogenesis of aortic aneurysms.', 'Control mice and smooth muscle cell-specific hypoxia-inducible factor-1α-deficient mice were infused with β-aminopropionitrile for 2 weeks and angiotensin II for 6 weeks to induce aortic aneurysm formation. Mutant mice experienced increased levels of aneurysm formation of the thoracic or abdominal aorta with more severe elastin disruption, compared with control mice. Smooth muscle cell-specific hypoxia-inducible factor-1α deficiency did not affect matrix metalloproteinase-2 activity; however, the activity of lysyl oxidase and the levels of tropoelastin mRNA in the angiotensin II- and β-aminopropionitrile-treated aortae, associated with elastin fiber formation, were suppressed. Furthermore, we observed reduced volumes of mature cross-linked elastin in the thoracoabdominal aorta after treatment with angiotensin II and β-aminopropionitrile.']\nQuestion: Does hypoxia-Inducible Factor-1α in Smooth Muscle Cells protect Against Aortic Aneurysms-Brief Report?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['To compare the effects of estrogen with estrogen-androgen treatment on vaginal blood flow velocity and fingertip postocclusive hyperemic blood flow response.', 'Prospective, randomized, parallel, double-blind study.', 'Healthy human volunteers in an academic research environment.', 'Postmenopausal women receiving estrogen replacement therapy for at least 12 months and treated with placebo before this investigation.', 'Esterified estrogens or esterified estrogen + methyltestosterone were administered orally; laser Doppler velocimetry was used to determine vaginal and fingertip blood flow responses at baseline and after 4 and 8 weeks of daily drug administration.', 'Fingertip postocclusive area under curve (AUC); vaginal blood flow velocities.', 'The AUC for postocclusive fingertip blood flow and vaginal blood flow increased to a greater extent in the estrogen-androgen group, but changes were not statistically significant between groups.']\nQuestion: Are vasodilator effects of estrogen diminished by androgen in postmenopausal women?\nAnswer:",
"role": "user"
},
{
"content": " no",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['To evaluate the association between rheumatoid arthritis (RA)-related autoantibodies and plasma 25,OH vitamin D in subjects at risk for RA.', 'In 1210 subjects without RA, 76 were positive for anti-cyclic citrullinated peptide antibodies or for at least 2 rheumatoid factors (RF; by nephelometry: RF-IgM, RF-IgG, RF-IgA). 25,OH vitamin D was measured in these cases and 154 autoantibody-negative controls from this cohort.', '25,OH vitamin D levels did not differ between cases and controls (adjusted OR 1.23, 95% CI 0.93-1.63).']\nQuestion: Are plasma 25 , OH vitamin D concentrations associated with rheumatoid arthritis ( RA ) -related autoantibodies in individuals at elevated risk for RA?\nAnswer:",
"role": "user"
},
{
"content": " no",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Xeroderma pigmentosum variant (XPV) is a rare recessive autosomal genodermatosis predisposing to multiple early onset skin cancers, including melanoma. XPV results from mutations of the POLH gene that encodes a DNA translesion polymerase. In this work, we tested the hypothesis that POLH variants could be associated with melanoma risk.', 'A common non-synonymous POLH variant, c.1783A>G p.M595V, was genotyped in 1075 melanoma patients and in 1091 ethnic-matched controls from France. In addition, we searched for rare POLH variants by sequencing the entire coding sequence in 201 patients having a familial history of melanoma (n=123), sporadic multiple melanomas (n=65) and a melanoma associated with a skin carcinoma (n=13).', 'Overall, the c.1783G, p.595V allele was statistically associated with melanoma (respective allelic frequencies, 0.040 versus 0.022, P-value=1.17 x 10(-3), odds ratio (OR)=1.86 [1.27-2.71]), which was further confirmed by a meta-analysis including 274 patients and 174 matched controls from Italy (P-value=7.7 x 10(-4), OR=1.84 [1.29-2.63]). Interestingly, three non-synonymous POLH variants were identified in three patients (c.295G>A p.V99M, c.815T>C p.I272T and c.1745C>T p.S582L) which were absent in 352 chromosome controls from healthy subjects.']\nQuestion: Are variants of the xeroderma pigmentosum variant gene ( POLH ) associated with melanoma risk?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Expression of leukemia inhibitory factor (LIF) by a subset of Müller glia cells has recently been implicated in an endogenous survival response to photoreceptor injury in a model of inherited retinal degeneration. To investigate whether such a LIF-controlled survival pathway might be commonly induced upon photoreceptor injury independently of the nature of the toxic stimulus, we analyzed the role of LIF during light-induced retinal degeneration.', 'Lif(+/-) and Lif(-/-) mice were exposed to 15,000 lx of white light for 2 h. Retinal morphology and rhodopsin content were analyzed nine days after light exposure. Gene expression studies were done using real-time PCR. Protein levels were determined by western blotting using specific antibodies.', 'A lack of LIF reduced survival of photoreceptor cells after light exposure. In the absence of LIF several genes encoding molecules involved in the Janus kinase/signal transducer and activator of transcription (Jak/STAT) signaling pathway were not activated after light exposure. Presence or absence of LIF did not affect AKT (also known as protein kinase B, PKB) signaling and had only a mild effect on extracellular regulated kinase (ERK) phosphorylation. Stress-induced glial fibrillary acidic protein (GFAP) induction was minimal in the absence of LIF.']\nQuestion: Does endogenous leukemia inhibitory factor protect photoreceptor cells against light-induced degeneration?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Total knee arthroplasty is associated with a perioperative blood loss, which is usually addressed with transfusion of allogenic blood. The possible risks of such treatment include viral infection, immunologic complications and occasional lack of blood products. Recently, retransfusion of blood recovered from the operative field or drains has become an effective treatment for blood loss. The purpose of this study was to evaluate the clinical usefulness of autologous transfusion of blood recovered from drains and to determine if the retransfusion alone is sufficient for treatment of the perioperative blood loss.', 'A retrospective evaluation of 214 patients (240 knees) was performed. Standard suction drains were used in 127 cases, whereas in 113 cases we used the HandyVac retransfusion system. The comparative analysis included the preoperative haemoglobin level, surgery time, length of hospitalisation, incidence of fever and demand for allogenic blood transfusion.', 'Retransfusion of blood from drains decreased the incidence of allogenic transfusion from 69.3% to 43.4%. The global demand for blood products was reduced by 42%. The use of retransfusion kits did not increase surgery time. In the retransfusion group, the incidence of elevated body temperature and number of days with fever per one patient were higher than in the allogenic transfusion group.']\nQuestion: Does retransfusion of shed blood collected in drain after Total Knee Replacement?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['To examine the effects of neural cells on the stratification of and junctional protein expression by corneal epithelial cells with a coculture system.', 'PC12 cells induced to undergo neuronal differentiation or rat trigeminal nerve cells were cultured together with simian virus 40-transformed human corneal epithelial (HCE) cells on opposite sides of a collagen vitrigel membrane. Stratification of HCE cells was examined by immunofluorescence analysis with antibodies to zonula occludens-1. Expression of junctional proteins in HCE cells was assessed by RT-PCR and immunoblot analyses.', 'The presence of neural cells (PC12 cells or trigeminal neurons) markedly promoted the stratification of HCE cells as well as increased the amounts of N-cadherin mRNA and protein in these cells. These effects of the neural cells were mimicked by conditioned medium prepared from differentiating PC12 cells or by the neuropeptides substance P and calcitonin gene-related peptide (CGRP). Furthermore, the stimulatory effects of trigeminal neurons on the stratification of and N-cadherin expression by HCE cells were inhibited by antagonists of substance P or of CGRP.']\nQuestion: Do neuropeptides released from trigeminal neurons promote the stratification of human corneal epithelial cells?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['To investigate the deleterious effects of air pollutants exposure in the Sao Paulo metropolitan region on semen quality in systemic lupus erythematosus (SLE).', 'A seven-years longitudinal repeated-measures panel study was performed at the Laboratory of Experimental Air Pollution and Rheumatology Division. Two semen samples from 28 post-pubertal SLE patients were analyzed. Daily concentrations of air pollutants exposure: PM10, SO2, NO2, ozone, CO, and meteorological variables were evaluated on 90 days before each semen collection dates using generalized estimating equation models.', 'Intravenous cyclophosphamide (IVCYC) and ozone had an association with a decrease in sperm quality of SLE patients. IVCYC was associated with decreases of 64.3 million of spermatozoa/mL (95% CI 39.01-89.65; p=0.0001) and 149.14 million of spermatozoa/ejaculate (95% CI 81.93-216.38; p=0.017). With regard to ozone, the most relevant adverse effects were observed from lags 80-88, when the exposure to an interquartile range increase in ozone 9-day moving average concentration led to decreases of 22.9 million of spermatozoa/mL (95% CI 5.8-40.0; p=0.009) and 70.5 million of spermatozoa/ejaculate (95% CI 12.3-128.7; p=0.016). Further analysis of 17 patients that never used IVCYC showed association between exposure to ozone (80-88 days) and decrease of 30.0 million of spermatozoa/mL (95% CI 7.0-53.0; p=0.011) and 79.0 million of spermatozoa/ejaculate (95% CI 2.1-155.9; p=0.044).']\nQuestion: Does ozone decrease sperm quality in systemic lupus erythematosus patients?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Paracetamol clearance differs between pregnant and non-pregnant women and between women with or without specific oral contraceptives (OCs). However, an association between female sex hormones and paracetamol clearance has never been explored.', 'In total, 49 women at delivery, 8 female control subjects without OC use, historical data of 14 women taking OCs, and 15 postpartum observations with and without OCs were pooled to explore covariates of paracetamol clearance. All received a single intravenous 2-gram paracetamol dose, and blood samples were collected up to 6 h after dosing. High-performance liquid chromatography was used to quantify paracetamol. The area under the curve to time infinity (AUC0-∞) was determined and clearance (l/h·m(2)) was calculated by dose/ AUC0-∞. In addition, estradiol and progesterone were quantified by ELISA with electro-chemiluminescence.', 'Median paracetamol clearance at delivery was significantly higher when compared to postpartum or non-pregnant women (11.9 vs. 6.42 and 8.4 l/h·m(2), at least p < 0.05), while an association between paracetamol clearance and estradiol was observed (R = 0.494, p < 0.0001). In non-pregnant subjects, there was no impact of OC exposure on paracetamol clearance. Multiple regression revealed a linear association (Radj = 0.41, p < 0.001) between paracetamol clearance and weight (p = 0.0462) and estradiol (p < 0.0001).']\nQuestion: Are estradiol and weight covariates of paracetamol clearance in young women?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Respiratory dysfunction associated with severe sepsis is a serious condition leading to poor prognosis. Activation of coagulation is a consequence of and contributor to ongoing lung injury in severe sepsis. The purpose of this study was to examine the efficacy of recombinant human soluble thrombomodulin (rhTM), a novel anticoagulant agent, for treating patients with sepsis-induced disseminated intravascular coagulation (DIC) in terms of mortality and respiratory dysfunction.', 'This study comprised 86 consecutive patients with sepsis-induced DIC who required ventilator management. The initial 45 patients were treated without rhTM (control group), and the following 41 patients were given rhTM (0.06 mg/kg/d) for 6 days (rhTM group). Patients were followed up for 90 days after study entry. Sequential Organ Failure Assessment (SOFA) score and lung injury score were recorded until 7 days after entry.', 'The baseline characteristic of severity of illness was significantly higher in the rhTM group than in the control group. Nevertheless, 90-day mortality rate in the rhTM group was significantly lower than that in the control group (37% vs. 58%, p = 0.038). There was a significant difference in the serial change of SOFA score from baseline to day 7 between the two groups (p = 0.009). Both the respiratory component of the SOFA score and the lung injury score in the rhTM group were significantly lower compared with the control group (p = 0.034 and p < 0.001, respectively).']\nQuestion: Does recombinant human soluble thrombomodulin improve mortality and respiratory dysfunction in patients with severe sepsis?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['The objective of this study is to evaluate the prevalence of malocclusion and treatment needs in transfusion dependent β-thalassemia major children.', \"One hundred transfusion dependent β-thalassemia major children visiting the Department of Pediatrics were selected randomly and evaluated for malocclusion with Angle's classification and Dewey's modification. The orthodontic treatment needs were also assessed using Grainger's treatment priority index (TPI). The orthodontic treatment needs were compared to normal children.\", \"The assessment of treatment needs revealed a higher prevalence of handicapping and severely handicapping malocclusion in thalassemic children compared to normal children. The thalassemic patients were found to show significantly more Angle's Class II malocclusion (55% vs. 15.7%) when compared to normal children.\"]\nQuestion: Does prevalence of malocclusion and assessment of treatment need in β-thalassemia major children?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['It has been reported that anemia is more common in patients with diabetes mellitus, and that it occurs early in the disease process.', 'In this study, we evaluated hemoglobin (Hb) values of patients with diabetes type 1 or 2 from a large collective receiving care from a tertiary center. A total of 751 patients with type 1 diabetes and 3,306 patients with type 2 were studied. Correlations were calculated for Hb with the following parameters: metabolic control (HbA(1c) and blood glucose), renal function [estimated glomerular filtration rate (eGFR), serum creatinine, albuminuria, proteinuria], blood leukocytes, duration of diabetes and use of ACE inhibitors/AT1-receptor antagonists.', '17% of patients with type 1 diabetes and 14% of those with type 2 had anemia [defined as an Hb <8.5 mmol/l (<13.68 g/dl) in men and <7.5 mmol/l (<12.07 g/dl) in women). There was a close positive correlation between Hb and eGFR, and a negative correlation with albuminuria and proteinuria. These close associations were also confirmed with linear regression analysis. A significant negative correlation was observed between serum creatinine levels and Hb. There was no negative correlation between actual Hb and mean HbA(1c) in the individual follow-up periods. No correlation was found between blood glucose (morning and postprandial blood glucose) and Hb. Blood leukocyte numbers, as a parameter of systemic inflammation, were not correlated with Hb. The use of ACE inhibitors/AT1-receptor antagonists had no adverse effect on Hb in our study cohort.']\nQuestion: Are hemoglobin concentrations closely linked to renal function in patients with type 1 or 2 diabetes mellitus?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Serum levels of soluble vascular cell adhesion molecule 1 (sVCAM-1) shed from its membrane-bound form are elevated in hypertension. This study clarified the effects of sVCAM-1 on vascular responses in rat aortic smooth muscle cells (RASMCs).', \"Boyden chamber, 5-bromo-2'-deoxyuridine incorporation and ex vivo aortic ring assays for migration and proliferation, and Western blot for the kinase activity were used.\", 'Spontaneously hypertensive rats (SHR) and Wistar Kyoto (WKY) rats were compared functionally. sVCAM-1 increased RASMC migration and proliferation, which were greater in SHR compared with WKY rats. RASMCs expressed the very late antigen 4alpha receptor integrin with no difference between SHR and WKY rats. Inhibitors of phosphoinositide kinase 3 (PI3K) and spleen tyrosine kinase (Syk) and small interference RNA-Syk abolished the sVCAM-1-induced migration, proliferation and phosphorylation of focal adhesion kinase. The phosphorylation of Syk was significantly greater in RASMCs from SHR than from WKY rats. sVCAM-1 increased aortic sprout outgrowth, which was inhibited by inhibitors of PI3K and Syk.']\nQuestion: Does soluble form of vascular cell adhesion molecule 1 induce migration and proliferation of vascular smooth muscle cells?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Adipose-derived mesenchymal stem cells (MSCs) have been gaining fame mainly due to their vast clinical potential, simple isolation methods and minimal donor site morbidity. Adipose-derived MSCs and microvascular endothelial cells have been shown to bear angiogenic and vasculogenic capabilities. We hypothesized that co-culture of human adipose-derived MSCs with human adipose-derived microvascular endothelial cells (HAMECs) will serve as an effective cell pair to induce angiogenesis and vessel-like network formation in three-dimensional scaffolds in vitro.', 'HAMECs or human umbilical vein endothelial cells (HUVECs) were co-cultured on scaffolds with either MSCs or human neonatal dermal fibroblasts. Cells were immunofluorescently stained within the scaffolds at different time points post-seeding. Various analyses were performed to determine vessel length, complexity and degree of maturity.', 'The HAMEC:MSC combination yielded the most organized and complex vascular elements within scaffolds, and in the shortest period of time, when compared to the other tested cell combinations. These differences were manifested by higher network complexity, more tube alignment and higher α-smooth muscle actin expression. Moreover, these generated microvessels further matured and developed during the 14-day incubation period within the three-dimensional microenvironment.']\nQuestion: Do adipose-derived endothelial and mesenchymal stem cells enhance vascular network formation on three-dimensional constructs in vitro?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['To investigate the behavior and association of serum androgen and serum C-reactive protein (CRP) in patients undergoing controlled ovarian hyperstimulation (COH) for in vitro fertilization (IVF).', 'Prospective, observational study.Setting. An IVF unit of an academic medical center.', 'Blood was drawn three times during the COH cycle from 15 patients undergoing the long gonadotropin-releasing hormone-analog protocol: the day on which adequate suppression was obtained (Day-S); the day of or prior to administration of human chorionic gonadotropin (Day-hCG); and the day of ovum pick-up (Day-OPU). Levels of sex steroids and serum CRP were compared among the three time points.', 'There was a significant increase in serum ovarian androgen levels during gonadotropin treatment. After hCG administration, there was a significant increase in the levels of both serum CRP and ovarian androgens (testosterone, androstenedione), with no significant change in adrenal androgen (dehydroepiandrosterone). Significant correlations were observed between CRP and ovarian androgen levels but not with dehydroepiandrosterone sulfate or estradiol levels.']\nQuestion: Do ovarian androgens but not estrogens correlate with the degree of systemic inflammation observed during controlled ovarian hyperstimulation?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: [\"White matter hyperintensities (WMH) have an effect on cognition and are increased in severity among individuals with amnestic mild cognitive impairment (aMCI). The influence of WMH on progression of aMCI to Alzheimer's disease (AD) is less clear.\", 'Data were drawn from a three-year prospective, double blind, placebo controlled clinical trial that examined the effect of donepezil or vitamin E on progression from aMCI to AD. WMH from multiple brain regions were scored on MR images obtained at entry into the trial from a subset of 152 study participants using a standardized visual rating scale. Cox proportional hazards models adjusting for age, education and treatment arm were used to investigate the role of WMH on time to progression.', '55 of the 152 (36.2 %) aMCI subjects progressed to AD. Only periventricular hyperintensities (PVH) were related to an increased risk of AD within three years (HR = 1.59, 95 % CI = 1.24 - 2.05, p-value < 0.001). Correcting for medial temporal lobe atrophy or the presence of lacunes did not change statistical significance.']\nQuestion: Do periventricular white matter hyperintensities increase the likelihood of progression from amnestic mild cognitive impairment to dementia?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['To investigate whether the methodological quality is influenced by language of publication in reports of randomized controlled trials and controlled clinical trials of physiotherapy interventions.', 'Bibliometric and methodological quality data from all reports of trials indexed on the Physiotherapy Evidence Database (PEDro) up to February 2011 were extracted. Descriptive statistics on the total PEDro score and the 11 individual PEDro items were calculated for each language of publication and for all non-English-language reports combined. Regression models were calculated to predict the total PEDro score and the presence of each of the 11 items of the PEDro scale using the language of publication as an independent variable.', 'A total of 13,392 reports of trials were used for this study, 12,532 trials published in English and 860 published in other languages. Overall methodological quality was better for English reports than reports written in other languages (β = 0.15, 95% confidence interval = 0.04, 0.25). Specifically, reporting was better for items relating to random allocation, concealed allocation, and blinding of assessors, worse for more than 85% follow-up and intention-to-treat analysis, and no different for eligibility criteria and source specified, baseline comparability, blinding of subjects and therapists, reporting of between-group statistical comparisons, and reporting of point measures and measures of variability.']\nQuestion: Does language of publication have a small influence on the quality of reports of controlled trials of physiotherapy interventions?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['The effects of diabetes on the respiratory system were investigated with arterial blood gas, sleep quality index and respiratory functions tests.', 'Fifty-three patients with type II diabetes and 41 healthy cases were included. Their biochemical data, demographic characteristics, anthropometric measurements and echocardiographic findings were collected from polyclinic records. Respiratory function tests were performed for all subjects and Pittsburgh Sleep Quality Index questionnaire was conducted. Aforementioned data were compared between these two groups.', 'The age, body weight and body mass index were similar but oxygen pressure, oxygen saturation, forced vital capacity (FVC; %), and sleep quality were decreased in patients with diabetes. Sleep quality was correlated with the presence of diabetes and hypertension, duration of diabetes, fasting and postprandial blood glucose levels, homeostasis model of assessment-insulin resistance, Glycosylated hemoglobin levels, and FVC. Half of the diabetic patients exhibited respiratory failure during sleep. Especially diabetic patients with autonomic neuropathy, experienced a more severe and prolonged decrease in oxygen saturation.']\nQuestion: Does type 2 diabetes affect sleep quality by disrupting the respiratory function?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Bone marrow-derived mesenchymal stem cell (MSC) is widely studied in inflammatory bowel disease (IBD) in basic and clinical research. However, patients with IBD have higher risk of developing colorectal cancer and MSC has dual effect on tumorigenesis. This study aims to evaluate the role of MSC on tumorigenesis of IBD.', 'MSCs were isolated from the bone marrow of allogenic mice and identified by flow cytometry. Mice in the model of colitis-associated tumorigenesis induced by azoxymethane and dextran sulfate sodium were injected with MSCs. Colon length, spleen size and tumors formation were assessed macroscopically. Pro-inflammatory cytokines and STAT3 phosphorylation in colon tissues were analyzed.', 'MSCs ameliorated the severity of colitis associated tumorigenesis compared with PBS control, with attenuated weight loss, longer colons and smaller spleens. Tumor number and tumor load were significantly less in the MSC group while tumor size remained comparable. Histological assessment indicated MSCs could reduce histological damage of the colon tissue. Decreased expression of pro-inflammatory cytokines (TNF-α, IL-1β and IL-6), and down-regulation of STAT3 phosphorylation in colon tissue were found after MSC treatment.']\nQuestion: Do bone marrow mesenchymal stem cells ameliorate colitis-associated tumorigenesis in mice?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Matrix metalloproteinase-26 (MMP-26), one of the main mediators of extracellular matrix (ECM) degradation, has been shown to exist in trophoblasts of human placenta and to play a role in trophoblast cell invasion. However, little is known about the regulation of MMP-26 expression in human trophoblasts. Recently, gonadotropin-releasing hormone I (GnRH I) and GnRH II have been shown to regulate the expression of MMP-2, MMP-9/tissue inhibitor of metalloproteinases 1 (TIMP-1), and urokinase plasminogen activator (uPA)/plasminogen activator inhibitor (PAI) in human trophoblasts, suggesting that these two hormones may work as paracrine and/or autocrine regulators in modulating the activities of various protease systems at the feto-maternal interface. In this study, we determined the regulatory effects of GnRH I and GnRH II on the expression of MMP-26 in human immortalized cytotrophoblast-like cell line, B6Tert-1.', 'Real-time PCR was used to quantify mRNA levels of MMP-26 in human trophoblast-like cell line, B6Tert-1 and primary cultured cytotrophoblasts. Western blotting was used to characterize the expression of MMP-26 and the phosphorylation of c-Jun NH2-terminal kinase (JNK) and extracellular signal-regulated kinase 1/2 (ERK1/2) in B6Tert-1 cells after treatment with GnRH I and GnRH II.', 'We found that GnRH I increased MMP-26 expression in B6Tert-1 cells after 12 h of treatment at both the mRNA and protein level, while GnRH II increased MMP-26 expression beginning at 3 h of treatment. Treatment of GnRH I at 1 nM resulted in maximal increase of MMP-26 mRNA and protein levels, whereas GnRH II treatment at a concentration of 100 nM was required to induce maximal increase in MMP-26 expression. In addition, we demonstrated that the activation of JNK, but not ERK1/2, was required for GnRH I and II-stimulated MMP-26 production in B6Tert-1 cells and primary cytotrophoblasts.']\nQuestion: Do gnRH I and II up-regulate MMP-26 expression through the JNK pathway in human cytotrophoblasts?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['Optical and spectroscopic technologies working at subcellular resolution with quantitative output are required for a deeper understanding of molecular processes and mechanisms in living cells. Such technologies are prerequisite for the realisation of predictive biology at cellular and subcellular level. However, although established in the physical sciences, these techniques are rarely applied to cell biology in the plant sciences.', 'Here, we present a combined application of one-chromophore fluorescence lifetime microscopy and wavelength-selective fluorescence microscopy to analyse the function of a GFP fusion of the Brassinosteroid Insensitive 1 Receptor (BRI1-GFP) with high spatial and temporal resolution in living Arabidopsis cells in their tissue environment. We show a rapid, brassinolide-induced cell wall expansion and a fast BR-regulated change in the BRI1-GFP fluorescence lifetime in the plasmamembrane in vivo. Both cell wall expansion and changes in fluorescence lifetime reflect early BR-induced and BRI1-dependent physiological or signalling processes. Our experiments also show the potential of one-chromophore fluorescence lifetime microscopy for the in vivo monitoring of the biochemical and biophysical subcellular environment using GFP fusion proteins as probes.']\nQuestion: Does novel application of fluorescence lifetime and fluorescence microscopy enable quantitative access to subcellular dynamics in plant cells?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['To study the relation between SUVmax, hypoxia inducible factor 1α (HIF-1α), angiogenetic factor adrenomedullin (AM) and antiapoptotic factor Bcl-2 in endometrial cancer.', 'Thirthy eight patients who were diagnosed after a preoperative endometrial biopsy with endometrium cancer underwent pre-operative positron emission tomography/computed tomography (PET/CT) utilizing fluorine-18-fluorodeoxy glucose (¹⁸F-FDG). Maximum standardized uptake values (SUVmax) of the primary tumor were measured. After hysterectomy and bilateral salpingo-oophorectomy, microscopic slides of the 38 endometrial adenocarcinoma patients were evaluated by a surgical pathologist to confirm the diagnosis. Immunohistochemical staining for AM, Bcl-2 and HIF-1α was studied.', 'In all patients, ¹⁸F-FDG uptake was detected. The mean SUVmax of the tumors was 11.8 ± 5.9. Although SUVmax was higher in HIF-1α positive tumors, this finding was not statistically important. No correlation was found between SUVmax and HIF-1α positivity. Mean SUVmax was 6.4 ± 3 and 12.3 ± 1.4 in AM negative and AM positive patients, respectively. Mean SUVmax was 10.6 ± 4.9 and 12.3 ± 1.4 in Bcl-2 negative and Bcl-2 positive patients, respectively. We found no correlation between SUVmax, AM or Bcl-2 expression. Allred scores were not related with SUVmax in regression analysis.']\nQuestion: Are hypoxia-inducible factor-1α , adrenomedullin and Bcl-2 although expected related to increased uptake of fluorine-18-fluorodeoxyglucose in endometrial cancer?\nAnswer:",
"role": "user"
},
{
"content": " no",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['The role of serotonin (5-hydroxytrptamine, 5-HT) in the modulation of pain has been widely studied. Previous work led to the hypothesis that 5-hydroxyindolacetic acid (5-HIAA), a main metabolite of serotonin, might by itself influence pain thresholds.', \"In the present study, we investigated the role of 5-HIAA in inflammatory pain induced by intraplantar injection of complete Freund's adjuvant (CFA) into the hind paw of mice. Wild-type mice were compared to mice deficient of the 5-HT transporter (5-HTT-/- mice) using behavioral tests for hyperalgesia and high-performance liquid chromatography (HPLC) to determine tissue levels of 5-HIAA. Wild-type mice reproducibly developed thermal hyperalgesia and paw edema for 5 days after CFA injection. 5-HTT-/- mice treated with CFA had reduced thermal hyperalgesia on day 1 after CFA injection and normal responses to heat thereafter. The 5-HIAA levels in spinal cord and sciatic nerve as measured with HPLC were lower in 5-HTT-/- mice than in wild-type mice after CFA injection. Pretreatment of wild-type mice with intraperitoneal injection of para-chlorophenylalanine (p-CPA), a serotonin synthesis inhibitor, resulted in depletion of the 5-HIAA content in spinal cord and sciatic nerve and decrease in thermal hyperalgesia in CFA injected mice. The application of exogenous 5-HIAA resulted in potentiation of thermal hyperalgesia induced by CFA in 5-HTT-/- mice and in wild-type mice pretreated with p-CPA, but not in wild-type mice without p-CPA pretreatment. Further, methysergide, a broad-spectrum serotonin receptor antagonist, had no effect on 5-HIAA-induced potentiation of thermal hyperalgesia in CFA-treated wild-type mice.\"]\nQuestion: Is 5-hydroxyindolacetic acid ( 5-HIAA ) , a main metabolite of serotonin , responsible for complete Freund 's adjuvant-induced thermal hyperalgesia in mice?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['The TNF2 allele at position -308 of the tumor necrosis factor (TNF)-alpha gene is associated with high TNF production. The purpose was to study the association of this gene polymorphism with rejection episodes and graft survival after kidney transplantation.', 'A retrospective analysis of transplant outcomes of patients who only had been treated with one single form of immunosuppression consisting of cyclosporine, azathioprine, and prednisolon was performed.', 'We found that 115 (73%) patients had the TNF1/TNF1 genotype, whereas 42 (27%) were TNF2 positive. There was no difference in the overall acute rejection frequency between these two groups (50% in each), but our data showed a non-significant tendency towards a higher frequency of steroid resistant rejections in the TNF2 positive group (57% vs. 40%). There was no significant difference in graft survival between the two genotype groups, although an early tendency towards worse survival was seen in TNF2 recipients. However, the TNF2 positive recipients with rejection episodes had far worse graft survival compared with the TNF1/TNF1 recipients with rejection episodes (P<0.02). No difference was seen between the two genotype groups in patients without rejection episodes.']\nQuestion: Is impaired kidney graft survival associated with the TNF-alpha genotype?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
[
{
"content": "You are a helpful assistant. Given the following list of abstracts, please answer the question with either yes, no or maybe.\nAbstracts: ['The prevalence of both hypertension and obstructive sleep apnea (OSA) are increased in patients with age greater than 60\\xa0years. We studied the clinical differences of OSA in hypertensive patients with age greater or less than 60\\xa0years. In addition, rate of OSA-induced hypertension in Thai population is limited.', 'We retrospectively reviewed medical records of patients treated at the hypertension/sleep clinic at Srinagarind Hospital, Khon Kaen University, between 2010 and 2011. The inclusion criteria used were hypertensive patients who had at least one symptom of OSA and had been tested for the sleep study. Rate and clinical features of OSA were studied and categorized by age of 69\\xa0years. Factors associated with likelihood of having OSA in hypertensive patients age over 60\\xa0years were identified by multiple logistic regression analysis.', 'During the study period, 49 patients met the criteria. Of those, 42 patients (85.71\\xa0%) had an apnea-hypopnea index (AHI) of more than 5/h. The average AHI was 22.22\\u2009±\\u200913.86 times/h. The common symptoms of OSA were snoring (100\\xa0%), daytime sleepiness (28.57\\xa0%), unexplained nocturia (28.57\\xa0%), and gastroesophageal reflux disease (28.57\\xa0%). The numbers of patients with age less than 60\\xa0years and more than 60\\xa0years were 20 and 22 cases, respectively. Most patients (88.10\\xa0%) had well-controlled blood pressure level. Only BMI was significantly associated with OSA-induced hypertension in patients aged over or equal to 60\\xa0years. The adjusted odds ratio was 0.743 (0.560, 0.985).']\nQuestion: Is lower BMI a predictor of obstructive sleep apnea in elderly Thai hypertensive patients?\nAnswer:",
"role": "user"
},
{
"content": " yes",
"role": "assistant"
}
] |
Subsets and Splits